CN116640762A

CN116640762A - SiRNA targeting diglycerol ester acyl transferase and application thereof

Info

Publication number: CN116640762A
Application number: CN202210143331.5A
Authority: CN
Inventors: 汤新景; 经男男
Original assignee: Peking University
Current assignee: Beijing Fuyuan Pharmaceutical Co ltd
Priority date: 2022-02-16
Filing date: 2022-02-16
Publication date: 2023-08-25

Abstract

The invention discloses siRNA targeting diglycerol acyl transferase and application thereof. The invention designs siRNA medicine to DGAT2 gene to obtain siRNA composed of sense strand and antisense strand RNA, and the nucleotide sequence is shown in SEQ ID No.1-SEQ ID No. 132. The sequence can effectively silence the mRNA level of DGAT2, wherein part of siRNA sequences can even silence the mRNA level of DGAT2 to about 20%, and has obvious concentration effect; after the nucleic acid skeleton and the nucleoside are modified, the stability is improved, the IC50 for silencing the DGAT2 gene can reach 0.033nM, and further the end group GalNAc modified siRNA is expected to improve the targeting to liver cells, so that the siRNA can be used for preparing gene therapy medicaments for treating nonalcoholic fatty liver diseases and the like caused by the DGAT2 gene.

Description

SiRNA targeting diglycerol ester acyl transferase and application thereof

Technical Field

The invention relates to a gene medicine for treating non-alcoholic fatty liver disease, in particular to siRNA targeting diglycerol acyltransferase and application thereof in preparing a gene therapy medicine for treating non-alcoholic fatty liver disease, belonging to the field of gene therapy medicines for treating non-alcoholic fatty liver disease.

Background

Diglycerol acyltransferase (or o-acyltransferase) DGAT catalyzes the production of triglycerides from diglycerides and acyl-CoA. The DGAT-catalyzed reaction is considered the final and only key step in triglyceride synthesis. In mammals, the DGAT enzymes are two isoenzymes DGAT1 and DGAT 2. Studies have shown that although DGAT1 and DGAT2 catalyze the same reaction, there is no sequence homology and structural independence between the genes. These two enzymes play different roles in triglyceride metabolism, DGAT2 is involved in steatosis and DGAT1 is involved in Very Low Density Lipoprotein (VLDL) synthesis. DGAT1 is expressed primarily in the small intestine, in absorptive intestinal cells of the intestine and duodenum, and recombines triglycerides that undergo lipolytic breakdown during intestinal absorption. DGAT1 recombines triglycerides in one defined step, and they are then packaged together with cholesterol and protein to form chylomicrons. DGAT2 is primarily located in fat, liver and skin cells, promoting the accumulation of triglycerides and the formation of fat. In humans, DGAT1 mutations are associated with congenital diarrhea. The exact cause of diarrhea is not clear, and is presumably related to abnormal fat absorption and DGAT1 substrate accumulation in the intestinal mucosa. DGAT2 is a key to adipose tissue formation, and is closely related to triglyceride levels in plasma, skin barrier formation, and fat accumulation in the liver. Because the DGAT1 and the DGAT2 have no sequence homology and have uncorrelated structures, the targeting of the DGAT2 can not influence the functional inhibition of the DGAT1, can effectively reduce the blood fat and the fat accumulation in the liver, and is a potential target for treating related diseases such as hyperlipidemia, fatty liver, obesity and the like.

Nonalcoholic fatty liver disease (NAFLD), also known as metabolic (dysfunctional) related fatty liver disease (MAFLD), is the accumulation of excessive fat in the liver without other clear causes such as alcohol consumption. NAFLD is the most common liver disease in the world, accounting for about 25% of the world population. NAFLD can be divided into two types: nonalcoholic fatty liver disease (NAFL) and nonalcoholic steatohepatitis (NASH). NAFL is less dangerous than NASH and does not generally progress to NASH or cirrhosis; damage such as lobular inflammation, ballooning of hepatocytes, and perisinus fibrosis is observed when NAFL progresses to NASH. Inflammation is a marker of NASH compared to simple steatosis; NASH is a progressive disease that increases liver cell death through apoptosis or necrosis, can seriously impair liver function, and causes complications such as cirrhosis, liver failure, liver cancer or cardiovascular disease, and has become one of three factors of clinical liver transplantation. No particular treatment is currently available for NAFLD, mainly by weight loss through dietary changes and exercise, and preliminary studies indicate that pioglitazone and vitamin E have therapeutic potential.

From NAFL (manifesting as simple steatosis) to NASH, these diseases start with an abnormal accumulation of fat in the liver (liver steatosis), which mainly exists in the form of triglycerides, but the mechanism of accumulation of triglycerides and the cause of liver dysfunction by accumulation are not clear.

Studies have shown that overexpression of DGAT2 increases triglyceride synthesis and that lowering the expression level of DGAT2 reduces triglyceride formation. In the current study, NEETA B.AMIN et al used DGAT2 inhibitors (PF-06427878) to significantly reduce triglyceride concentrations in liver and plasma and to reduce adipogenic gene expression; in NASH mouse model, PF-06427878 treatment significantly improved liver steatosis and fibrosis; can improve liver function markers such as alanine aminotransferase and reduce liver steatosis in 2 phase 1 clinical experiments (Amin N B, carvajal-Gonzalez S, purkal J, et al, targeting diacylglycerol acyltransferase 2for the treatment of nonalcoholic steatohepatitis[J ]. Sci. Transl. Med.,2019,11 (520): eaav 9701). A drug for the treatment of NASH, named IONIS-DGAT2 Rx, developed by Ionis Pharmaceuticals works by inhibiting DGAT2 gene expression by antisense strand nucleic acid (Prl A, emb B, lw B, et al, novel antisense inhibition of diacylglycerol O-acyltransferase 2for treatment of non-alcoholic fatty liver disease: a multicenter, double-blank, random, placard-controlled phase 2 three [ J ]. 2020.). The research shows that DGAT2 is an effective target for treating NAFLD/NASH, and the inhibition of DGAT2 can effectively reduce triglyceride and reduce liver fat accumulation.

siRNA is a double-stranded RNA with the length of about 21-25bp, is negatively charged, realizes high-efficiency and high-specificity combination of target mRNA mainly through RNA interference (RNAi), and triggers specific degradation of the target mRNA, thereby regulating gene expression. Screening for effective siRNA can reduce the expression level of DGAT2 and further treat related diseases.

Disclosure of Invention

It is an object of the present invention to provide sirnas targeting diglycerol acyltransferase and conjugates thereof;

it is a second object of the present invention to provide a recombinant expression vector containing the said diglycerol acyltransferase-targeted siRNA.

It is a further object of the present invention to provide a host cell containing the recombinant expression vector.

The fourth object of the present invention is to apply the siRNA targeting the diglycerol acyltransferase or the recombinant expression vector containing the siRNA targeting the diglycerol acyltransferase to the preparation of a gene therapy drug for treating non-alcoholic fatty liver disease;

the above object of the present invention is achieved by the following technical solutions:

an aspect of the present invention provides an siRNA targeting a diglycerol acyltransferase selected from any one of the following 66 sirnas consisting of sense strand and antisense strand RNAs:

(1) siRNA composed of sense strand RNA shown in SEQ ID No.1 and antisense strand RNA shown in SEQ ID No. 2;

(2) siRNA composed of sense strand RNA shown in SEQ ID No.3 and antisense strand RNA shown in SEQ ID No. 4;

(3) siRNA composed of sense strand RNA shown in SEQ ID No.5 and antisense strand RNA shown in SEQ ID No. 6;

(4) siRNA composed of sense strand RNA shown in SEQ ID No.7 and antisense strand RNA shown in SEQ ID No. 8;

(5) An siRNA composed of sense strand RNA shown in SEQ ID No.9 and antisense strand RNA shown in SEQ ID No. 10;

(6) An siRNA composed of a sense strand RNA shown in SEQ ID No.11 and an antisense strand RNA shown in SEQ ID No. 12;

(7) An siRNA composed of a sense strand RNA shown in SEQ ID No.13 and an antisense strand RNA shown in SEQ ID No. 14;

(8) An siRNA composed of a sense strand RNA shown in SEQ ID No.15 and an antisense strand RNA shown in SEQ ID No. 16;

(9) An siRNA composed of a sense strand RNA shown in SEQ ID No.17 and an antisense strand RNA shown in SEQ ID No. 18;

(10) An siRNA composed of a sense strand RNA shown in SEQ ID No.19 and an antisense strand RNA shown in SEQ ID No. 20;

(11) An siRNA composed of a sense strand RNA shown in SEQ ID No.21 and an antisense strand RNA shown in SEQ ID No. 22;

(12) An siRNA consisting of a sense strand RNA shown in SEQ ID No.23 and an antisense strand RNA shown in SEQ ID No. 24;

(13) An siRNA consisting of a sense strand RNA shown in SEQ ID No.25 and an antisense strand RNA shown in SEQ ID No. 26;

(14) An siRNA consisting of a sense strand RNA shown in SEQ ID No.27 and an antisense strand RNA shown in SEQ ID No. 28;

(15) An siRNA consisting of a sense strand RNA shown in SEQ ID No.29 and an antisense strand RNA shown in SEQ ID No. 30;

(16) An siRNA composed of a sense strand RNA shown in SEQ ID No.31 and an antisense strand RNA shown in SEQ ID No. 32;

(17) An siRNA consisting of a sense strand RNA shown in SEQ ID No.33 and an antisense strand RNA shown in SEQ ID No. 34;

(18) An siRNA consisting of a sense strand RNA shown in SEQ ID No.35 and an antisense strand RNA shown in SEQ ID No. 36;

(19) An siRNA consisting of a sense strand RNA shown in SEQ ID No.37 and an antisense strand RNA shown in SEQ ID No. 38;

(20) An siRNA consisting of a sense strand RNA shown in SEQ ID No.39 and an antisense strand RNA shown in SEQ ID No. 40;

(21) An siRNA composed of a sense strand RNA shown in SEQ ID No.41 and an antisense strand RNA shown in SEQ ID No. 42;

(22) An siRNA consisting of a sense strand RNA shown in SEQ ID No.43 and an antisense strand RNA shown in SEQ ID No. 44;

(23) An siRNA consisting of a sense strand RNA shown in SEQ ID No.45 and an antisense strand RNA shown in SEQ ID No. 46;

(24) An siRNA consisting of a sense strand RNA shown in SEQ ID No.47 and an antisense strand RNA shown in SEQ ID No. 48;

(25) An siRNA consisting of a sense strand RNA shown in SEQ ID No.49 and an antisense strand RNA shown in SEQ ID No. 50;

(26) An siRNA consisting of a sense strand RNA shown in SEQ ID No.51 and an antisense strand RNA shown in SEQ ID No. 52;

(27) An siRNA consisting of a sense strand RNA shown in SEQ ID No.53 and an antisense strand RNA shown in SEQ ID No. 54;

(28) An siRNA consisting of a sense strand RNA shown in SEQ ID No.55 and an antisense strand RNA shown in SEQ ID No. 56;

(29) An siRNA consisting of a sense strand RNA shown in SEQ ID No.57 and an antisense strand RNA shown in SEQ ID No. 58;

(30) An siRNA consisting of a sense strand RNA shown in SEQ ID No.59 and an antisense strand RNA shown in SEQ ID No. 60;

(31) An siRNA consisting of a sense strand RNA shown in SEQ ID No.61 and an antisense strand RNA shown in SEQ ID No. 62;

(32) An siRNA consisting of a sense strand RNA shown in SEQ ID No.63 and an antisense strand RNA shown in SEQ ID No. 64;

(33) An siRNA consisting of a sense strand RNA shown in SEQ ID No.65 and an antisense strand RNA shown in SEQ ID No. 66;

(34) An siRNA consisting of a sense strand RNA shown in SEQ ID No.67 and an antisense strand RNA shown in SEQ ID No. 68;

(35) An siRNA consisting of a sense strand RNA shown in SEQ ID No.69 and an antisense strand RNA shown in SEQ ID No. 70;

(36) An siRNA composed of a sense strand RNA shown in SEQ ID No.71 and an antisense strand RNA shown in SEQ ID No. 72;

(37) An siRNA consisting of a sense strand RNA shown in SEQ ID No.73 and an antisense strand RNA shown in SEQ ID No. 74;

(38) An siRNA consisting of a sense strand RNA shown in SEQ ID No.75 and an antisense strand RNA shown in SEQ ID No. 76;

(39) An siRNA consisting of a sense strand RNA shown in SEQ ID No.77 and an antisense strand RNA shown in SEQ ID No. 78;

(40) An siRNA consisting of a sense strand RNA shown in SEQ ID No.79 and an antisense strand RNA shown in SEQ ID No. 80;

(41) An siRNA consisting of a sense strand RNA shown in SEQ ID No.81 and an antisense strand RNA shown in SEQ ID No. 82;

(42) An siRNA consisting of a sense strand RNA shown in SEQ ID No.83 and an antisense strand RNA shown in SEQ ID No. 84;

(43) An siRNA consisting of a sense strand RNA shown in SEQ ID No.85 and an antisense strand RNA shown in SEQ ID No. 86;

(44) An siRNA consisting of a sense strand RNA shown in SEQ ID No.87 and an antisense strand RNA shown in SEQ ID No. 88;

(45) An siRNA composed of sense strand RNA shown in SEQ ID No.89 and antisense strand RNA shown in SEQ ID No. 90;

(46) An siRNA composed of a sense strand RNA shown in SEQ ID No.91 and an antisense strand RNA shown in SEQ ID No. 92;

(47) An siRNA consisting of a sense strand RNA shown in SEQ ID No.93 and an antisense strand RNA shown in SEQ ID No. 94;

(48) An siRNA consisting of a sense strand RNA shown in SEQ ID No.95 and an antisense strand RNA shown in SEQ ID No. 96;

(49) An siRNA consisting of a sense strand RNA shown in SEQ ID No.97 and an antisense strand RNA shown in SEQ ID No. 98;

(50) siRNA composed of sense strand RNA shown in SEQ ID No.99 and antisense strand RNA shown in SEQ ID No. 100;

(51) An siRNA consisting of a sense strand RNA shown in SEQ ID No.101 and an antisense strand RNA shown in SEQ ID No. 102;

(52) An siRNA consisting of a sense strand RNA shown in SEQ ID No.103 and an antisense strand RNA shown in SEQ ID No. 104;

(53) An siRNA consisting of a sense strand RNA shown in SEQ ID No.105 and an antisense strand RNA shown in SEQ ID No. 106;

(54) An siRNA consisting of a sense strand RNA shown in SEQ ID No.107 and an antisense strand RNA shown in SEQ ID No. 108;

(55) An siRNA consisting of a sense strand RNA shown in SEQ ID No.109 and an antisense strand RNA shown in SEQ ID No. 110;

(56) An siRNA consisting of a sense strand RNA shown in SEQ ID No.111 and an antisense strand RNA shown in SEQ ID No. 112;

(57) An siRNA consisting of a sense strand RNA shown in SEQ ID No.113 and an antisense strand RNA shown in SEQ ID No. 114;

(58) An siRNA consisting of a sense strand RNA shown in SEQ ID No.115 and an antisense strand RNA shown in SEQ ID No. 116;

(59) An siRNA consisting of a sense strand RNA shown in SEQ ID No.117 and an antisense strand RNA shown in SEQ ID No. 118;

(60) An siRNA consisting of a sense strand RNA shown in SEQ ID No.119 and an antisense strand RNA shown in SEQ ID No. 120;

(61) An siRNA consisting of a sense strand RNA shown in SEQ ID No.121 and an antisense strand RNA shown in SEQ ID No. 122;

(62) An siRNA consisting of a sense strand RNA shown in SEQ ID No.123 and an antisense strand RNA shown in SEQ ID No. 124;

(63) An siRNA consisting of a sense strand RNA shown in SEQ ID No.125 and an antisense strand RNA shown in SEQ ID No. 126;

(64) An siRNA consisting of a sense strand RNA shown in SEQ ID No.127 and an antisense strand RNA shown in SEQ ID No. 128;

(65) An siRNA consisting of the sense strand RNA shown in SEQ ID No.129 and the antisense strand RNA shown in SEQ ID No. 130;

(66) siRNA composed of sense strand RNA shown in SEQ ID No.131 and antisense strand RNA shown in SEQ ID No. 132.

Preferably, the siRNA is selected from any one of the following sirnas having a better silencing effect:

an siRNA composed of sense strand RNA shown in SEQ ID No.9 and antisense strand RNA shown in SEQ ID No. 10; an siRNA consisting of a sense strand RNA shown in SEQ ID No.25 and an antisense strand RNA shown in SEQ ID No. 26; an siRNA consisting of a sense strand RNA shown in SEQ ID No.57 and an antisense strand RNA shown in SEQ ID No. 58; an siRNA consisting of a sense strand RNA shown in SEQ ID No.59 and an antisense strand RNA shown in SEQ ID No. 60; an siRNA consisting of a sense strand RNA shown in SEQ ID No.63 and an antisense strand RNA shown in SEQ ID No. 64; an siRNA consisting of a sense strand RNA shown in SEQ ID No.65 and an antisense strand RNA shown in SEQ ID No. 66; an siRNA consisting of a sense strand RNA shown in SEQ ID No.97 and an antisense strand RNA shown in SEQ ID No. 98; an siRNA consisting of a sense strand RNA shown in SEQ ID No.125 and an antisense strand RNA shown in SEQ ID No. 126; an siRNA consisting of a sense strand RNA shown in SEQ ID No.127 and an antisense strand RNA shown in SEQ ID No. 128; an siRNA consisting of the sense strand RNA shown in SEQ ID No.129 and the antisense strand RNA shown in SEQ ID No. 130; siRNA composed of sense strand RNA shown in SEQ ID No.131 and antisense strand RNA shown in SEQ ID No. 132.

For reference, to enhance strand selectivity and silencing effect of siRNA on target gene, one skilled in the art can modify 5' end of antisense strand of siRNA by phosphorylating or phosphorylating analogue modification as follows:

to improve the stability of siRNA in vivo, the above-described siRNA can be modified by one skilled in the art as needed, including but not limited to the following modification categories: the two ends of the sense strand RNA and the antisense strand RNA of the siRNA are modified by a plurality of phosphorothioates, or can be modified by changing a nucleoside skeleton into phosphorothioate bonds, borane phosphate bonds or methylphosphonate bonds, and the like, so that the stability of the siRNA can be enhanced, and the degradation of the siRNA by exonuclease can be reduced; or modifying the 2' -OH of the siRNA, such as replacing the 2' -OH with methoxy, methylethoxy\fluoro and/or deoxidizing the 2' -OH; or a modification to change the siRNA to a Peptide Nucleic Acid (PNA) type, a Locked Nucleic Acid (LNA) type, or an Unlocked Nucleic Acid (UNA) type; or the nucleotide is modified and substituted by 5-methylcytosine, 6-methyladenine, ribavirin, pseudouracil and/or inosine and other bases.

Preferably, the modified siRNA is selected from any one of the following 8 sets of modifications consisting of sense strand nucleic acid and antisense strand nucleic acid:

(1) Sense strand: c (C) _m *C _m *A _m U _m C _m C _m U _f C _m A _f U _m G _f U _m A _f C _m A _m U _m A _m U _m U _m * T, antisense strand: phos-A _m *A _f *U _f A _f U _m G _f U _m A _f C _m A _f U _m G _f A _m G _f G _m A _f U _m G _m G _m *T*T；

(2) Sense strand: g _m *C _m *U _m A _m C _m U _m U _f U _m C _f G _m A _f G _m A _f C _m U _m A _m C _m U _m U _m * T, antisense strand: phos-A _m *A _f *G _f U _f A _m G _f U _m C _f U _m C _f G _m A _f A _m A _f G _m U _f A _m G _m C _m *T*T；

(3) Sense strand: a is that _m *C _m *C _m A _m U _m A _m G _f A _m C _f U _m A _f U _m U _f U _m G _m C _m U _m U _m U _m * T, antisense strand: phos-A _m *A _f *A _f G _f C _m A _f A _m A _f U _m A _f G _m U _f C _m U _f A _m U _f G _m G _m U _m *T*T；

(4) Sense strand: g _m *A _m *C _m U _m A _m U _m U _f U _m G _f C _m U _f U _m U _f C _m A _m A _m A _m G _m A _m * T, antisense strand: phos-U _m *C _f *U _f U _f U _m G _f A _m A _f A _m G _f C _m A _f A _m A _f U _m A _f G _m U _m C _m *T*T；

(5) Sense strand: u (U) _m *A _m *G _m A _m C _m U _m A _f U _m U _f U _m G _f C _m U _f U _m U _f C _m A _f A _m A _m G _m A _m *A _m *U _m The antisense strand: phos-U _m *C _f *U _f U _f U _m G _f A _m A _f A _m G _f C _m A _f A _m A _f U _m A _f G _m U _f C _m U _f A _m *U _m *G _m ；

(6) Sense strand: g _m *A _m *C _m U _m A _m U _m U _f U _m G _f C _m U _f U _m U _f C _m A _f A _m A _m G _m A _m *A _m *U _m Antisense strand: phos-U _m *C _f *U _f U _f U _m G _f A _m A _f A _m G _f C _m A _f A _m A _f U _m A _f G _m U _f C _m *U _m *A _m ；

(7) Sense strand: g _m *C _m *U _m A _m C _m U _m U _f U _m C _f G _m A _f G _m A _f C _m U _m A _m C _m U _m U _m -GalNAc, antisense strand: phos-A _m *A _f *G _f U _f A _m G _f U _m C _f U _m C _f G _m A _f A _m A _f G _m U _f A _m G _f C _m *G _m *C _m ；

(8) Sense strand: g _m *A _m *C _m U _m A _m U _m U _f U _m G _f C _m U _f U _m U _f C _m A _f A _m A _m G _m A _m -GalNAc, antisense strand: phos-U _m *C _f *U _f U _f U _m G _f A _m A _f A _m G _f C _m A _f A _m A _f U _m A _f G _m U _f C _m *U _m *A _m ；

Wherein is phosphorothioate modification, subscript _m For 2' -methoxy modification, subscript _f For 2 '-fluoro modifications, phos is a 5' phosphorylation modification.

In order to improve the targeting of siRNA to liver cells, a person skilled in the art can modify the end group of the siRNA by acetylgalactosamine target molecules (GalNAc target with the structural formula as follows) according to the requirement, so as to improve the efficiency and long-acting property of the siRNA drug entering liver cells and enhance the treatment effect.

GaINAc target:

in a second aspect, the present invention provides a siRNA recombinant expression plasmid for expressing the target diglycerol acyltransferase as described above, and sdrnas and shrnas based on the corresponding sequences and their recombinant expression vectors, preferably, the recombinant expression vectors may be prokaryotic recombinant expression vectors or eukaryotic recombinant expression vectors, more preferably, the expression vectors are eukaryotic recombinant expression vectors, and particularly preferably, the eukaryotic recombinant expression vectors are recombinant adenovirus expression vectors.

The third aspect of the present invention relates to a host cell comprising a recombinant expression vector as described above, preferably the host cell is a prokaryotic cell or a eukaryotic cell, more preferably the host cell is a eukaryotic cell, particularly preferably the host cell is a mammalian cell.

In a fourth aspect, the present invention provides an application of the siRNA in the preparation of a gene therapy drug for treating non-alcoholic fatty liver disease, comprising: the siRNA is prepared into a gene therapy or gene interference pharmaceutical composition according to a conventional preparation method in the field, wherein the pharmaceutical composition can treat nonalcoholic fatty liver disease, and pharmaceutically acceptable auxiliary materials for gene therapy, such as components for inhibiting RNA degradation, pH regulator or excipient and the like, can be contained in the pharmaceutical composition.

The siRNA sequence provided by the invention can effectively silence the mRNA level of DGAT2, wherein part of the siRNA sequence can even silence the mRNA level of DGAT2 to about 20%, the siRNA has obvious concentration effect, the IC50 of skeleton and nucleoside modified siRNA to DGAT2 gene can reach 0.033nM, and further terminal GalNAc modified siRNA conjugate is expected to improve the targeting to liver cells, and can be used for preparing gene therapy drugs for treating nonalcoholic fatty liver diseases.

Drawings

FIG. 1 shows the results of a JD-136, JD-531, JD-535, JD-702 and JD-710siRNA screen using 24h-25nM, 48h-25nM, 72h-25nM conditions.

FIG. 2 shows the results of a screening of JD-136, JD-531, JD-535, JD-702 and JD-710siRNA using 24h-25nM, 24h-50nM conditions.

FIG. 3 shows the result of inhibition of mRNA expression by DGAT2 by siRNA.

FIG. 4 shows the IC50 results of JD-137-M.

FIG. 5 shows the IC50 results of JD-272-M.

FIG. 6 shows the IC50 results for JD-529-M.

FIG. 7 shows the IC50 results of JD-535-M.

FIG. 8 shows the IC50 results of JD-535-1-M.

FIG. 9 shows the IC50 results of JD-535-4-M.

FIG. 10 shows a schematic structure of GalNAc-modified JD-272-GM.

FIG. 11 shows a schematic structure of GalNAc-modified JD-535-4-GM.

FIG. 12 shows the IC50 results of JD-272-GM.

FIG. 13 shows the IC50 results of JD-535-4-GM.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions can be made in the details and form of the invention without departing from the spirit and scope of the invention, but these modifications and substitutions are intended to be within the scope of the invention.

Experimental example 1 design and screening of siRNA sequence targeting diglycerol acyltransferase

1 laboratory apparatus, reagent and consumable

Conventional instrumentation: nanoDrop 2000 (ThermoFisher, ND-1000), PCR (Life), real Time PCR instrument (Agilent, MX 3005P), fluorescent quantitative PCR instrument (ABI, quantStudio).

Common reagents: high-grade fetal bovine serum FBS (Pan P303302), DMEM (M&C，CM15019)，1×PBS(M&C, CC 008), pancreatin-EDTA (0.25%, M&C，CC012)，Opti-MEM(Gibco，31985070)，Lipofectamine2000 ^TM (Invitrogen, 11668019), BIOZOL Total RNA extraction reagent (Bioer, BSC51M 1), hiScript III 1st Strand cDNA Synthesis Kit (+gDNA wind) (Vazyme, R312-02), goTaq qPCR ready-to-use 2x premix stock (GoTaq qPCR Master Mix, promega, A6002).

Commonly used consumables: 75cm ² Square, bevel-top, vented cell culture flask (Corning, 430641), 25cm ² Square, bezel, vented cover cell culture flasks (Corning, 430639), 24 well plates (NEST, 702001), 1000 μl long diameter blue enzyme-free tips (KIRGEN, KG 1333), 200 μl standard yellow enzyme-free tips (NEST, 302116), 10 μl long diameter colorless enzyme-free tips (NEST, 301016), 50mL enzyme-free centrifuge tubes (Trueline, TR 2021), 15mL enzyme-free centrifuge tubes (Trueline, TR 2010), 1.5mL enzyme-free centrifuge tubes (Axygen, MCT-150-C), 0.6mL enzyme-free centrifuge tubes (Axygen,MCT-060-C), 0.2mL of enzyme-free transparent PCR eight-row tube flat cover (special for fluorescence quantification, axygen, PCR-2 CP-RT-C), 0.1mL of enzyme-free transparent PCR eight-row tube flat cover (special for fluorescence quantification, KIRGEN, KG 2541).

2siRNA and primer

2.1 design of siRNA

siRNA design is carried out according to the DGAT2 coding gene sequence, TT is added to the 3' -end of the siRNA as a protruding overhang base, so that the stability of the siRNA double-strand complex is improved, meanwhile, certain sequences are prolonged or overhang bases are changed, and the sequences of 66 siRNAs shared for siRNA activity screening are shown in table 1.

And respectively synthesizing the sense strand RNA and the antisense strand RNA of the designed siRNA by a solid phase synthesizer. The nucleotide phosphoramidite chemistry and nucleic acid synthesis are used to synthesize the corresponding RNA according to the designed sequence on a solid phase synthesizer. The corresponding RNA strand is obtained through the steps of solid phase cutting, nucleoside deprotection, subsequent purification and the like. The resulting purified sense strand RNA and antisense strand RNA were prepared according to 1:1 ratio pairing corresponding sirnas were prepared for subsequent evaluation.

Table 1 design of siRNA sequences

/>

2.2 primers

TABLE 2 primer sequences

Name of the name	Sequence(s)
		DGAT2-Forward	GGCCTCCCGGAGACTGA
DGAT2-Reverse	AAGTGATTTGCAGCTGGTTCCT
		GAPDH-Forward	GCACCGTCAAGGCTGAGAAC
GAPDH-Reverse	TGGTGAAGACGCCAGTGGA

3 Experimental method

3.1 cell culture

(1) DMEM (+, +) medium configuration

445mL of DMEM medium was added with 50mL of FBS (sterile filter filtration) and 5mL of diabody (penicillin and streptomycin), and DMEM (+, +) containing 10% FBS and 1% diabody was prepared and stored in a refrigerator at 4℃for cell culture.

(2) DMEM (+, -) Medium configuration

450mL of DMEM medium was added with 50mL of FBS (sterile filter filtration) and DMEM (+, -) containing 10% FBS was stored in a refrigerator at 4℃for cell culture.

(3) Cell proliferation, passaging and plating

HepG2 cells were cultured in 75cm for resuscitative culture ² 15mL of DMEM (+, +) medium was added to the air-permeable cell culture flask, and the flask was left to stand under conditions of 37℃and CO ₂ The cells were propagated in 5% concentration culture incubator.

The cells were passaged when the cell density in the flask reached about 95%. The medium in the cell culture flask was discarded, washed twice with 1 XPBS (about 2 mL/time), and 1mL pancreatin was added to incubate the cellsThe cells were allowed to round in the tank, and after a small amount of cells had been allowed to float (about 5 min), 3mL of DMEM was added (++) to terminate the digestion. The cells were gently blown from the bottom with a 1mL pipette, taking care that no bubbles were generated as much as possible. The cell suspension was transferred to a 15mL centrifuge tube and centrifuged at 1000g/min for 5min. The supernatant was discarded, the cells were resuspended with fresh DMEM (++), about 1/3 of the cell suspension was added to 15mL DMEM (++), and the mixture was homogenized and added to a new 75cm volume ² Is continuously proliferated in the incubator.

Count with a cell counter plate and arrange 2X 10 ⁵ Per mL of cell heavy suspension, 0.5mL of cell heavy suspension is added to each hole of a 24-hole plate, and the mixture is placed into a cell incubator for culturing for 24 hours after shaking evenly by a cross method.

3.2 cell transfection

Cell transfection experiments were performed at a cell density of about 70% after 24h incubation in a 24-well plate cell incubator, using commercial transfection reagents to transfect nucleic acids. The transfection experiment comprises the following steps:

(1) Configuration of Lipofectamine 2000 ^TM +Opti-MEM stock solution

Lipofectamine 2000 in 24-well plate ^TM mu.L/well 25. Mu.L of Opti-MEM medium was added to 600. Mu.L of Opti-MEM medium to dilute to 625. Mu.L of LLipofectamine 2000 ^TM +Opti-MEM stock solution, after pipetting gun mixing, incubate for 5min at room temperature.

(2) Preparation of nucleic acid transfection stock solution

The siRNA sequence was 10. Mu.M stock (1 XPBS), and the siRNA was diluted to a transfection concentration of 25. Mu.L per well in Opti-MEM medium.

(3) Preparation of transfection stock solution

Lipofectamine 2000 after incubation in step (1) ^TM An equal volume (25. Mu.L per well) of +Opti-MEM stock was added to the nucleic acid transfection stock of step (2), and the mixture was mixed by pipetting 10-20 times, allowed to stand at room temperature and incubated for 10min.

(4) siRNA transfection

DMEM (++) medium was removed from 24-well plates and 450 μl DMEM was added to each well

(+, -) medium. Adding 50 mu L of the transfection stock solution in the step (3) into a 24-well plate according to the experimental design, mixing the stock solution by shaking gently, putting the stock solution into a cell incubator after the completion of the mixing, and evaluating the stock solution according to the transfection starting time of 24 hours or 48 hours or 72 hours (48 hours liquid exchange).

Evaluation of results

(1) Extraction of Total RNA

The method comprises the steps of extracting according to the specification of BIOZOL total RNA extraction reagent, detecting the concentration and absorption peak of RNA by using NanoDrop 2000, and carrying out the next reverse transcription after reaching the standard.

(2) Total RNA reverse transcription

A HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wind) kit of Norpraise was used. In accordance with the instruction procedure, the amount of reverse transcribed Total RNA was 500ng.

(3)qPCR

Promega was usedThe fluorescence quantitative detection kit for qPCR Master Mix has a fluorescence signal of SYBR Green. The procedure was followed in the experimental instructions, and 180. Mu.L of enzyme-free water (50. Mu.L for initial 5) was added to the post-reverse transcription system as Total RNA first strand cDNA, and the housekeeping gene selected for GAPDH.

TABLE 3 qPCR System configuration component content

TABLE 4 qPCR reaction procedure for mRNA

5 experimental results

5.1 time gradient and concentration screening

The evaluation of siRNA requires appropriate concentration and time. The mRNA structure of DGAT2 is simulated, two factors of loose structure, easy combination and effective probability are combined, 5 siRNAs of JD-136, JD-531, JD-535, JD-702 and JD-710 are selected, and time screening (24 h, 48h and 72 h) and concentration screening (25 nM and 50 nM) are carried out, wherein the 5 sequences all show gene silencing effect, and the effect of the JD-535 is the best. After time comparison, the time gradient effect is basically shown from 24h to 48h to 72h, the effect of 48h is obviously improved compared with 24h, but the gene silencing effect of 72h is not obviously improved compared with 48h, and a small-amplitude return rise of some sequences is also shown, which shows that 72h can possibly cause the increase of the gene silencing effect due to the degradation of siRNA, so 48h is selected as a screening time condition (figure 1). The siRNA showed a substantial concentration effect by comparing the concentrations of 25nM and 50nM, and all had a substantial gene silencing effect, so that the lower concentration of 25nM was selected as the concentration screening condition (FIG. 2).

5.2SiRNA sequence screening

The silencing effect of siRNA sequences on DGAT2 is shown in Table 5 and FIG. 3.

TABLE 5 experimental results of siRNA sequences on DGAT2 silencing efficacy

/>

Through screening of 1-66 designed siRNA sequences, siRNA with 3-5 bases moving around 272, 528-537 and 770 of mRNA coding region of DAGT and along the mRNA sequence of DGAT2 (without affecting the siRNA strand selectivity) can obtain better gene silencing effect (FIG. 3). Wherein the sequences JD-535, JD-137, JD-529, JD-272 and the like can silence the mRNA level of DGAT2 to about 20%, are effective siRNA sequences, and can be further modified and evaluated.

The JD-535 with good effect is selected for sequence extension, wherein the JD-535-1, the JD-535-2 and the JD-535-3 are siRNA sequences with 23 bases, and the extension mode is that 2 convex overhang bases are added at the 3' -end of the sense strand and the antisense strand of the siRNA after adding 2 complementary pairing bases according to the mRNA sequence; JD-535-4 is a 21 base siRNA sequence, and is extended by adding 2 overhanging bases (TT nucleosides in the original sequence are removed) to the 3' -end of the sense strand and the antisense strand of the siRNA according to the mRNA sequence. It was evaluated that this sequence extension has less effect on siRNA and no significant difference in gene silencing effect compared to the JD-535 sequence.

The sequences JD-137, JD-272, JD-529, JD-535-1, JD-535-4 were selected for further modification and evaluation, the specific modifications of which are shown in Table 6 below:

TABLE 6 modification of siRNA

Wherein phosphorothioate modification, subscript m 2' -methoxy modification, subscript f 2' -fluoro modification, phos 5' phosphorylation modification.

The two ends of the sense strand and the antisense strand of the siRNA are modified by two phosphorothioates, which is mainly used for enhancing the stability of the siRNA and reducing the degradation of the siRNA by the exonuclease. The phosphorothioate modification is to change the oxidizing reagent of the DNA solid phase synthesizer into a thioating reagent to change one of the non-ester-bond oxygen of the phosphodiester bond into sulfur. Methoxy modification of 2' -OH can promote binding force between siRNA and target sequence and enhance enzyme stability of siRNA; fluoro modifications also enhance the enzymatic stability of siRNA. Since an excessive number of methylation affects the effect of siRNA, fluoro and methoxy are used alternately. Fluoro and methoxy modifications were achieved by solid phase synthesis using fluoro or methoxy commercial phosphoramidite monomers in the synthesis of nucleic acids using a solid phase synthesizer. Since siRNA functions by 5' phosphorylation of antisense strand nucleic acid in cells, advanced modification is more effective with siRNA.

5.3IC50 experiment

The first 6 siRNA sequences modified in Table 6 were subjected to the above experimental methods and conditions for siRNA screening, and the gene silencing effect at siRNA concentrations of 0.005, 0.01, 0.05, 0.1, 0.2, 0.5, 1, 5, 25, 50, 100nM and 48h post-transfection was determined and IC50 values for the corresponding siRNA effect were calculated by fitting silencing efficiencies at different concentrations. (FIGS. 4-9)

As shown in Table 7, the IC50 value of the 6 sequences was 0.159nM, 0.033nM for JD-272-M, 0.155nM for JD-535-M, 0.056nM for JD-529-M, 0.142nM for JD-535-1-M and 0.093nM for JD-535-4-M. Further modification of 535-4M in 272M and 535 related sequences with the lowest IC50 value was selected, and a tridentate acetylgalactosamine (GalNAc) group was introduced at the 3' -end of the sense strand of the siRNA for functional modification (FIG. 10 and FIG. 11), and the test was performed again according to the method and conditions of the above-mentioned IC50 experiment of the siRNA, and the corresponding IC50 value was calculated, and the evaluation results are shown in Table 7, FIG. 12 and FIG. 13.

TABLE 7 IC50 of modified sequences

Sequence name	IC50(nM)
		JD-137-M	0.159
JD-272-M	0.033
		JD-529-M	0.056
JD-535-M	0.155
		JD-535-1-M	0.142
JD-535-4-M	0.093
		JD-272-GM	0.118
JD-535-4-GM	0.036

SEQUENCE LISTING

<110> university of Beijing medical department

<120> siRNA targeting diglycerol acyltransferase and uses thereof

<130> BJ-1001-211107A

<160> 134

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artifical sequence

<400> 1

cauagacuau uugcuuucat t 21

<210> 2

<211> 21

<212> DNA

<213> Artifical sequence

<400> 2

ugaaagcaaa uagucuaugt t 21

<210> 3

<211> 21

<212> DNA

<213> Artifical sequence

<400> 3

ccugcagugc cauccucaut t 21

<210> 4

<211> 21

<212> DNA

<213> Artifical sequence

<400> 4

augaggaugg cacugcaggt t 21

<210> 5

<211> 21

<212> DNA

<213> Artifical sequence

<400> 5

gugccauccu cauguacaut t 21

<210> 6

<211> 21

<212> DNA

<213> Artifical sequence

<400> 6

auguacauga ggauggcact t 21

<210> 7

<211> 21

<212> DNA

<213> Artifical sequence

<400> 7

ugccauccuc auguacauat t 21

<210> 8

<211> 21

<212> DNA

<213> Artifical sequence

<400> 8

uauguacaug aggauggcat t 21

<210> 9

<211> 21

<212> DNA

<213> Artifical sequence

<400> 9

gccauccuca uguacauaut t 21

<210> 10

<211> 21

<212> DNA

<213> Artifical sequence

<400> 10

auauguacau gaggauggct t 21

<210> 11

<211> 21

<212> DNA

<213> Artifical sequence

<400> 11

ccauccucau guacauauut t 21

<210> 12

<211> 21

<212> DNA

<213> Artifical sequence

<400> 12

aauauguaca ugaggauggt t 21

<210> 13

<211> 21

<212> DNA

<213> Artifical sequence

<400> 13

uacauauucu gcacugauut t 21

<210> 14

<211> 21

<212> DNA

<213> Artifical sequence

<400> 14

aaucagugca gaauauguat t 21

<210> 15

<211> 21

<212> DNA

<213> Artifical sequence

<400> 15

gcugugcucu acuucacuut t 21

<210> 16

<211> 21

<212> DNA

<213> Artifical sequence

<400> 16

aagugaagua gagcacagct t 21

<210> 17

<211> 21

<212> DNA

<213> Artifical sequence

<400> 17

acuucacuug gcugguguut t 21

<210> 18

<211> 21

<212> DNA

<213> Artifical sequence

<400> 18

aacaccagcc aagugaagut t 21

<210> 19

<211> 21

<212> DNA

<213> Artifical sequence

<400> 19

cuucacuugg cugguguuut t 21

<210> 20

<211> 21

<212> DNA

<213> Artifical sequence

<400> 20

aaacaccagc caagugaagt t 21

<210> 21

<211> 21

<212> DNA

<213> Artifical sequence

<400> 21

gguguuugac uggaacacat t 21

<210> 22

<211> 21

<212> DNA

<213> Artifical sequence

<400> 22

uguguuccag ucaaacacct t 21

<210> 23

<211> 21

<212> DNA

<213> Artifical sequence

<400> 23

gggcugugug gcgcuacuut t 21

<210> 24

<211> 21

<212> DNA

<213> Artifical sequence

<400> 24

aaguagcgcc acacagccct t 21

<210> 25

<211> 21

<212> DNA

<213> Artifical sequence

<400> 25

cgcuacuuuc gagacuacut t 21

<210> 26

<211> 21

<212> DNA

<213> Artifical sequence

<400> 26

aguagucucg aaaguagcgt t 21

<210> 27

<211> 21

<212> DNA

<213> Artifical sequence

<400> 27

gcuacuuucg agacuacuut t 21

<210> 28

<211> 21

<212> DNA

<213> Artifical sequence

<400> 28

aaguagucuc gaaaguagct t 21

<210> 29

<211> 21

<212> DNA

<213> Artifical sequence

<400> 29

cuacuuucga gacuacuuut t 21

<210> 30

<211> 21

<212> DNA

<213> Artifical sequence

<400> 30

aaaguagucu cgaaaguagt t 21

<210> 31

<211> 21

<212> DNA

<213> Artifical sequence

<400> 31

gcugaccacc aggaacuaut t 21

<210> 32

<211> 21

<212> DNA

<213> Artifical sequence

<400> 32

auaguuccug guggucagct t 21

<210> 33

<211> 21

<212> DNA

<213> Artifical sequence

<400> 33

cugaccacca ggaacuauat t 21

<210> 34

<211> 21

<212> DNA

<213> Artifical sequence

<400> 34

uauaguuccu gguggucagt t 21

<210> 35

<211> 21

<212> DNA

<213> Artifical sequence

<400> 35

ccaccaggaa cuauaucuut t 21

<210> 36

<211> 21

<212> DNA

<213> Artifical sequence

<400> 36

aagauauagu uccugguggt t 21

<210> 37

<211> 21

<212> DNA

<213> Artifical sequence

<400> 37

caccaggaac uauaucuuut t 21

<210> 38

<211> 21

<212> DNA

<213> Artifical sequence

<400> 38

aaagauauag uuccuggugt t 21

<210> 39

<211> 21

<212> DNA

<213> Artifical sequence

<400> 39

aggaacuaua ucuuuggaut t 21

<210> 40

<211> 21

<212> DNA

<213> Artifical sequence

<400> 40

auccaaagau auaguuccut t 21

<210> 41

<211> 21

<212> DNA

<213> Artifical sequence

<400> 41

acuauaucuu uggauaccat t 21

<210> 42

<211> 21

<212> DNA

<213> Artifical sequence

<400> 42

ugguauccaa agauauagut t 21

<210> 43

<211> 21

<212> DNA

<213> Artifical sequence

<400> 43

cagaagugag caagaaguut t 21

<210> 44

<211> 21

<212> DNA

<213> Artifical sequence

<400> 44

aacuucuugc ucacuucugt t 21

<210> 45

<211> 21

<212> DNA

<213> Artifical sequence

<400> 45

acuuccgaau gccuguguut t 21

<210> 46

<211> 21

<212> DNA

<213> Artifical sequence

<400> 46

aacacaggca uucggaagut t 21

<210> 47

<211> 21

<212> DNA

<213> Artifical sequence

<400> 47

uguugaggga guaccugaut t 21

<210> 48

<211> 21

<212> DNA

<213> Artifical sequence

<400> 48

aucagguacu cccucaacat t 21

<210> 49

<211> 21

<212> DNA

<213> Artifical sequence

<400> 49

accugauguc uggagguaut t 21

<210> 50

<211> 21

<212> DNA

<213> Artifical sequence

<400> 50

auaccuccag acaucaggut t 21

<210> 51

<211> 21

<212> DNA

<213> Artifical sequence

<400> 51

ccgggacacc auagacuaut t 21

<210> 52

<211> 21

<212> DNA

<213> Artifical sequence

<400> 52

auagucuaug gugucccggt t 21

<210> 53

<211> 21

<212> DNA

<213> Artifical sequence

<400> 53

cgggacacca uagacuauut t 21

<210> 54

<211> 21

<212> DNA

<213> Artifical sequence

<400> 54

aauagucuau ggugucccgt t 21

<210> 55

<211> 21

<212> DNA

<213> Artifical sequence

<400> 55

gggacaccau agacuauuut t 21

<210> 56

<211> 21

<212> DNA

<213> Artifical sequence

<400> 56

aaauagucua ugguguccct t 21

<210> 57

<211> 21

<212> DNA

<213> Artifical sequence

<400> 57

ggacaccaua gacuauuugt t 21

<210> 58

<211> 21

<212> DNA

<213> Artifical sequence

<400> 58

caaauagucu auggugucct t 21

<210> 59

<211> 21

<212> DNA

<213> Artifical sequence

<400> 59

caccauagac uauuugcuut t 21

<210> 60

<211> 21

<212> DNA

<213> Artifical sequence

<400> 60

aagcaaauag ucuauggugt t 21

<210> 61

<211> 21

<212> DNA

<213> Artifical sequence

<400> 61

accauagacu auuugcuuut t 21

<210> 62

<211> 21

<212> DNA

<213> Artifical sequence

<400> 62

aaagcaaaua gucuauggut t 21

<210> 63

<211> 21

<212> DNA

<213> Artifical sequence

<400> 63

cauagacuau uugcuuucat t 21

<210> 64

<211> 21

<212> DNA

<213> Artifical sequence

<400> 64

ugaaagcaaa uagucuaugt t 21

<210> 65

<211> 21

<212> DNA

<213> Artifical sequence

<400> 65

gacuauuugc uuucaaagat t 21

<210> 66

<211> 21

<212> DNA

<213> Artifical sequence

<400> 66

ucuuugaaag caaauaguct t 21

<210> 67

<211> 21

<212> DNA

<213> Artifical sequence

<400> 67

cuauuugcuu ucaaagaaut t 21

<210> 68

<211> 21

<212> DNA

<213> Artifical sequence

<400> 68

auucuuugaa agcaaauagt t 21

<210> 69

<211> 21

<212> DNA

<213> Artifical sequence

<400> 69

gcuuucaaag aaugggagut t 21

<210> 70

<211> 21

<212> DNA

<213> Artifical sequence

<400> 70

acucccauuc uuugaaagct t 21

<210> 71

<211> 21

<212> DNA

<213> Artifical sequence

<400> 71

gggaguggca augcuaucat t 21

<210> 72

<211> 21

<212> DNA

<213> Artifical sequence

<400> 72

ugauagcauu gccacuccct t 21

<210> 73

<211> 21

<212> DNA

<213> Artifical sequence

<400> 73

ggaguggcaa ugcuaucaut t 21

<210> 74

<211> 21

<212> DNA

<213> Artifical sequence

<400> 74

augauagcau ugccacucct t 21

<210> 75

<211> 21

<212> DNA

<213> Artifical sequence

<400> 75

guggcaaugc uaucaucaut t 21

<210> 76

<211> 21

<212> DNA

<213> Artifical sequence

<400> 76

augaugauag cauugccact t 21

<210> 77

<211> 21

<212> DNA

<213> Artifical sequence

<400> 77

gcaaugcuau caucaucgut t 21

<210> 78

<211> 21

<212> DNA

<213> Artifical sequence

<400> 78

acgaugauga uagcauugct t 21

<210> 79

<211> 21

<212> DNA

<213> Artifical sequence

<400> 79

gcuccaugcc uggcaagaat t 21

<210> 80

<211> 21

<212> DNA

<213> Artifical sequence

<400> 80

uucuugccag gcauggagct t 21

<210> 81

<211> 21

<212> DNA

<213> Artifical sequence

<400> 81

gguucccauc uacuccuuut t 21

<210> 82

<211> 21

<212> DNA

<213> Artifical sequence

<400> 82

aaaggaguag augggaacct t 21

<210> 83

<211> 21

<212> DNA

<213> Artifical sequence

<400> 83

cuacuccuuu ggagagaaut t 21

<210> 84

<211> 21

<212> DNA

<213> Artifical sequence

<400> 84

auucucucca aaggaguagt t 21

<210> 85

<211> 21

<212> DNA

<213> Artifical sequence

<400> 85

cuccuuugga gagaaugaat t 21

<210> 86

<211> 21

<212> DNA

<213> Artifical sequence

<400> 86

uucauucucu ccaaaggagt t 21

<210> 87

<211> 21

<212> DNA

<213> Artifical sequence

<400> 87

ccuuuggaga gaaugaagut t 21

<210> 88

<211> 21

<212> DNA

<213> Artifical sequence

<400> 88

acuucauucu cuccaaaggt t 21

<210> 89

<211> 21

<212> DNA

<213> Artifical sequence

<400> 89

gagagaauga aguguacaat t 21

<210> 90

<211> 21

<212> DNA

<213> Artifical sequence

<400> 90

uuguacacuu cauucucuct t 21

<210> 91

<211> 21

<212> DNA

<213> Artifical sequence

<400> 91

guguacaagc aggugaucut t 21

<210> 92

<211> 21

<212> DNA

<213> Artifical sequence

<400> 92

agaucaccug cuuguacact t 21

<210> 93

<211> 21

<212> DNA

<213> Artifical sequence

<400> 93

uguacaagca ggugaucuut t 21

<210> 94

<211> 21

<212> DNA

<213> Artifical sequence

<400> 94

aagaucaccu gcuuguacat t 21

<210> 95

<211> 21

<212> DNA

<213> Artifical sequence

<400> 95

gaugggucca gaagaaguut t 21

<210> 96

<211> 21

<212> DNA

<213> Artifical sequence

<400> 96

aacuucuucu ggacccauct t 21

<210> 97

<211> 21

<212> DNA

<213> Artifical sequence

<400> 97

cagaagaagu uccagaaaut t 21

<210> 98

<211> 21

<212> DNA

<213> Artifical sequence

<400> 98

auuucuggaa cuucuucugt t 21

<210> 99

<211> 21

<212> DNA

<213> Artifical sequence

<400> 99

agaagaaguu ccagaaauat t 21

<210> 100

<211> 21

<212> DNA

<213> Artifical sequence

<400> 100

uauuucugga acuucuucut t 21

<210> 101

<211> 21

<212> DNA

<213> Artifical sequence

<400> 101

agaaguucca gaaauacaut t 21

<210> 102

<211> 21

<212> DNA

<213> Artifical sequence

<400> 102

auguauuucu ggaacuucut t 21

<210> 103

<211> 21

<212> DNA

<213> Artifical sequence

<400> 103

gaaguuccag aaauacauut t 21

<210> 104

<211> 21

<212> DNA

<213> Artifical sequence

<400> 104

aauguauuuc uggaacuuct t 21

<210> 105

<211> 21

<212> DNA

<213> Artifical sequence

<400> 105

uccagaaaua cauugguuut t 21

<210> 106

<211> 21

<212> DNA

<213> Artifical sequence

<400> 106

aaaccaaugu auuucuggat t 21

<210> 107

<211> 21

<212> DNA

<213> Artifical sequence

<400> 107

accuguacca caccauguat t 21

<210> 108

<211> 21

<212> DNA

<213> Artifical sequence

<400> 108

uacauggugu gguacaggut t 21

<210> 109

<211> 21

<212> DNA

<213> Artifical sequence

<400> 109

uguaccacac cauguacaut t 21

<210> 110

<211> 21

<212> DNA

<213> Artifical sequence

<400> 110

auguacaugg ugugguacat t 21

<210> 111

<211> 21

<212> DNA

<213> Artifical sequence

<400> 111

ucgacaagca caagaccaat t 21

<210> 112

<211> 21

<212> DNA

<213> Artifical sequence

<400> 112

uuggucuugu gcuugucgat t 21

<210> 113

<211> 21

<212> DNA

<213> Artifical sequence

<400> 113

cucugucacc uggcucaaut t 21

<210> 114

<211> 21

<212> DNA

<213> Artifical sequence

<400> 114

auugagccag gugacagagt t 21

<210> 115

<211> 21

<212> DNA

<213> Artifical sequence

<400> 115

ucugucaccu ggcucaauat t 21

<210> 116

<211> 21

<212> DNA

<213> Artifical sequence

<400> 116

uauugagcca ggugacagat t 21

<210> 117

<211> 21

<212> DNA

<213> Artifical sequence

<400> 117

ccuggcucaa uagguccaat t 21

<210> 118

<211> 21

<212> DNA

<213> Artifical sequence

<400> 118

uuggaccuau ugagccaggt t 21

<210> 119

<211> 21

<212> DNA

<213> Artifical sequence

<400> 119

auagguccaa gguggaaaat t 21

<210> 120

<211> 21

<212> DNA

<213> Artifical sequence

<400> 120

uuuuccaccu uggaccuaut t 21

<210> 121

<211> 21

<212> DNA

<213> Artifical sequence

<400> 121

caagguggaa aagcagcuat t 21

<210> 122

<211> 21

<212> DNA

<213> Artifical sequence

<400> 122

uagcugcuuu uccaccuugt t 21

<210> 123

<211> 21

<212> DNA

<213> Artifical sequence

<400> 123

ggauucugug aagggaagut t 21

<210> 124

<211> 21

<212> DNA

<213> Artifical sequence

<400> 124

acuucccuuc acagaaucct t 21

<210> 125

<211> 21

<212> DNA

<213> Artifical sequence

<400> 125

ccugugacgg gcacuggaut t 21

<210> 126

<211> 21

<212> DNA

<213> Artifical sequence

<400> 126

auccagugcc cgucacaggt t 21

<210> 127

<211> 23

<212> RNA

<213> Artifical sequence

<400> 127

uagacuauuu gcuuucaaag aau 23

<210> 128

<211> 22

<212> RNA

<213> Artifical sequence

<400> 128

ucuuugaaag caaauagucu au 22

<210> 129

<211> 23

<212> RNA

<213> Artifical sequence

<400> 129

agacuauuug cuuucaaaga auc 23

<210> 130

<211> 23

<212> RNA

<213> Artifical sequence

<400> 130

uucuuugaaa gcaaauaguc uau 23

<210> 131

<211> 23

<212> RNA

<213> Artifical sequence

<400> 131

gacuauuugc uuucaaagaa ucc 23

<210> 132

<211> 23

<212> RNA

<213> Artifical sequence

<400> 132

auucuuugaa agcaaauagu cua 23

<210> 133

<211> 21

<212> RNA

<213> Artifical sequence

<400> 133

gacuauuugc uuucaaagaa u 21

<210> 134

<211> 21

<212> RNA

<213> Artifical sequence

<400> 134

ucuuugaaag caaauagucu a 21

Claims

1. An siRNA targeting a diglycerol acyltransferase, wherein the siRNA is selected from any one of the following 66 sirnas consisting of sense strand RNA and antisense strand RNA:

(66) An siRNA sense strand antisense strand consisting of sense strand RNA shown in SEQ ID No.131 and antisense strand RNA shown in SEQ ID No. 132;

preferably, the siRNA is selected from any one of the following sirnas:

an siRNA composed of sense strand RNA shown in SEQ ID No.9 and antisense strand RNA shown in SEQ ID No. 10; or siRNA composed of sense strand RNA shown in SEQ ID No.25 and antisense strand RNA shown in SEQ ID No. 26; or siRNA composed of sense strand RNA shown in SEQ ID No.57 and antisense strand RNA shown in SEQ ID No. 58; or siRNA composed of sense strand RNA shown in SEQ ID No.59 and antisense strand RNA shown in SEQ ID No. 60; or siRNA composed of sense strand RNA shown in SEQ ID No.63 and antisense strand RNA shown in SEQ ID No. 64; or siRNA composed of sense strand RNA shown in SEQ ID No.65 and antisense strand RNA shown in SEQ ID No. 66; or siRNA composed of sense strand RNA shown in SEQ ID No.97 and antisense strand RNA shown in SEQ ID No. 98; or siRNA composed of sense strand RNA shown in SEQ ID No.125 and antisense strand RNA shown in SEQ ID No. 126; or siRNA composed of sense strand RNA shown in SEQ ID No.127 and antisense strand RNA shown in SEQ ID No. 128; or siRNA composed of sense strand RNA shown in SEQ ID No.129 and antisense strand RNA shown in SEQ ID No. 130; or siRNA composed of sense strand RNA shown in SEQ ID No.131 and antisense strand RNA shown in SEQ ID No. 132.

2. An siRNA sequence of claim 1 having 15 consecutive nucleotide sequences or more.

3. The modified siRNA of claim 1 or 2, wherein the modified siRNA is obtained by subjecting the siRNA to skeleton modification, sugar ring modification and/or base modification.

4. A modified siRNA according to claim 3, wherein the backbone modification includes, but is not limited to: performing thio modification and/or amino modification on the phosphate frameworks of the sense strand RNA and the antisense strand RNA of the siRNA; such sugar ring modifications include, but are not limited to: substitution of 2 "-OH in the nucleotide with methoxy, methylethoxy and/or fluoro, or deoxygenation modification of 2' -OH in the nucleotide; or a modification to change a nucleotide in the siRNA to a peptide nucleic acid type, a locked nucleic acid type, or an unlocked nucleic acid type; such base modifications include, but are not limited to: base modification or substitution of the nucleoside bases 5-methylcytosine, 6-methyladenine, ribavirin, pseudouracil and/or inosine;

preferably, the modified siRNA is selected from any one of the following 8 groups of modified siRNAs consisting of sense strand nucleic acid and antisense strand nucleic acid:

(1) Sense strand: c (C) _m *C _m *A _m U _m C _m C _m U _f C _m A _f U _m G _f U _m A _f C _m A _m U _m A _m U _m U _m *T*T，Antisense strand: phos-A _m *A _f *U _f A _f U _m G _f U _m A _f C _m A _f U _m G _f A _m G _f G _m A _f U _m G _m G _m *T*T；

(5) Sense of senseChain: u (U) _m *A _m *G _m A _m C _m U _m A _f U _m U _f U _m G _f C _m U _f U _m U _f C _m A _f A _m A _m G _m A _m *A _m *U _m The antisense strand: phos-U _m *C _f *U _f U _f U _m G _f A _m A _f A _m G _f C _m A _f A _m A _f U _m A _f G _m U _f C _m U _f A _m *U _m *G _m ；

Wherein, is phosphorothioate modification, subscript _m For 2' -methoxy modification, subscript _f For 2 '-fluoro modifications, phos is a 5' phosphorylation modification.

5. An siRNA conjugate, characterized in that the siRNA of claim 1 or 2 is conjugated to a conjugate group; or an siRNA conjugate obtained by conjugating the modified siRNA according to claim 3 or 4 with a conjugation group.

6. The siRNA conjugate of claim 5, wherein the conjugate group is a GalNAc group.

7. A recombinant expression vector, shRNA or sdRNA expressing the siRNA of claim 1 or 2; a recombinant expression vector, shRNA or sdRNA expressing the modified siRNA of claim 3 or 4; preferably, the recombinant expression vector is a eukaryotic recombinant expression vector, more preferably, the eukaryotic recombinant expression vector is a recombinant adenovirus expression vector.

8. A host cell comprising the recombinant expression vector of claim 7, preferably said host cell is a mammalian cell.

9. Use of the siRNA of claim 1 or 2, the modified siRNA of claim 3 or 4 or the siRNA conjugate of claim 5 or 6 in the preparation of a gene therapy medicament for the treatment of non-alcoholic fatty liver disease.

10. Use of the recombinant expression vector of claim 7 in the preparation of a gene therapy drug for the treatment of non-alcoholic fatty liver disease.