CN116676307A

CN116676307A - Vascular bundle and meristem efficient expression promoter of corn root and application thereof

Info

Publication number: CN116676307A
Application number: CN202310636341.7A
Authority: CN
Inventors: 李素贞; 陈景堂; 陈茹梅; 柳小庆; 周晓今; 杨文竹
Original assignee: Biotechnology Research Institute of CAAS; Qingdao Agricultural University
Current assignee: Biotechnology Research Institute of CAAS; Qingdao Agricultural University
Priority date: 2023-06-01
Filing date: 2023-06-01
Publication date: 2023-09-01
Anticipated expiration: 2043-06-01
Also published as: CN116676307B

Abstract

The invention discloses a vascular bundle and meristem efficient expression promoter of corn roots and application thereof. The polynucleotide sequence of the ZmIRT1 promoter is shown in a sequence table SEQ ID No:1. the invention clones the promoter of ZmIRT1, and discovers that the exogenous gene driven by the promoter is mainly expressed in the vascular bundle and the meristem of plant roots. The promoter is used for carrying out gene modification on crop varieties, for example, the promoter is used for regulating and controlling the efficient expression of target genes in vascular bundles and meristems of roots, so that the physiological mechanism of corn transport and flow can be clarified, and a physiological foundation is laid for high yield of corn.

Description

Vascular bundle and meristem efficient expression promoter of corn root and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a vascular bundle and meristem efficient expression promoter of corn roots and application thereof.

Background

Corn is one of the most main grain crops, with the development of economy, the global requirement on corn yield and quality is raised more and more, and the genetic modification method is used for improving corn yield per unit and corn quality, so that the method has positive significance.

The stem bundle of corn stalk is an external tough stem bundle, the xylem is composed of 3-4 larger ducts which are arranged in V shape, the two large ducts at the upper end are metawood parts, and the lower end is composed of two ducts with smaller diameters. In the continued elongation of the stems, the vessels of the native xylem tend to tear by pulling, leaving a cavity in the bundle. Phloem is also composed of sieve tubes, companion cells and phloem parenchyma cells. The primordial phloem is extruded to the outermost, has lost function, does not form a layer between the xylem and phloem, and has several thick parietal cells surrounding it outside the bundle, which is the bundle sheath formed by the fibers. The vascular bundles are channels for transporting water, inorganic salts and organic substances through the corns.

The number of the vascular bundle specific promoters which are identified at present is small, and the vascular bundle specific expression promoters which are reported mainly comprise: bean GRP118, rice POsvas 1, arabidopsis profile 2 gene, and promoters of bean phenylalanine ammonia lyase PAL gene, etc. At present, no related report of a high-efficiency expression promoter of a vascular bundle of corn sources exists.

Disclosure of Invention

The invention aims to provide a vascular bundle and meristem efficient expression promoter of corn roots and application thereof.

A ZmIRT1 promoter, the polynucleotide of the ZmIRT1 promoter being as set forth in (a), (b), (c) or (d):

(a) As shown in a sequence table SEQ ID No: 1; or (b)

(b) And SEQ ID No:1, which can hybridize under stringent hybridization conditions, and which can promote efficient expression of genes in the vascular bundles and meristems of corn roots;

(c) And SEQ ID No:1, a polynucleotide having at least 90% or more homology to the polynucleotide shown in (a); or (b)

(d) In SEQ ID No:1, and the polynucleotide mutant can promote the efficient expression of the gene in the vascular bundle and the meristem of corn root.

A vector comprising the ZmIRT1 promoter.

Engineering bacteria comprising the ZmIRT1 promoter vector.

And detecting a primer of any fragment of the ZmIRT1 promoter.

The ZmIRT1 promoter is applied to the efficient expression of the exogenous gene in the vascular bundle and the meristem of plant roots.

The plant is corn.

The invention has the beneficial effects that: the invention clones the promoter of ZmIRT1 and finds that the exogenous gene driven by the promoter is mainly expressed in the vascular bundle and the meristem of plant roots. The promoter is used for carrying out gene modification on crop varieties, for example, the promoter is used for regulating and controlling the efficient expression of target genes in vascular bundles of roots, so that the physiological mechanism of corn transport and flow can be clarified, and a physiological foundation is laid for high yield of corn.

Drawings

FIG. 1 is a block diagram of pEASY-ZmIRT1PRO vector.

FIG. 2 is a block diagram of pUM3G-ZmIRT1PRO-GUS vector.

FIG. 3 shows GUS staining and paraffin section results; A-D is GUS staining results, E-H is paraffin section results.

FIG. 4 shows the results of ZmIRT1 in situ hybridization; the left and right panels show lateral root meristematic region, shoot tip meristem and leaf cross-sectional mesophyll cells and bundles using antisense and sense probes of ZmIRT1, respectively, with hybridization signals indicated by arrows on a scale of 100 μm.

Detailed Description

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

EXAMPLE 1 cloning of ZmIRT1 promoter and construction of transformation vector

Cloning of ZmIRT1 promoter: 1947bp of the ZmIRT1 gene ATG upstream was obtained, ecoRI and XbaI restriction sites were added to the 5 'and 3' ends, respectively, and PCR amplification was performed using KOD mix, and the obtained target fragment was ligated between EcoRI and XbaI of the pUM3G vector to initiate GUS gene expression. The nucleotide sequence of the ZmIRT1 promoter is shown in a sequence table SEQ ID NO:1.

Construction of pEASY-ZmIRT1PRO intermediate vector:

primers used for ZmIRT1 promoter amplification:

ZmIRT1PROF：GAATTCTGGTGAGGCATCAGACATGG；

ZmIRT1PROR：TCTAGACTTT GCTCTCAGCT TAGCTA；

the ZmIRT1PRO fragment was ligated to the intermediate vector pEASY-Blunt (FIG. 1), designated pEASY-ZmIRT1PRO.

Construction of pUM3G-ZmIRT1PRO-GUS stable transformation vector: pUM3G-GUS and pEASY-ZmIRT1PRO vectors were digested with EcoRI and XbaI, respectively, and pUM3G-GUS vectors were recovered, zmIRT1PRO fragments were ligated with T4 ligase to form pUM3G-ZmIRT1PRO-GUS final vector (FIG. 2), and Agrobacterium was transformed for maize genetic transformation.

Example 2 Agrobacterium-mediated stable maize transformation

1) Taking young corn ears after pollination for about 10 days, removing bracts and filaments to strip young embryos, ensuring the diameter of the young embryos to be 1.5-2mm, sterilizing the young corn ears in 5% sodium hypochlorite for 30min, and washing with sterile water for three times.

2) Young embryos are carefully removed in an ultra clean bench and placed in 2.0mL centrifuge tubes with liquid infection medium added.

3) The agrobacterium cells on the YEB medium are scraped into a liquid infection medium and are used for infection when the agrobacterium cells are cultured for 1-2 hours at 28 ℃ until the temperature reaches to OD 550=0.35-0.40.

4) The young embryo is washed for 2 times by liquid infection culture medium, 1.5mL of prepared agrobacterium is added into the suction culture medium, the mixture is inverted and mixed for 20 times, and the mixture is kept stand for 5min in a dark place.

5) Pouring the embryo into a plate filled with 3 sterile filter papers, and transferring the young embryo to a co-culture medium after the bacterial liquid is sucked by the filter papers, and culturing in dark at 24 ℃ for 3-4 days.

6) The young embryos are transferred to recovery medium and dark cultured at 28℃for 7-10 days.

7) The young embryos are transferred to selection medium and dark cultured at 28℃for 1 sub-culture every 2 weeks.

8) After 2-3 generations of screening, obviously proliferation resistant calli appear, and the resistant calli are singly picked out and are further propagated on a screening culture medium.

9) The callus with good condition is selected and transferred to regeneration culture, and dark culture is carried out at 28 ℃ for 10-14 days, and embryoid body is formed at this stage.

10 Transferring the embryoid bodies formed by induction to rooting medium, and culturing at 25 ℃ by light, wherein regenerated seedlings are generated at the stage. After the seedlings grow to 3-5cm, transferring the seedlings into a glass tube filled with rooting culture medium, and continuing to carry out illumination culture at 25 ℃.

11 After the seedlings grow to 12-15cm, transplanting the seedlings into a greenhouse.

EXAMPLE 3GUS histochemical staining and Paraffin section

The formulation of the 500mL system is shown in the following Table:

TABLE 1GUS dye liquor formulation

The roots of different parts are taken and placed into a large centrifuge tube, GUS dye solution is added, the mixture is placed at 37 ℃ for dyeing overnight, and the mixture is washed by deionized water and then photographed.

Preparation of paraffin sections:

1) Dehydrating: the material is placed (preferably 4 ℃ C. And slightly shaken) in sequence of 30%, 50%, 70% (the material can be stored for up to 6 months at this step 4 ℃ C.), 85%, 90%, 100% ethanol, 0.5-1h per step. If the seeds are seeds which are 20-25d after pollination, the time can be increased to 2-3h;

2) And (3) transparency: (Room temperature and slightly shaking) 25% xylene-75% ethanol, 50% xylene-50% ethanol, 75% xylene-25% ethanol, 100% xylene, 0.5-1h per step, if it is 20-25d seed after pollination, the time can be increased to 2-3 hours, 50% xylene-50% paraffin (melted), 42 ℃ overnight;

3) Wax dipping: 100% pure wax, preserving heat at 60 ℃ for 3d, and replacing the pure wax for 6 times during the period;

4) Embedding: rapidly cooling the material after embedding, and preserving at 4 ℃ for a short period;

5) Slicing: cutting the blocks in the afternoon of the previous day until the materials are exposed, placing the cut of the materials on ice overnight, and cutting the materials when the materials are cool the next day;

6) Photographing.

The results are shown in FIG. 3, where GUS staining and paraffin sections showed that the ZmIRT1 promoter-driven GUS protein expression was mainly distributed in the vascular bundles and meristems of maize roots.

Example 4 in situ hybridization experiments

In situ hybridization probe primers are shown in Table 2:

TABLE 2

Planting the seed of the maize inbred line B73 in nutrient soil, illuminating for 18h and darkening for 6h,when the temperature is 30 ℃, the seedling grows to three leaves and one heart, the materials are obtained, and the leaves are cut into 1cm ² Is a small block of (2); taking out and cleaning the root, and cutting into 1-2cm long; the stem tip is peeled about 1 cm. Respectively placing the above-mentioned materials into embedding boxes to make them be fixed in fixing liquor. And respectively placing the embryo and endosperm of 15d and 20d after pollination into an embedding box and fixing in a fixing solution.

Preparation and experimental procedures of in situ hybridization probes:

acquisition and linearization of the probe:

the probes were amplified using primers (Table 2) for the synthetic probes, ligated into pEASY-T3 vector, sequenced to verify the sequence correctness, and linearized with the corresponding enzyme.

In vitro transcription:

TABLE 3 in vitro transcription System

And (3) probe purification:

1. 1. Mu.L of Glycogen was added to the reaction system;

2. adding 1/10 volume of 4M LiCl and 2.5-3 times of absolute ethyl alcohol precooled at-20 ℃ to precipitate nucleic acid;

3. precipitating at-70deg.C for 30min or overnight at-20deg.C;

4、4℃，13,000×g，15min；

5. removing the supernatant, adding 100 mu L of 75% ethanol, and washing the precipitate;

6、4℃，13,000×g，5min；

7. removing supernatant, and drying and precipitating;

8. dissolving with appropriate amount of TE, and preserving at-70deg.C;

9. the MOPS formaldehyde denatured gel roughly quantified RNA probe concentration.

In situ hybridization:

50-100 ng/. Mu.L of in situ hybridization probe; (T7) anti-sense (Sp 6) sense.

1. Fixing materials: pumping air for 0.5-2 hours at room temperature in the FAA fixing solution; in the case of seeds 20-25 days after pollination, the time can be increased to 6-8 hours, after which the fresh preparation of fixative is changed to room temperature (preferably 4 ℃ C. And slightly shaken) for more than 12 hours (overnight).

2. Dehydrating: (preferably 4 ℃ C. And slightly shaking) 30%, 50%, 70% (the material can be stored at this step 4 ℃ C. For up to 6 months), 85%, 90%, 100% ethanol, 0.5-1h per step, and if it is a seed 20-25 days after pollination, the time can be increased to 2-3 hours.

3. And (3) transparency: (Room temperature and slightly shaking) 25% xylene-75% ethanol, 50% xylene-50% ethanol, 75% xylene-25% ethanol, 100% xylene, 0.5-1h per step, if seed 20-25 days after pollination, the time can be increased to 2-3 hours, 50% xylene-50% paraffin (melted), 42℃overnight.

4. Wax dipping: 100% pure wax, kept at 60 ℃ for 3 days, and replaced 6 times during the period.

5. Embedding: after embedding, the material is cooled rapidly and stored for a short period at 4 ℃.

6. Slicing: the previous afternoon was trimmed, sliced to expose the material, the material cut was placed on ice overnight, and the next day was sliced while cold.

7. Spreading: the DEPC treatment water is added on the slide glass, the wax belt is placed on the water, the redundant water is sucked off after the slide glass is unfolded, and the slide glass is baked for 1-2 days at 42 ℃.

8. Dewaxing and rehydrating: 100% xylene room temperature for 10 minutes, 50% xylene-50% ethanol room temperature for 2 minutes; 100% ethanol, 90% ethanol, 70% ethanol, 50% ethanol, 30% ethanol, 10% ethanol, H ₂ O, 2 minutes per step at room temperature, (ethanol gradient was set up at 100% xylene room temperature for 20 minutes, after which K buffer was pre-heated).

9. Proteinase K treatment: after preheating the K buffer at 37℃PK (mother liquor concentration 10 mg/mL) was added to a final concentration of 2.5. Mu.g/mL and treated at 37℃for 15 minutes. DEPC treated water was washed 3 times at room temperature for 2min each time.

10. Acetylation: in 100mM triethanolamine pH8.0 for 10min. Acetic anhydride was then added to a final concentration of 0.25% (m/V), and the mixture was left at room temperature for 10min,2 XSSC, and at room temperature for 5min, twice.

11. Dehydrating: 10% ethanol, 30% ethanol, 50% ethanol, 70% ethanol, 90% ethanol, 100% ethanol, each step at room temperature for 2 minutes, and oven drying the slide glass at 42 deg.C for about 1 hr, and hybridization or preservation at-20deg.C for a period of time. (in this case, 0.3M NaCl-50% formamide was used to prepare a wet chamber, and a hybridization solution was prepared).

12. Hybridization: hybridization solution A77.2. Mu.L; hybridization solution B22.8. Mu.L (1. Mu.LRNA probe+17.8. Mu.L EPC water+1.5. Mu.L tRNA+2.5. Mu.L LPolyA), denaturation at 80℃for 5min, immediate placement on ice, pre-heating of hybridization solution at 42℃and 100. Mu.L/piece, even spreading on glass slides, capping Parafilm, filling wet chamber with 0.3MNaCl-50% formamide saturated filter paper, hybridization overnight at 50-55 ℃.

13. And (3) film washing: 40mL of 2 XSSC pre-warmed at 37℃for 20 minutes at room temperature, three times.

14. RNase A treatment: RNase buffer was preheated at 37℃and RNase A was added to a final concentration of 25. Mu.g/mL, and the mixture was placed in a slice at 37℃for 30 minutes. (100. Mu.L of 10mg/mL RNase A was added to 40mL RNase buffer).

15. Wash RNase a: RNase buffer pre-heated at 37℃was washed for 10 minutes twice.

16. Low/high stringency wash-out: 2 XSSC (650 mL) was stirred at a low speed with a small rotor at room temperature for 30 minutes, 0.5 XSSC was stirred at 55℃for 30 minutes, and the film was washed.

17. And (3) film washing: 1 XPBS room temperature for 5 minutes (this step may be at 4℃overnight).

18. Closing: blocking was performed in a blocking solution of 0.5% for 60 minutes at room temperature. (stock Reagent and 1 XPBS).

19. Washing 1 XPBS for 5min at room temperature.

20. Antibody incubation: anti-DIG-AP (1:500 dilution) (1. Mu.L anti-DIG-AP+50. Mu.L 10mg/mL BSA+450. Mu.L 1 XPBS) was incubated at room temperature for 60-120 min, and the wet chamber was filled with filter paper saturated with 1 XPBS.

20. And (3) film washing: 1 XPBT (650 ml) for 10 minutes at room temperature, three times. The film is agitated at low speed by a small rotor during film washing.

21. And (3) film washing: 1 XTNM 50 for 5 minutes at room temperature.

22. Color development: 2% NBT/BCIP (formulated with TNM 50) was developed for more than 30 minutes in the dark at room temperature.

23. And (3) terminating: the reaction was stopped in TE.

24. Microscopic examination, adding glycerol dropwise to prevent drying and photographing.

25. Sealing piece: sequentially treating with 30%, 50%, 70%, 85%, 95%, 100% ethanol at room temperature for 2min. After which the mixture was treated with xylene at room temperature for 5min 2 times. The neutral resin was carefully capped with a coverslip and the resin that overflowed around the slide was washed off with xylene.

26. And baking the slices at 42 ℃ for 2 days, and performing microscopic examination and photographing.

As a result, zmIRT1 is expressed mainly in the vascular bundle and meristem of the root (arrow), as shown in FIG. 4, and this result indicates that ZmIRT1 promoter is a promoter for the vascular bundle and meristem expression of the root.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. A ZmIRT1 promoter, wherein the polynucleotide of the ZmIRT1 promoter is as set forth in (a), (b), (c) or (d):

(a) As shown in a sequence table SEQ ID No: 1; or (b)

2. A vector comprising the ZmIRT1 promoter of claim 1.

3. An engineered bacterium comprising the ZmIRT1 promoter vector of claim 2.

4. A primer for detecting any fragment of the ZmIRT1 promoter of claim 1.

5. The ZmIRT1 promoter of claim 1 for promoting efficient expression of exogenous genes in vascular bundles and meristems of plant roots.

6. The use of ZmIRT1 promoter according to claim 5 for promoting efficient expression of exogenous gene in vascular bundles and meristems of plant root, wherein said plant is maize.