CN116640789A

CN116640789A - Ribo-OFF space-time specific gene silencing technique and use thereof

Info

Publication number: CN116640789A
Application number: CN202310361433.9A
Authority: CN
Inventors: 邹炜; 方洁; 陈宝惠
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2023-03-30
Filing date: 2023-03-30
Publication date: 2023-08-25

Abstract

The application discloses a Ribo-OFF space-time specific gene silencing technology and application thereof. Specifically, the application establishes a gene expression control tool formed by combining ribozyme and specific recombinase, and can realize the state from 'on' to 'off' of endogenous gene expression in time and space.

Description

Ribo-OFF space-time specific gene silencing technique and use thereof

Technical Field

The application belongs to the fields of molecular biology and biological medicine, and in particular relates to a system for performing space-time specificity on the expression of an organism endogenous gene and application thereof.

Background

In the post-genomic era, one of the most challenging directions of research is to assess the function of specific genes in development and disease. For this reason, disruption of specific genes to construct a loss-of-function mutant model is a very important experimental approach.

At the DNA level, CRISPR/Cas9 mediated gene-targeted induced mutation has proven to be a very efficient approach. At the RNA level, RNA interference and recently developed CRISPR interference techniques can be conveniently subjected to high throughput experiments. However, these methods have potential off-target effects.

At the protein level, methods such as Degron-induced protein degradation are only applicable to part of the protein and there may be leakage of expression. Some proteins are difficult to degrade due to their presence in specific subcellular locations or their high stability characteristics.

Accordingly, those skilled in the art are working to develop novel expression manipulation tools for endogenous genes from "on" to "off".

Disclosure of Invention

The application aims to provide a gene expression control system.

In a first aspect of the present application, there is provided a gene expression control system comprising a first nucleic acid construct comprising a structure represented by formula I,

5'G-M-T3', formula I

In formula I, G is a DNA fragment optionally labeled with a gene; m is a DNA fragment comprising a terminator and a specific recombination site; t is a DNA fragment of a ribozyme gene; each "-" is a bond or a linking sequence;

the gene expression control system further includes a site-specific recombinase that recognizes the specific recombination site, the gene expression control system being configured to have a first state (On) and a second state (OFF):

when the gene expression control system is in a first state, the specific recombination site is not recognized by the site-specific recombinase so that no gene recombination occurs, and the terminator functions to prevent transcription of ribozymes;

when the gene expression control system is in the second state, the site-specific recombinase recognizes the specific recombination site and performs gene recombination so as to delete the terminator, thereby realizing normal transcription of the ribozyme.

In another preferred embodiment, the gene expression control system comprises a regulated specific recombinase-encoding gene, the site-specific recombinase-encoding gene being not expressed when the gene expression control system is in the first state, the terminator functioning to prevent transcription of the ribozyme;

when the gene expression regulation system is in a second state, the site-specific recombinase encodes gene expression and recognizes that the specific recombination site is subjected to gene recombination so as to delete the terminator, thereby realizing normal transcription of ribozymes.

In another preferred embodiment, the specific recombinase is Cre recombinase and the specific recombination site is a LoxP site.

In another preferred embodiment, when the gene expression control system is in the first state, recombinase Cre is not expressed, the terminator is transcribed, but the ribozyme sequence is not transcribed, so that mRNA of the gene of interest is stably expressed;

when the gene expression control system is in the second state, the specific recombination site is recognized by the site-specific recombinase so that gene recombination occurs, the terminator is deleted, and the ribozyme sequence is transcribed together with the target RNA, resulting in cleavage and degradation of the target RNA by the ribozyme.

In another preferred embodiment, the structure of M is as follows:

5' LoxP-terminator-LoxP '3'.

In another preferred embodiment, the label is a reporter; preferably, the reporter is a fluorescent protein or fluorescein.

In another preferred example, the fluorescent protein is a red fluorescent protein (e.g., tdTomato, dsRed, mCherry), a green fluorescent protein (e.g., eGFP, zsGreen), a Yellow Fluorescent Protein (YFP), a Blue Fluorescent Protein (BFP), a cyan fluorescent protein gene (CFP), etc.

In another preferred embodiment, the terminator is a let-858 terminator.

In another preferred embodiment, the ribozyme is a T3H38 ribozyme.

In another preferred embodiment, the ribozyme has spacers on both sides to optimize its spatial conformation.

In another preferred embodiment, the first nucleic acid construct is disposed downstream of the gene to be regulated (gene of interest); preferably, the gene to be regulated includes an essential gene and a lethal gene.

In another preferred embodiment, the gene expression control system controls the expression or non-expression of the gene encoding the site-specific recombinase via a promoter.

In another preferred embodiment, the promoter is an inducible promoter or a tissue-specific promoter; preferably, for example, a heat shock promoter.

In a second aspect of the present application, there is provided a nucleic acid construct comprising a structure represented by formula I:

5'G-M-T3', formula I

In formula I, G is a DNA fragment optionally labeled with a gene; m is a DNA fragment comprising a terminator and a specific recombination site; t is the DNA sequence of the ribozyme gene; each "-" is a bond or a linking sequence.

In another preferred embodiment, the nucleic acid construct comprises a structure of formula I':

5' HA-G-M-T-3' HA of formula I '

In formula I', G is a DNA fragment optionally labeling the gene; m is a DNA fragment comprising a terminator and a specific recombination site; t is a DNA fragment of a ribozyme gene; the 5'HA is a homology arm at the 5' end of the site to be inserted; the 3'HA is a homology arm at the 3' end of a site to be inserted; each "-" is a bond or a linking sequence.

In another preferred embodiment, the structure of M is as follows:

5' LoxP-terminator-LoxP '3'.

In another preferred embodiment, the terminator is a let-858 terminator.

In another preferred embodiment, the ribozyme is a T3H38 ribozyme.

In another preferred embodiment, the first nucleic acid construct is disposed downstream of the gene to be regulated; preferably, the gene to be regulated includes an essential gene and a lethal gene.

In a third aspect of the application, there is provided an expression cassette comprising a nucleic acid construct according to the second aspect of the application.

Preferably, the expression cassette is used as a recombinant donor template within a species. The nucleic acid construct is inserted into the gene of interest by homology-arm mediated DNA repair (HDR).

In a fourth aspect of the application there is provided an expression vector comprising an expression cassette according to the third aspect of the application.

In another preferred embodiment, the expression vector is a plasmid.

In a fifth aspect of the application there is provided a kit for use in the preparation of a transgenic engineered line, the kit comprising an expression vector according to the fourth aspect, an expression cassette according to the third aspect of the application, or a nucleic acid construct according to the second aspect of the application.

In another preferred embodiment, the kit further comprises a Cas9 protein expression plasmid.

In another preferred embodiment, the kit further comprises an sgRNA expression plasmid template.

In a sixth aspect, the present application provides the use of the gene expression control system according to the first aspect of the present application in the control of gene expression in a living body.

In another preferred example, the living body is an animal, a plant, a microorganism (eukaryotic microorganism) or a cell (animal cell, plant cell).

In another preferred embodiment, the gene regulation is regulation at endogenous levels.

In another preferred embodiment, the use is for detecting the tissue or time at which a gene of interest (gene to be regulated) is functioning.

In another preferred example, the gene of interest may be various genes including essential genes or lethal genes.

In a seventh aspect of the present application, there is provided a method of gene regulation, the method comprising the steps of:

constructing a gene expression control system in said living organism, said gene expression control system comprising a first nucleic acid construct comprising a structure of formula I,

5'G-M-T3', formula I

In another preferred embodiment, the site-specific recombinase is not expressed when the gene expression control system is in the first state, and the terminator functions to prevent transcription of the ribozyme;

when the gene expression regulation system is in a second state, the site-specific recombinase expresses and recognizes that the specific recombination site undergoes gene recombination so as to delete the terminator, thereby realizing normal transcription of ribozymes.

In another preferred embodiment, the living organism is an animal (e.g., nematode, zebra fish, mouse, monkey, dog), a plant (e.g., arabidopsis, rice, wheat, corn), a microorganism (e.g., eukaryotic microorganism, yeast) or a cell (e.g., ex vivo animal cell, ex vivo plant cell).

In another preferred embodiment, the gene expression control system controls the expression or non-expression of the site-specific recombinase via a promoter.

In another preferred embodiment, the method comprises the steps of:

(i) Providing a first parent of a stable expression specific recombinase under the control of a promoter;

(ii) Providing a second parent into which the first nucleic acid construct is inserted downstream of the gene of interest (where the gene is expressed in the "On" state);

(iii) Crossing the first parent and the second parent and obtaining a progeny life body having the gene expression control system.

In another preferred embodiment, the structure of M is as follows:

5' LoxP-terminator-LoxP '3'.

In another preferred embodiment, the terminator is a let-858 terminator.

In another preferred embodiment, the ribozyme is a T3H38 ribozyme.

In another preferred embodiment, the method employs a CRISPR/Cas tool to achieve gene stable integration.

In another preferred embodiment, the CRISPR/Cas tool is a CRISPR/Cas9 gene editing tool.

It is understood that within the scope of the present application, the above-described technical features of the present application and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

The following drawings are illustrative of particular embodiments of the application and are not intended to limit the scope of the application as defined by the claims.

FIG. 1 is a diagram showing the design of implementing the spatiotemporal control of Cre expression and an inducible T3H38 ribozyme/Cre-loxP system to conditionally knock down endogenous expression.

(a) When an active T3H38 ribozyme is inserted behind the gene of interest, it will produce a self-cleaving effect, thereby effecting mRNA degradation.

(b) Schematic representation of the Ribo-Off operator from "on" to "Off" and mRNA will be stable when not subjected to Cre recombination, resulting in protein translation; when subjected to Cre recombination, ribozymes can cause mRNA degradation, rendering the protein nontranslatable.

(c) Schematic diagram of induction expression Cre, realizing time regulation by expressing Cre through a tissue specific promoter; spatial regulation is achieved by a heat shock promoter.

FIG. 2 is a diagram showing that the Ribo-Off system can spatially and temporally shut down the expression of the endogenous gene argn-1.

(a) Confocal fluorescence images show mitochondrial morphology marked by MITO:: mKate and ARGN-1:: GFP expression levels under different conditions. Adult animals were imaged for 2 days. Scale bar: 5 μm. Arrow: enlarged mitochondria.

(b) ARGN-1: relative fluorescence expression of GFP under various conditions. All values are expressed as mean ± s.e.m. Each dot represents a nematode, n.gtoreq.30. * P <0.0001 (unilateral analysis of variance using Tukey correction).

(c) Quantification of animal proportions containing normal, moderate and severe defective forms of mitochondria. The sample size of each group is shown above each column.

FIG. 3 is a conditional knockdown of scav-3 and sax-7 by Ribo-Off.

(a) Confocal fluorescence images show SAX-7:: GF expression and PVD morphology in different genetic contexts. All animals were imaged on day 2 adults. Arrow: defective dendrite branches. Asterisks: intestinal autofluorescence. Scale bar: 20 μm.

(b) Statistics of SAX-7 relative fluorescence expression intensities under different conditions. Each dot represents a nematode, n.gtoreq.30. All values are expressed as mean ± s.e.m.

(c) Quantification of PVD morphology under different conditions. The sample size is shown above each column.

(d) Confocal fluorescence images showing GFP expression and lysosome morphology in various genetic backgrounds. Cre expression is controlled in time by the heat shock promoter and in space by the tissue specific promoter, respectively. All animals were imaged on day 2 adults. Scale bar: 20 μm.

(e) Statistics of SCAV-3 relative fluorescence expression intensities under different conditions. Each dot represents a nematode, n.gtoreq.30. All values are expressed as mean ± s.e.m.

(f) Quantitative statistics of lysosomal morphology under different conditions. The sample size is shown above each column. NS: is not significant. * P < 0.01.* P <0.0001 (one-sided analysis of variance with Tukey correction)

FIG. 4 is a conditional knockout of essential genes using the Ribo-Off system.

(a) Confocal fluorescence images showing PVD dendrite morphology. Cre recombinase is specifically expressed to delete let-858 transcription terminators in various tissues using different tissue-specific promoters. The Cre transgene expressed by the heat shock promoter is subjected to heat shock treatment in the L4 stage. Day 3 adults of all groups were imaged. Scale bar: 20 μm.

(b) Quantification of the number of ectopic dendritic branches between primary and tertiary dendrites in the front 100 μm region of PVD cell bodies under different genetic backgrounds. All values are expressed as mean ± s.e.m. n is more than or equal to 25 nematodes. NS: is not significant. * P <0.0001 (unilateral analysis of variance using Tukey correction).

Detailed Description

The present inventors have made extensive and intensive studies to establish a novel tool for visually controlling gene expression (referred to as "Ribo-OFF" tool in the present application). The tool is created by combining ribozyme and Cre/loxP system, and can realize the space-time efficient regulation and control of endogenous genes. Relying on CRIPSR/Cas9 mediated knock-in ensures the specificity of gene regulation. The coding sequence of the T3H38 ribozyme sequence is only 63bp, and the gene can be easily inserted into the gene of interest by using the CRISPR/Cas9 technology, so that the success rate is high. The loxP-stop-loxP gene regulatory cassette is added before the T3H38 ribozyme sequence so that the gene is initially in an "On" state, and the gene of interest is brought into a "Off" state in time and space by the Cre recombinase. The present application has been completed on the basis of this finding.

Gene expression has a temporal and spatial specificity of regulation. Cre-loxP recombination is a site-specific recombinase technology that can perform deletions, insertions, translocations and inversions at specific sites on DNA, and with this system, modifications can be made to DNA in cells for specific cell types or with specific external stimuli, both in eukaryotic and prokaryotic systems. The recombinase system is a tool for controlling gene expression and deletion under the most widely applied conditions, and has the advantages of space-time specificity, high efficiency, wide application range and the like.

Ribozymes are catalytic RNA molecules capable of cleaving RNA, which can act both in cis and trans. Trans-acting ribozymes use their base pairing regions to specifically bind to the target RNA, thereby effecting cleavage. However, the overall efficiency is not high. Recently, it has been discovered that cis-acting ribozymes, such as a class III hammerhead ribozyme, are very effective in regulating inactivation of gene expression due to self-cleavage induced mRNA decay upon insertion into a targeted RNA molecule.

T3H38 is a hammerhead ribozyme that inhibits transgene expression by about 730-fold compared to the catalytically inactive form of T3H 38. Transgene expression may be restored by sterically blocking the antisense oligonucleotide moiety, which binds to and inactivates self-cleavage of T3H 38.

Gene expression has a time-specific and space-specific law, and thus, there is still a need for useful methods to be developed for the temporal and spatial control of gene expression. We have created a Ribo-OFF tool in combination with the T3H38 ribozyme and the Cre/loxP system that allows for the spatiotemporal manipulation of endogenous genes. We expect that these new methods would be applicable to other multicellular organisms, including mammals, and would increase the kits for gene regulation.

Ribozyme

Ribozyme (Ribozyme) refers to small molecule RNA with catalytic function, belongs to biocatalysts, and can degrade specific mRNA sequences. Compared with general translated RNA, ribozymes have a more stable spatial structure and are less susceptible to attack by RNases. More importantly, the ribozyme can be released from the hybrid strand after cleaving the mRNA, re-binding and cleaving other mRNA molecules. Ribozymes can specifically cleave substrate RNA molecules by catalyzing cleavage of phosphodiester bonds in the RNA strand of the target site, thereby blocking expression of the target gene.

In a preferred embodiment, a Spacer of 12bp is added on both sides of the ribozyme to optimize its steric conformation, with the following sequence:

CAAACAAACAAA(SEQ ID NO.1)。

in a preferred embodiment, the present application selects for use a T3H38 ribozyme having the sequence:

GCGCGTCCTGGATTCCACTTCGGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAACGCGC

(SEQ ID NO.2)。

Cre-LoxP recombinase system

Cre recombinase: found in 1981 from P1 phage, belonging to the lambda Int enzyme super gene family. The full length 1029bp (EMBL database accession number X03453) of Cre recombinase gene coding region sequence codes for a 38kDa monomeric protein consisting of 343 amino acids. It has catalytic activity, and similar to restriction enzyme, can recognize specific DNA sequence, i.e. loxP site, so that the gene sequence between loxP sites can be deleted or recombined. The Cre recombinase has recombination efficiency of 70%, and can act on DNA substrates with various structures, such as linear, circular and even supercoiled DNA without any auxiliary factors. It is a site-specific recombinase, which can mediate specific recombination between two LoxP sites (sequences), so that the gene sequence between LoxP sites is deleted or recombined.

LoxP (locus of X (cross) -ovin p 1) sequence: the P1 phage is derived from two 13bp inverted repeats and an intermediate 8bp sequence, and the 8bp sequence also determines the LoxP direction. Cre is covalently bound to DNA during the catalytic DNA strand exchange, and the 13bp inverted repeat is the Cre enzyme binding domain. The sequence is as follows:

5'–ATAACTTCGTATA-GCATACAT-TATACGAAGTTAT-3'(SEQ ID NO.3)

3'–TATTGAAGCATAT-CGTATGTA-ATATGCTTCAATA-5'(SEQ ID NO.4)

in a preferred embodiment, the sequence of loxP is shown in SEQ ID NO. 3.

In a preferred embodiment, the sequence of the let-858 terminator is as follows:

GGATGATCGACGCCAACGTCGTTGAATTTTCAAATTTTAAATACTGAATATTTGTTTTTTTTCCTAT

TATTTATTTATTCTCTTTGTGTTTTTTTTCTTGCTTTCTAAAAAATTAATTCAATCCAAATCTAAACATTT

TTTTTTCTCTTTCCGTCTCCCAATTCGTATTCCGCTCCTCTCATCTGAACACAATGTGCAAGTTTATTTAT

CTTCTCGCTTTCATTTCATTAGGACGTGGGGGGAATTGGTGGAAGGGGGAAACACACAAAAGGATGATGGA

AATGAAATAAGGACACACAATATGCAACAACATTCAATTCAGAAATATGGAGGAAGGTTTAAAAGAAAACA

TAAAAATATATAGAGGAGGAAGGAAACTAG(SEQ ID NO.5)

in a preferred embodiment, a let-858 terminator sequence is selected to be inserted between two loxP sites in the same direction, as follows:

ATAACTTCGTATAGCATACATTATACGAAGTTATGGATGATCGACGCCAACGTCGTTGAATTTTCAA

ATTTTAAATACTGAATATTTGTTTTTTTTCCTATTATTTATTTATTCTCTTTGTGTTTTTTTTCTTGCT TT

CTAAAAAATTAATTCAATCCAAATCTAAACATTTTTTTTTCTCTTTCCGTCTCCCAATTCGTATTCCGC TC

CTCTCATCTGAACACAATGTGCAAGTTTATTTATCTTCTCGCTTTCATTTCATTAGGACGTGGGGGGAA TT

GGTGGAAGGGGGAAACACACAAAAGGATGATGGAAATGAAATAAGGACACACAATATGCAACAACATTC AA

TTCAGAAATATGGAGGAAGGTTTAAAAGAAAACATAAAAATATATAGAGGAGGAAGGAAACTAGATAACTT

CGTATAGCATACATTATACGAAGTTAT(SEQ ID NO.6)

visual fluorescent protein

The fluorescent protein can be used for observing the activity of cells, can be used for marking expressed proteins, can be used for deep proteomics experiments and the like.

In a preferred embodiment, GFP fluorescent protein is selected for visual detection of gene expression levels, the gene sequence of which is as follows (SEQ ID No. 7):

ATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGGTAAGTTTAAACATATATATACTAACTAACCCTGATTATTTAAATTTTCAGCCAACACTTGTCACTACTTTCTGTTATGGTGTTCAATGCTTCTCGAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTAAGTTTAAACAGTTCGGTACTAACTAACCATACATATTTAAATTTTCAGGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTGTAAGTTTAAACATGATTTTACTAACTAACTAATCTGATTTAAATTTTCAGAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAA。

genetically engineered species and method for preparing same

In a preferred embodiment of the application, the application provides the construction of a variety of genetically engineered species incorporating sequences for regulating gene expression behind the gene of interest, and in addition, fluorescent proteins for visualizing the intensity of gene expression.

In a preferred embodiment, the fluorescent protein may be a red fluorescent protein (e.g., tdTomato, dsRed, mCherry), a green fluorescent protein (e.g., eGFP, zsGreen), a Yellow Fluorescent Protein (YFP), a Blue Fluorescent Protein (BFP), a cyan fluorescent protein gene (CFP), etc.

The process of preparing genetically engineered cells is preferably gene editing using CRISPR/Cas system tools. The CRISPR/Cas system is a acquired immune system found in most bacteria and all archaea today, and is known in full name as the recurrent palindromic repeat cluster/recurrent palindromic repeat cluster associated protein system (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins). It has now been found that a number of different types of CRISPR/Cas systems, wherein the CRISPR/Cas9 system is composed of Cas9 proteins and guide RNAs (grnas) as cores, only a single cleavage protein (Cas 9) is required for cleavage of the foreign gene, and thus is most convenient to use. Binding of Cas9 protein to gRNA enables cleavage of DNA at specific sites, the last 3 rd NGG sequence of which recognition site is called PAM (protospacer adjacent motif) sequence, which is important for DNA cleavage.

Genome editing is performed by using a CRISPR/Cas9 system, firstly, cas9 proteins with DNA shearing enzyme activity are heterologously expressed in cells, and then, sgRNA and target homologous sequences are obtained to guide Cas9 to a target for DNA shearing. Specific methods of operation are well known to those skilled in the art.

In a preferred embodiment of the present application, the present application provides a method for preparing the genetically engineered cell, the method comprising the steps of:

(i) Providing different promoters to induce genetically engineered species that stably express Cre recombinase;

(ii) Providing another genetically engineered species in which an expression cassette that achieves visual regulation of gene expression is inserted into a gene of interest, the gene expression being in an "On" state;

(iii) Mating and combining the two, and if the space regulation is performed, the "Off" state of the gene in the specific space is performed; if time regulation is performed, the "Off" state of the gene is achieved after induction by specific conditions.

The visualization method is realized by inserting a reporter molecule, and then connecting the expression cassette. The expression cassette is characterized in that a let-858 terminator sequence is inserted between two loxP sites in the same direction, then a ribozyme sequence is connected, and the gene is inserted after a stop codon of a gene of interest. The space-time regulation is realized by Cre-loxP recombinase. Visualization is achieved as fluorescent protein insertion in another preferred embodiment, steps (i and ii) described above, using CRISPR/Cas tools, achieve endogenous stable integration.

In a preferred embodiment, the CRISPR-Cas9 based gene editing system employs a DNA repair approach of homology arm mediated DNA repair (HDR) to insert the visual regulatory gene expression sequence after the stop codon of the gene of interest.

In a preferred embodiment of the application, the insertion of the expression cassette and ribozyme into the gene of interest does not affect the background level of the gene prior to the Cre recombination as compared to prior to the non-transgene.

In a preferred embodiment of the application, the visual spatial regulation ("on" to "off") of the gene of interest can be achieved by inducing the expression of Cre recombinase by means of different promoters, exploring the major tissue in which the gene is acting and the time.

In a preferred embodiment of the application, the temporal regulation of the gene of interest is achieved by expressing the Cre recombinase via a heat shock promoter, the longer the recovery time after heat shock, the lower the expression level of the gene.

In a more preferred embodiment, the application is applicable to essential or lethal genes, enabling spatial regulation of the essential or lethal genes, exploring the major tissues in which they function.

In a preferred embodiment, the sequence of the T3H38 ribozyme (SEQ id No. 8) that regulates gene expression at the RNA level:

CAAACAAACAAAgcgcgtcctggattccacttcgggtacatccagctgacgagtcccaaataggac gaaacgcgcCAAACAAACAAA。

in a preferred embodiment, a let-858 terminator sequence is inserted between two loxP sites in the same direction.

In a preferred embodiment, the level of gene expression is detected using GFP fluorescent protein visualization.

Application of

The present application provides a novel tool for regulating gene expression, "Ribo-OFF" tool. The tool is created by a ribozyme and the Cre/loxP system. The expression cassette (a let-858 terminator sequence is inserted between two identical loxP sequences) and ribozyme are inserted behind the stop codon of the gene of interest, so that the high-efficiency regulation and control of the endogenous gene in specific tissues at specific time can be realized.

Relying on CRIPSR/Cas9 mediated knock-in ensures the specificity of gene regulation. The loxP-stop-loxP gene regulation box is added before the ribozyme sequence, so that the gene is in an 'On' state at first, and the 'Off' state in time and space is realized On the gene of interest by Cre recombinase. The development of this technique can be used to explore the site of action and time of action that occurs with genes of interest, including essential/lethal genes.

The application has the main advantages that:

(1) RNA interference, CRISPR interference, and Cas 13-mediated gene knockout are effective tools for gene regulation at the mRNA level. However, these methods may result in off-target gene regulation. Ribo-Off relies on CRISPR/Cas9 mediated knock-in, identified by PCR and sequencing, ensuring the specificity of the targeted gene.

(2) The use of Ribo-Off can further shut down target gene expression by spatiotemporal control of Cre expression. The Cre-loxP system has been studied for a long time to verify the high efficiency of recombination.

(3) Can realize the regulation and control of knocking down of the gene of interest under different conditions, thereby exploring the action site and action time of the gene.

(4) Compared with the insertion without Cre recombination, the insertion of the experimental design has no influence on the gene level regulation of the background, so that the expression regulation from 'on' to 'off' can be carried out in specific tissues aiming at any gene, and the experimental design is particularly suitable for exploring the essential lethal gene.

The present application will be described in further detail with reference to the following examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Parts and percentages are by weight unless otherwise indicated.

Example 1: donor plasmid construction

(1) Donor plasmid construction for homology arm-mediated DNA repair (visual gene expression):

the donor plasmid is used as an internal reference, and the following three fragments are cloned by a homologous recombination molecule method: 1) GFP fluorescent protein; 2) A homology arm of about 500bp in length 5' to the insertion site of the gene of interest; 3) The homologous arm with the length of about 500bp at the 3' end of the insertion site of the gene of interest is spliced into a fragment, and is inserted into a universal vector.

The donor plasmid is a design group, and the following five fragments are cloned by homologous recombination molecules: 1) GFP fluorescent protein; 2) A loxP-let 858 terminator-loxP fragment, wherein loxP is realized by loading in a primer; 3) T3H38 ribozyme; 4) A homology arm of about 500bp in length 5' to the insertion site of the gene of interest; 5) The homologous arm with the length of about 500bp at the 3' end of the insertion site of the gene of interest is spliced into a fragment, and is inserted into a universal vector.

(2) Donor plasmid construction for homology arm-mediated DNA repair (non-visual gene expression):

the following four fragments were cloned by homologous recombination: 1) A loxP-let 858 terminator-loxP fragment, wherein loxP is realized by loading in a primer; 2) T3H38 ribozyme; 3) A homology arm of about 500bp in length 5' to the insertion site of the gene of interest; 4) The homologous arm with the length of about 500bp at the 3' end of the insertion site of the gene of interest is spliced into a fragment, and is inserted into a universal vector.

The plasmid backbone of the above universal vector carries only the amp-resistant and ori elements, and only the amp-resistant sequence carries the promoter sequence to express the amp-resistant protein.

Example 2: construction of transgenic lines visualizing endogenous Gene expression

(1) Each sgRNA (20 ng/uL) was screened by dpy-10 by microinjection of donor plasmid (50 ng/uL), cas-9 protein (50 ng/uL) into wild-type adult 1-antenna insects.

(2) After 3-4 days, F1 generation exhibiting a dpy-10 phenotype was selected.

(3) After 3-4 days, F2 generation is grown, and the genotyping of F1 generation is carried out by a PCR method.

(4) Subsequently, the transgenic lines which may contain the insertion of the desired fragment are selected and the F2 generation is split.

(5) After 3-4 days, the genotype identification of F2 generation is carried out by a PCR method, and homozygote is obtained.

(6) The GFP signal of the gene of interest was analyzed for signal intensity using GraphPad analysis software, and the results are shown in FIGS. 2,3 and 4. It was found that the insertion of the gene expression cassette did not affect the expression of the gene or the function of the gene.

Example 3: spatially visualizing shut down of endogenous gene expression

Constructing a tissue-specific promoter to induce and stably express a genetic engineering species of Cre recombinase:

(1) The Plasmid (for example, in nematodes, the concentration of injection is regulated according to different tissues, and the expression of the Cre (Pdpy-7-wormCre) in the epidermis promoter Pdpy-7 is preferably 5ng/uL, the expression of the Cre (Phlh-1-wormCre) in the muscle is preferably 20ng/uL, the expression of the Cre (Ser 2p 3-wormCre) in the PVD neuron promoter Ser2p3 is preferably 20 ng/uL) is selected by a commonly used method for labeling red-colored plasmids expressed on the Plasmid nerve ring (Podr-1-rfp (50 ng/uL), and the expression of the red-colored plasmids expressed by pharyngeal muscle (Pmyo-2-mcherry (2 ng/uL, purchased from Addge, accession number Plasmid # 19327)). ( The world Cre plasmid was purchased from Addgene under the number #69253 and replaced with a promoter. Reference is made to: G1/S Inhibitors and the SWI/SNF Complex Control Cell-Cycle Exit during Muscle differentiation. Ruijtenberg S, van den Heuvel S.cell.2015Jul16;162 (2) 300-13.Doi:10.1016/j.cell.2015.06.013.Epub 2015Jul 2.10.1016/j.cell.2015.06.013PubMed 26144318 )

(2) After 3-4 days, the F1 generation was picked, which shows a red-colored pharyngeal phenotype, indicating that Cre was successfully expressed in the specific tissue in the insect.

(3) After 3-4 days, after the F2 generation grows out, it is observed whether the F1 generation can stabilize the phenotype of the above (2) in a specific ratio.

(4) Then, a high proportion of exogenous transgenic strain is reserved, and the strain is a genetically engineered species of which the tissue-specific promoter induces stable expression of Cre recombinase.

Genetically engineered species stably expressing Cre recombinase are induced by tissue-specific promoters to mate with the lines constructed in example 2 above to obtain homozygous species. After recombination in a particular tissue, the gene will knock down in that tissue, assuming an "Off" state.

(1.1) for example, for the test of argn-1 gene, confocal imaging was performed when the nematode was at the next day size. The excitation light of the green fluorescent channel was 488 nm wavelength, the laser intensity was 10%, the exposure time was 100ms, the laser intensity was 561nm was 5%, and the exposure time was 100ms. The imaging results are shown in fig. 2 (a).

For example, for the test of the sax-7 gene, confocal imaging was performed when the nematode was at the third day size. The excitation light of the green fluorescent channel was 488 nm wavelength, the laser intensity was 40%, the exposure time was 100ms, the laser intensity was 561nm was 40%, and the exposure time was 100ms. The imaging results are shown in fig. 3 (a).

For example, for the test of the scav-3 gene, confocal imaging was performed when the nematode was at the next day size. The excitation light of the green fluorescent channel was 488 nm wavelength, the laser intensity was 70%, the exposure time was 100ms, the laser intensity of 561nm was 20%, and the exposure time was 100ms. The imaging results are shown in fig. 3 (d).

(1.2) measurement of endogenous protein expression based on fluorescence imaging using ImageJ five representative regions in each nematode were selected to calculate average fluorescence intensity, and then background signal was subtracted. The GFP signal of the gene of interest was analyzed for signal intensity using GraphPad analysis software, and the results are shown in FIG. 2 (b), 3 (b), and 3 (e). The signal intensity of GFP after Cre recombination is expressed by different promoters is shown in the figure, and the fact that only Cre is expressed in epidermis can lead to GFP expression reduction.

(1.3) analysis of functional changes in the gene of interest using ImageJ.

Imaging statistics were performed on 220 μm x 220 μm areas of each animal.

For argn-1 gene related to mitochondria, selecting and counting mitochondrial function forms, and counting according to the following indexes: normal, partial defect, severe defect, "normal" means that most mitochondria are tubules, or tubules and globular structures (diameter less than 1.5 μm); "partial defect" refers to a partial mitochondrial enlargement (diameter greater than 1.5 μm but less than 3 μm); "severe" means that some mitochondria are severely enlarged (diameter exceeding 3 μm). The results are shown in FIG. 2 (c).

For the gene related to sax-7 and PVD neurons, the statistical PVD morphology is selected and counted according to the following indexes: normal, partial defect, severe defect, "normal" means that the unit area is fully occupied by three and four levels of branches; "partial defect" means that a unit area is covered by these branch portions; "severe defects" means that no tertiary or quaternary branches are formed per unit area. The results are shown in FIG. 3 (c).

For the gene related to scav-3 and lysosome, the function and morphology of lysosome are selected and counted, and the statistics is carried out according to the following indexes: normal, partial defect, severe defect, "normal" means that the 220 μm imaging region contains less than 5 enlarged lysosomes (defined as lysosomes having diameters exceeding 2.7 μm; partial defect "means that the unit area contains 5 to 10 enlarged lysosomes; severe defect" means that the unit area contains more than 10 enlarged lysosomes. The results are shown in fig. 3 (f).

These three genes can be seen to play a major role in the epidermis.

Example 4: time-visualized shut-down of endogenous gene expression

Constructing a genetic engineering species for stably expressing Cre recombinase by inducing a heat shock promoter:

(1) The Cre expressed by the heat shock promoter Phsp-16.48, namely Phsp-16.48-world Cre (20 ng/uL, the world Cre Plasmid is purchased from Addgene Corp. #69253 and is subjected to promoter replacement.) was selected by the method of the commonly used labeling Plasmid Podr-1-rfp (50 ng/uL), pmyo-2-mcherry (2 ng/uL, purchased from Addgene, the Plasmid # 19327).

(2) After 3-4 days, F1 generation with red pharyngeal phenotype was selected, which represents that the insect body successfully carried the character that would express Cre after heat shock.

(4) And then, retaining a high-proportion exogenous transgenic strain, namely a genetically engineered species for stably expressing Cre recombinase by inducing a heat shock promoter.

The genetically engineered species that stably expressed Cre recombinase was induced by heat-shock promoters and the lines constructed in example 2 above were mated to obtain homozygous species.

(1.1) selecting transgenic species for heat shock treatment for a specified period of time and then resuming imaging for a period of time. For example, for the argn-1 and scav-3 gene tests, nematodes at stage L4 were heat-shock treated at 33℃for 1h, followed by 48h recovery for imaging.

For the argn-1 gene test, confocal imaging was performed when the nematode was at the next day size. The excitation light of the green fluorescent channel was 488 nm wavelength, the laser intensity was 10%, the exposure time was 100ms, the laser intensity was 561nm was 5%, and the exposure time was 100ms. As a result of the imaging, as shown in FIG. 2 (a), the GFP expression was reduced.

For the test of the scav-3 gene, confocal imaging was performed when the nematode was at the next day size. The excitation light of the green fluorescent channel was 488 nm wavelength, the laser intensity was 70%, the exposure time was 100ms, the laser intensity of 561nm was 20%, and the exposure time was 100ms. As a result of the imaging, as shown in FIG. 3 (d), the GFP expression was decreased.

(1.2) measurement of endogenous protein expression based on fluorescence imaging using ImageJ five representative regions in each nematode were selected to calculate average fluorescence intensity, and then background signal was subtracted. The GFP signal of the gene of interest was analyzed for signal intensity using GraphPad analysis software, and the results are shown in FIG. 2 (b), 3 (b), and 3 (e). The figure shows that the signal intensity of GFP protein is significantly reduced after recovery for 48h by heat shock for 1 h.

(1.3) analysis of functional changes in the gene of interest using ImageJ.

Imaging functional statistics were performed on 220 μm x 220 μm areas of each animal.

It was found that the gene expression was decreased after heat shock, resulting in defects in morphological functions of the two genes.

Example 5:

use of conditional knockdown of endogenous essential (or lethal) gene expression:

(1) loxP::: stop::: rz gene expression cassette is inserted into the C-terminal stop codon of endogenous essential gene using CRISPR/Cas9 mediated homologous recombination, and such insertion will not affect the expression and function of the gene.

(2) Cre recombinase is specifically expressed to delete let-858 transcription terminators in various tissues using different tissue-specific promoters to effect gene knockdown.

For example, the essential gene bicd-1 was selected for testing and confocal imaging was performed when the nematode was at the third day size, and the results are shown in FIG. 4 (a). It was found that knocking down the bicd-1 only in the epidermis produced an ectopic branched phenotype, suggesting that bicd-1 plays a major role in the epidermis.

(3) Quantitative statistics on PVD morphology were performed for knock-down of the bicd-1 gene function changes in different tissues: number of ectopic dendritic branches between primary and tertiary dendrites in the first 100 μm region of PVD cell bodies under different genetic backgrounds. All values are expressed as mean ± s.e.m. n is more than or equal to 25 worms. NS: is not significant. * P <0.0001 (unilateral analysis of variance with Tukey correction).

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Claims

1. A gene expression control system, characterized in that the gene expression control system comprises a first nucleic acid construct comprising a structure represented by formula I,

5'G-M-T3', formula I

2. The gene expression control system of claim 1, wherein the specific recombinase is Cre recombinase and the specific recombination site is a LoxP site.

3. The gene expression control system of claim 1, wherein M has the structure:

5' LoxP-terminator-LoxP '3'.

4. The gene expression control system of claim 1, wherein the terminator is a let-858 terminator; and/or, the ribozyme is a T3H38 ribozyme.

5. A nucleic acid construct comprising a structure according to formula I:

5'G-M-T3', formula I

In formula I, G is a DNA fragment optionally labeled with a gene; m is a DNA fragment comprising a terminator and a specific recombination site; t is the DNA sequence of the ribozyme gene; each "-" is a bond or a linking sequence;

preferably, the nucleic acid construct comprises a structure represented by formula I':

5' HA-G-M-T-3' HA of formula I '

6. An expression cassette comprising the nucleic acid construct of claim 5.

7. An expression vector comprising the expression cassette of claim 6.

8. A kit comprising the expression vector of claim 7, the expression cassette of claim 6, or the nucleic acid construct of claim 5;

preferably, the kit further comprises a Cas9 protein expression plasmid.

9. Use of the gene expression control system according to claim 1 for the control of gene expression in a living body.

10. A method of gene regulation, the method comprising the steps of:

5'G-M-T3', formula I

when the gene expression control system is in a first state, the site-specific recombinase is not expressed, and the terminator functions to prevent transcription of the ribozyme;