CN116622897A - Application of SNP molecular marker in identification of cabbage clubroot resistance and/or cabbage breeding with clubroot resistance - Google Patents
Application of SNP molecular marker in identification of cabbage clubroot resistance and/or cabbage breeding with clubroot resistance Download PDFInfo
- Publication number
- CN116622897A CN116622897A CN202310760891.XA CN202310760891A CN116622897A CN 116622897 A CN116622897 A CN 116622897A CN 202310760891 A CN202310760891 A CN 202310760891A CN 116622897 A CN116622897 A CN 116622897A
- Authority
- CN
- China
- Prior art keywords
- crr5
- clubroot
- cabbage
- chinese cabbage
- reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 240000007124 Brassica oleracea Species 0.000 title claims abstract description 28
- 235000003899 Brassica oleracea var acephala Nutrition 0.000 title claims abstract description 28
- 235000011301 Brassica oleracea var capitata Nutrition 0.000 title claims abstract description 28
- 235000001169 Brassica oleracea var oleracea Nutrition 0.000 title claims abstract description 28
- 238000009395 breeding Methods 0.000 title claims abstract description 24
- 230000001488 breeding effect Effects 0.000 title claims abstract description 24
- 239000003147 molecular marker Substances 0.000 title claims abstract description 24
- 235000010149 Brassica rapa subsp chinensis Nutrition 0.000 claims abstract description 50
- 235000000536 Brassica rapa subsp pekinensis Nutrition 0.000 claims abstract description 50
- 241000499436 Brassica rapa subsp. pekinensis Species 0.000 claims abstract description 50
- 238000000034 method Methods 0.000 claims description 21
- 239000003153 chemical reaction reagent Substances 0.000 claims description 20
- 238000006243 chemical reaction Methods 0.000 claims description 11
- 230000003321 amplification Effects 0.000 claims description 9
- 238000003205 genotyping method Methods 0.000 claims description 9
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 9
- 239000002773 nucleotide Substances 0.000 claims description 9
- 125000003729 nucleotide group Chemical group 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 230000002860 competitive effect Effects 0.000 claims description 6
- 238000007844 allele-specific PCR Methods 0.000 claims description 5
- 239000003086 colorant Substances 0.000 claims description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 3
- 238000012216 screening Methods 0.000 abstract description 5
- 201000010099 disease Diseases 0.000 description 34
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 34
- 239000000463 material Substances 0.000 description 22
- 239000003550 marker Substances 0.000 description 20
- 108090000623 proteins and genes Proteins 0.000 description 15
- 208000035240 Disease Resistance Diseases 0.000 description 8
- 241000196324 Embryophyta Species 0.000 description 8
- 238000001514 detection method Methods 0.000 description 8
- 239000000047 product Substances 0.000 description 4
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 3
- 238000004925 denaturation Methods 0.000 description 3
- 230000036425 denaturation Effects 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 206010028980 Neoplasm Diseases 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 230000001580 bacterial effect Effects 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 230000004069 differentiation Effects 0.000 description 2
- 238000010413 gardening Methods 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 238000011835 investigation Methods 0.000 description 2
- PHTQWCKDNZKARW-UHFFFAOYSA-N isoamylol Chemical compound CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 235000015097 nutrients Nutrition 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 241000219198 Brassica Species 0.000 description 1
- 235000003351 Brassica cretica Nutrition 0.000 description 1
- 235000014698 Brassica juncea var multisecta Nutrition 0.000 description 1
- 240000002791 Brassica napus Species 0.000 description 1
- 235000011293 Brassica napus Nutrition 0.000 description 1
- 235000006008 Brassica napus var napus Nutrition 0.000 description 1
- 240000000385 Brassica napus var. napus Species 0.000 description 1
- 235000011299 Brassica oleracea var botrytis Nutrition 0.000 description 1
- 235000017647 Brassica oleracea var italica Nutrition 0.000 description 1
- 240000003259 Brassica oleracea var. botrytis Species 0.000 description 1
- 235000006618 Brassica rapa subsp oleifera Nutrition 0.000 description 1
- 235000003343 Brassica rupestris Nutrition 0.000 description 1
- 235000004977 Brassica sinapistrum Nutrition 0.000 description 1
- 244000088415 Raphanus sativus Species 0.000 description 1
- 235000006140 Raphanus sativus var sativus Nutrition 0.000 description 1
- 229910000831 Steel Inorganic materials 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000012620 biological material Substances 0.000 description 1
- QKSKPIVNLNLAAV-UHFFFAOYSA-N bis(2-chloroethyl) sulfide Chemical compound ClCCSCCCl QKSKPIVNLNLAAV-UHFFFAOYSA-N 0.000 description 1
- 201000011510 cancer Diseases 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 230000032798 delamination Effects 0.000 description 1
- 208000022602 disease susceptibility Diseases 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000011536 extraction buffer Substances 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 230000002458 infectious effect Effects 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 235000010460 mustard Nutrition 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 230000001376 precipitating effect Effects 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 230000035755 proliferation Effects 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 239000011540 sensing material Substances 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000010959 steel Substances 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 230000001502 supplementing effect Effects 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular marker assisted breeding, and relates to application of SNP molecular marker A08-12285323 in identification of cabbage clubroot resistance and/or cabbage breeding resistant to clubroot. The invention provides an application of SNP molecular markers A08-12285323 in identifying cabbage clubroot resistance and/or clubroot resistance cabbage breeding, wherein the sequence of the SNP molecular markers A08-12285323 is shown as SEQ ID NO.1, the 70 th base from the 5' end of the sequence shown as SEQ ID NO.1 is a SNP locus, and the base is T or C. The SNP molecular marker A08-12285323 can realize identification of the anti-clubroot Chinese cabbage, and is used for screening the breeding of the anti-clubroot Chinese cabbage.
Description
Technical Field
The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to application of SNP molecular marker A08-12285323 in identification of cabbage clubroot resistance and/or clubroot-resistant cabbage breeding.
Background
Clubroot, also known as "root cancer", is a worldwide soil-borne disease caused by infection with brassica napus (plasmmodiophora brassicae woron), mainly infecting cruciferous plants such as chinese cabbage, radish, broccoli, mustard, canola, etc. After infection, the rhizomatosis can cause abnormal proliferation of root cells and form tumors, thereby affecting the transportation of moisture and nutrient substances and causing the lack of nutrient wilt of the overground parts of plants until the death of the whole plants. The method for cultivating the disease-resistant variety by utilizing the clubroot-resistant gene has the characteristics of safety, high efficiency and economy, is one of important ways for fundamentally solving the trouble of the clubroot, and can greatly improve the disease-resistant breeding efficiency by searching a molecular marker closely linked with the clubroot-resistant gene and utilizing the molecular marker to assist in selective breeding (marker-assisted selection). Therefore, screening more SNP related to cabbage clubroot resistance genes, being applied to the selection of cabbage disease-resistant materials and the breeding of disease-resistant varieties, and having important significance in improving the yield and quality of cabbage and the like.
Disclosure of Invention
The invention aims to provide an application of SNP molecular markers A08-12285323 in identifying the clubroot resistance of Chinese cabbages and/or the breeding of the Chinese cabbages with clubroot resistance. The SNP molecular marker A08-12285323 can realize identification of the anti-clubroot Chinese cabbage, and is used for screening the breeding of the anti-clubroot Chinese cabbage.
The invention provides an application of SNP molecular markers A08-12285323 in identifying cabbage clubroot resistance and/or clubroot resistance cabbage breeding, wherein the sequence of the SNP molecular markers A08-12285323 is shown as SEQ ID NO.1, the 70 th base from the 5' end of the sequence shown as SEQ ID NO.1 is a SNP locus, and the base is T or C.
The invention also provides a reagent for detecting the SNP molecular marker A08-12285323 in the application of the technical scheme.
Preferably, the reagent comprises primer set Crr5-funK2, and primer set Crr5-funK2 comprises Crr5-funK2Fa, crr5-funK2Fb and Crr5-funK2R; the nucleotide sequence of Crr-funK 2Fa is shown in SEQ ID NO. 2; the nucleotide sequence of Crr-funK 2Fb is shown in SEQ ID NO. 3; the nucleotide sequence of Crr-funK 2R is shown in SEQ ID NO. 4.
Preferably, the Crr5-funK2Fa and Crr5-funK2Fb are labeled with fluorescent groups of different colors, respectively.
Preferably, the fluorescent groups include FAM and HEX.
The invention also provides a kit for detecting the SNP molecular marker A08-12285323 in the application of the technical scheme, and the kit comprises the reagent and the reaction solution in the technical scheme.
The invention also provides the application of the reagent or the kit in the technical scheme in identifying the clubroot resistance of the Chinese cabbage and/or the breeding of the Chinese cabbage with clubroot resistance.
The invention also provides a method for identifying the clubroot resistance of the celery cabbage, which comprises the following steps:
the reagent or the kit of the technical proposal is used for carrying out competitive allele specific PCR amplification on the genome DNA of the Chinese cabbage, and finally, the KASP amplification product is subjected to end-point method fluorescent signal reading to obtain a genotyping result, when the genotype is TT or TC, the Chinese cabbage is identified as the Chinese cabbage with clubroot resistance, and when the genotype is CC, the Chinese cabbage is identified as the Chinese cabbage with clubroot resistance.
Preferably, the PCR amplification reaction system comprises, in 8. Mu.L, 1.5. Mu.L of genomic DNA, 4. Mu.L of KASP Mastermix (2X), 0.14. Mu.L of primer set Crr-funK 2 and the balance of water.
Preferably, the reaction procedure of the PCR amplification comprises: 94 ℃ for 15min;94℃for 20s and 61℃for 60s, for a total of 10 cycles, each cycle being reduced by 0.6℃from the second cycle; 94 ℃ for 20s and 55 ℃ for 60s, 26 cycles are total; 1min at 37 ℃.
The invention provides an application of SNP molecular markers A08-12285323 in identifying cabbage clubroot resistance and/or cabbage breeding resistant to clubroot. The SNP molecular marker A08-12285323 can realize identification of the anti-clubroot Chinese cabbage, and is used for screening the breeding of the anti-clubroot Chinese cabbage. Specifically, the detection is carried out by using the reagent for detecting the SNP molecular marker A08-12285323, so that the differentiation and identification of the clubroot resistant and clubroot-sensitive materials of the cabbages can be realized, the individuals containing the clubroot resistant gene Crr in the offspring population of the cabbages can be rapidly screened on the molecular level, the accuracy is high, and the disease-resistant breeding efficiency can be greatly improved.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions of the prior art, the drawings that are needed in the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the result of the present invention using the marker Crr5-funK2 pair F 2 Performing KASP genotyping result graph on the population;
FIG. 2 is a graph showing the results of KASP genotyping of natural populations using the marker Crr5-funK2 provided by the present invention.
Detailed Description
The invention provides an application of SNP molecular markers A08-12285323 in identifying cabbage clubroot resistance and/or clubroot resistance cabbage breeding, wherein the sequence of the SNP molecular markers A08-12285323 is shown as SEQ ID NO.1 (ACTCAAACCAAACATAACACACAATGATAATCTAACACACATACTGCAAAATGCGAAATGTTTCTTCAGYTTCCATCAACATGAGAGAGCTAAGCTTTCTAAAGGACGTAGCCCGCATTCTTTAATCTCCCCGTTTTTT, Y=T/C), the 70 th base from the 5' end of the sequence shown as SEQ ID NO.1 is a SNP locus, and the base is T or C. The SNP molecular marker A08-12285323 is a SNP molecular marker of a cabbage clubroot resistance related gene Crr. The invention discloses SNP molecular markers A08-12285323 related to a Chinese cabbage clubroot resistance trait gene Crr5 for the first time. The detection is carried out by using the reagent for detecting the SNP molecular marker A08-12285323, so that the differentiation and identification of the anti-clubroot and clubroot-sensing materials of the cabbages can be realized, individuals containing the anti-clubroot genes in the offspring population of the cabbages can be rapidly screened on the molecular level, the accuracy is high, and the disease-resistant breeding efficiency can be greatly improved.
The invention also provides a reagent for detecting the SNP molecular marker A08-12285323 in the application of the technical scheme. In the present invention, the primer preferably includes a KASP (Kompetitive Allele Specific PCR, competitive allele-specific PCR) primer. In the present invention, the reagent preferably includes a primer set Crr5-funK2, and the primer set Crr5-funK2 includes Crr5-funK2Fa, crr5-funK2Fb and Crr5-funK2R; the nucleotide sequence of Crr-funK 2Fa is shown in SEQ ID NO. 2: 5' -GAAGGTGACCAAGTTCATGCTAAATGCGAAATGTTTCTTCAGT-3'; the nucleotide sequence of Crr-funK 2Fb is shown in SEQ ID NO. 3: 5' -GAAGGTCGGAGTCAACGGATTATGCGAAATGTTTCTTCAGC-3'; the nucleotide sequence of Crr-funK 2R is shown in SEQ ID NO. 4: 5'-CGTCCTTTAGAAAGCTTAGCTCTCTC-3'. In the present invention, the Crr5-funK2Fa and Crr5-funK2Fb are preferably labeled with fluorescent groups of different colors, respectively. In the present invention, the fluorescent group preferably includes FAM and HEX. In the present invention, the Crr5-funK2Fa is attached to FAM and the Crr5-funK2Fb is attached to HEX. The invention discloses a detection primer group Crr-funK 2 of SNP molecular marker A08-12285323 related to Chinese cabbage clubroot resistance character for the first time, the detection primer comprises three primers, DNA of F2 generation separation group generated after DH line of disease-resistant and disease-resistant Chinese cabbage and hybridization of the two is amplified by PCR, and detected by KASP gene analysis system, crr-funK 2 can obviously distinguish clubroot resistance and clubroot resistance materials, and Chinese cabbage is rapidly screened on molecular levelThe offspring population contains individuals with the clubroot resistance gene Crr.
The invention also provides a kit for detecting the SNP molecular marker A08-12285323 in the application of the technical scheme, and the kit comprises the reagent and the reaction solution in the technical scheme. In the present invention, the reaction liquid preferably includes kasfmastermix (2×).
The invention also provides the application of the reagent or the kit in the technical scheme in identifying the clubroot resistance of the Chinese cabbage and/or the breeding of the Chinese cabbage with clubroot resistance.
The invention also provides a method for identifying the clubroot resistance of the celery cabbage, which comprises the following steps:
the reagent or the kit of the technical proposal is used for carrying out competitive allele specific PCR amplification on the genome DNA of the Chinese cabbage, and finally, the KASP amplification product is subjected to end-point method fluorescent signal reading to obtain a genotyping result, when the genotype is TT or TC, the Chinese cabbage is identified as the Chinese cabbage with clubroot resistance, and when the genotype is CC, the Chinese cabbage is identified as the Chinese cabbage with clubroot resistance.
In the present invention, the reaction system for PCR amplification preferably comprises 1.5. Mu.L of genomic DNA, 2X 4. Mu.L of KASP Mastermix, 0.14. Mu.L of primer set Crr-funK 2 and the balance of water in terms of 8. Mu.L. In the present invention, the concentration of each primer in the primer set Crr5-funK2 is preferably 100. Mu. Mol/L. In the present invention, crr-funK 2Fa, crr5-funK2Fb, crr5-funK2R and ddH in the primer set Crr5-funK2 2 The mixing volume ratio of O is preferably 12:12:30:46. the method for extracting the genomic DNA of the Chinese cabbage is not particularly limited, and conventional genomic DNA extraction methods well known to those skilled in the art can be adopted. In the present invention, the reaction procedure of the PCR amplification preferably includes: 94 ℃ for 15min;94℃for 20s and 61℃for 60s, for a total of 10 cycles, each cycle being reduced by 0.6℃from the second cycle; 94 ℃ for 20s and 55 ℃ for 60s, 26 cycles are total; 1min at 37 ℃.
After KASP amplification products are obtained, fluorescent signals are read by an end-point method, and genotyping results are obtained: and when the genotype is TT or TC, identifying the Chinese cabbage as the Chinese cabbage with the clubroot resistance, and when the genotype is CC, identifying the Chinese cabbage as the Chinese cabbage with the clubroot resistance.
In the invention, the fluorescent signal reading by the end-point method is preferably performed by using a Roche fluorescent quantitative PCR Instrument LightCycler480 Instrument II (LC 480 II). SNP typing results were analyzed using LC480 software v 1.5.1.
For further explanation of the present invention, the application of the SNP molecular markers A08-12285323 provided by the present invention in the identification of the clubroot resistance of Chinese cabbage and/or the breeding of the clubroot-resistant Chinese cabbage will be described in detail with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1.1 investigation of test Material and disease resistance Properties
Selecting Chinese cabbage disease-resistant DH series material 1EDHR1 (P) 1 ) And a disease-causing material 1EDHS1 (P) 2 ) Positioning of the cabbage clubroot resistance gene BraA.Pb.8.4 as a parent (Yang Shuangjuan et al; KASP marker development; gardening journal, 2021, 48 (7): 1317-1328. The biological material is available to the public from the applicant and is used only for repeated experiments in connection with the invention and is not used for other purposes. The two materials are subjected to forward and backward intersection to obtain F 1 Seed generation, F 1 Selfing the material to obtain F 2 Seed. P pair P 1 ，P 2 ，F 1 And F 2 Inoculating and identifying in seedling stage, wherein the bacterial source is Henan New wild new bacterium XY-2, the bacterial source is No.4 physiological race according to a Williams system identification system, and is ECD21/31/31 race according to an ECD identification system (Yuxiang, zhao Yanyan, wei Xiaochun, etc. 2017. Henan Chinese cabbage clubroot germ physiological race identification. Henan agricultural science, 46 (7): 71-76). The disease level of each individual was examined after 6 weeks of inoculation and classified into 0, 1, 3, 5 and 7, and specific investigation methods were referred to Zhao Yanyan et al (Zhao Yanyan, jiang Wusheng, yuxiang et al. Chinese cabbage clubroot indoor artificial inoculation method and condition comparison and different variety resistance identification, gardening report, 2014, 41 (S1): 2675).
Disease resistance identification results show that the disease resistance parent 1EDHR1 (P 1 ) 10 strains of disease stageAll of them are class 0, 10 strains 1EDHS1 (P 2 ) The disease incidence of the strain is all 7, 10 strain F 1 The onset grade of the material is 0 grade (Table 1), F 2 159 strains in the population are 0 grade, 156 strains are 1 grade, 9 strains are 3 grade, 15 strains are 5 grade, and 96 strains are 7 grade. Classifying level 0 and level 1 into disease resistance type, classifying level 3, level 5 and level 7 into disease susceptibility type, F 2 The disease-resistant single plant in the population has 315 strains, the disease-resistant single plant is 120 strains, and the separation ratio (Table 1) of the disease-resistant single plant accords with 3:1 through the square test, which shows that 1EDHR1 (P) 1 ) The carried gene for resisting clubroot is controlled by 1 pair of dominant nuclear genes, and the disease resistance is dominant to the disease.
TABLE 1 isolation of the parent and its progeny from disease-resistant and susceptible plants of Chinese cabbage
1.2 genomic DNA extraction
Extracting two parents and F by adopting improved CTAB method 1 And F 2 Genomic DNA of each individual strain. The specific steps are as follows.
Fresh leaves were taken in 2.0mL Eppendorf centrifuge tubes, 1 shot of steel balls (5 MM diameter) was placed into each tube, after which 1000. Mu.L of 2% CTAB extraction buffer was added and the cells were broken on a tissue breaker (model: retsch MM400, germany) at a frequency of 30 times/sec for 1min. After cooling, adding 500 mu L of 24:1 chloroform/isoamyl alcohol extract, shaking up and down for 30 times, standing for delamination, centrifuging (12000 r/min) for 10min, sucking 400 mu L of supernatant into a new 1.5mL centrifuge tube, adding 400 mu L of isopropanol for precipitating DNA, centrifuging (12000 r/min) for 5min after up and down mixing, discarding supernatant, adding 70% ethanol for 750 mu L for cleaning DNA precipitation, centrifuging (12000 r/min) for 2min, discarding supernatant, airing DNA at room temperature, adding 100 mu L of ddH2O for dissolving DNA, and placing in a refrigerator at-20 ℃ for standby.
1.3 discovery of SNP marker linked to clubroot Gene Crr5 and development of detection primer set Crr-funK 2
The candidate gene of the cabbage clubroot resistance gene Crr is determined by a gene positioning method, sequencing and sequence comparison are carried out on the candidate gene, and the SNP variation T/C is found to exist at the 12285323bp position of the A08 chromosome (Brapa_Chiifu_V3.0 reference gene), the base in the disease-resistant material is T, the base in the disease-resistant material is C, and the variation is called SNP markers A08-12285323 as shown in the next section.
ACTCAAACCAAACATAACACACAATGATAATCTAACACACATACTGCAAAATGCGAAATGTTTCTTCAG[T/C]TTCCATCAACATGAGAGAGCTAAGCTTTCTAAAGGACGTAGCCCGCATTCTTTAATCTCCCCGTTTTTT(SEQ ID NO.1)。
The KASP marker Crr5-funK2 was designed for this SNP marker A08-12285323, comprising three primers:
Crr5-funK2Fa：5'-GAAGGTGACCAAGTTCATGCTAAATGCGAAATGTTTCTTCAGT-3'(SEQ ID NO.2)；
Crr5-funK2Fb：5'-GAAGGTCGGAGTCAACGGATTATGCGAAATGTTTCTTCAGC-3'(SEQ ID NO.3)；
Crr5-funK2R：5'-CGTCCTTTAGAAAGCTTAGCTCTCTC-3'(SEQ ID NO.4)。
crr5-funK2Fa and Crr5-funK2Fb are two allele-specific forward primers, crr5-funK2Fa is a specific primer of disease-resistant genotype, crr5-funK2Fb is a specific primer of disease-sensitive genotype, FAM and HEX fluorescent sequence tag sequences (underlined parts) are respectively added to the 5' end, crr5-funK2Fa is connected with FAM, and Crr-funK 2Fb is connected with HEX. Crr5-funK2R is a common reverse primer.
The KASP-PCR reaction was performed on a 96-well PCR apparatus with 8. Mu.L of the reaction system: 1.5. Mu.L of DNA (80 ng/. Mu.L), 4. Mu.LKASP Mastermix (2X), 0.14. Mu.L of primer mix (prepared from Crr5-funK2Fa, crr5-funK2Fb, crr5-funK2R and ddH at a concentration of 100. Mu. Mol/L 2 O is mixed according to the volume ratio of 12:12:30:46, and the rest is ddH 2 And (3) supplementing O.
The KASP-PCR amplification procedure was: denaturation at 94℃for 15min in the first stage; the second stage of denaturation at 94℃for 20s and annealing at 61℃for 60s, for a total of 10 cycles (0.6℃decrease per cycle starting from the second cycle); the third stage is denaturation at 94 ℃ for 20s and annealing at 55 ℃ for 60s, 26 cycles are carried out; the fourth stage is carried out at 37 ℃ for 1min.
KASP-PCR amplified products were read for endpoint fluorescence signal using a Roche fluorescent quantitative PCR Instrument, lightCycler480 Instrument II (LC 480 II). SNP typing results were analyzed using LC480 software v 1.5.1: homozygous disease-resistant materialThe signal point of the material is blue, the 5' end is connected with the primer of FAM fluorescent label sequence for competitive amplification, the primer is polymerized near the X axis, and the genotype is TT; the signal point of the homozygous infectious material is green, the 5' end is connected with the primer competitive amplification of HEX fluorescent tag sequence, and the primer is polymerized near the Y axis, and the genotype is CC; the signal point of the hybrid disease-resistant material is red, and the hybrid disease-resistant material is polymerized near the diagonal line, and the genotype is TC (FIG. 1, the marker Crr-funK 2 is used for F 2 KASP genotyping results plots were performed for the population). Crr5-funK2 marker can significantly distinguish two homozygous genotypes, and can identify heterozygous genotypes, has the characteristic of co-dominant marker, and the marker development is successful.
Using Crr-funK 2 marker pair F 2 Genotyping 86 individual plants of the population, marking the genotype of homozygous disease resistance as a, the genotype of homozygous disease resistance as b and the heterozygosity as h. As a result, 18 individuals with genotype a had a disease level of 0, 21 individuals with genotype h had a disease level of 0, 47 individuals with genotype b had a disease level of 7 (FIG. 1). The genotypic and phenotypic concordance rate of marker Crr5-funK2 in 86F 2 individuals reached 100%. Crr5-funK2 marker can be used for molecular auxiliary breeding of clubroot resistant varieties of Chinese cabbage.
1.4 application of SNP marker detection primer
The extraction of leaf DNA was performed by CTAB method. The materials are 47 DH-series materials such as Y636-9, Y663-8, Y623-1, Y578-2, etc. The KASP marker Crr5-funK2 was used for verification in 47 DH populations, 1EDHR1 was used as a disease-resistant control, and the result shows that 47 pathogenic DH-series materials are all polymerized near the Y axis and are expressed as pathogenic genotypes, and 1EDHR1 is aggregated near the X axis as a disease-resistant material. The genotype and phenotype agreement rate of the marker Crr5-funK2 in 48 DH-series materials reaches 100%. The marker Crr-funK 2 has good universality and accuracy, and can be used for molecular marker assisted selection of the celery cabbage clubroot material.
FIG. 2 is a graph showing the results of KASP genotyping of natural populations using the marker Crr5-funK2.
Conclusion: the invention discloses SNP markers A08-12285323 related to a Chinese cabbage clubroot disease resistance gene Crr5 and discloses a detection primer group Crr5-funK2 for detecting the markers. The SNP marker and the detection primer set Crr5-funK2 thereof can accurately and efficiently detect disease-resistant and disease-sensitive material types. The screening method is not influenced by environmental factors, can greatly reduce the field selection workload, and is helpful for helping to accelerate the disease-resistant breeding of the Chinese cabbages.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.
Claims (10)
1. The sequence of the SNP molecular marker A08-12285323 is shown as SEQ ID NO.1, the 70 th base from the 5' end of the sequence shown as SEQ ID NO.1 is a SNP locus, and the base is T or C.
2. A reagent for detecting SNP molecular marker A08-12285323 in the use as set forth in claim 1.
3. The reagent of claim 2, wherein the reagent comprises primer set Crr5-funK2, the primer set Crr5-funK2 comprising Crr5-funK2Fa, crr5-funK2Fb, and Crr5-funK2R; the nucleotide sequence of Crr-funK 2Fa is shown in SEQ ID NO. 2; the nucleotide sequence of Crr-funK 2Fb is shown in SEQ ID NO. 3; the nucleotide sequence of Crr-funK 2R is shown in SEQ ID NO. 4.
4. A reagent according to claim 3, wherein the Crr5-funK2Fa and Crr5-funK2Fb are labelled with fluorophores of different colours respectively.
5. The reagent of claim 4, wherein the fluorescent groups comprise FAM and HEX.
6. A kit for detecting the SNP molecular marker a08-12285323 in the application of claim 1, wherein the kit comprises the reagent according to any one of claims 2 to 5 and a reaction solution.
7. Use of the reagent according to any one of claims 2 to 5 or the kit according to claim 6 for identifying cabbage clubroot resistance and/or cabbage breeding against clubroot.
8. A method for identifying clubroot resistance of chinese cabbage, comprising the steps of:
performing competitive allele-specific PCR amplification on the genomic DNA of the Chinese cabbage by using the reagent according to any one of claims 2 to 5 or the kit according to claim 6, and finally performing end-point fluorescent signal reading on the KASP amplification product to obtain a genotyping result, and identifying the Chinese cabbage as the anti-clubroot Chinese cabbage when the genotype is TT or TC, and identifying the Chinese cabbage as the clubroot Chinese cabbage when the genotype is CC.
9. The method according to claim 8, wherein the PCR amplification reaction system comprises 1.5. Mu.L of genomic DNA, 4. Mu.L of 2 XSKASPMastermix, 0.14. Mu.L of primer set Crr-funK 2 and the balance of water in 8. Mu.L.
10. The method of claim 8, wherein the reaction procedure for PCR amplification comprises: 94 ℃ for 15min;94℃for 20s and 61℃for 60s, for a total of 10 cycles, each cycle being reduced by 0.6℃from the second cycle; 94 ℃ for 20s and 55 ℃ for 60s, 26 cycles are total; 1min at 37 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310760891.XA CN116622897A (en) | 2023-06-26 | 2023-06-26 | Application of SNP molecular marker in identification of cabbage clubroot resistance and/or cabbage breeding with clubroot resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310760891.XA CN116622897A (en) | 2023-06-26 | 2023-06-26 | Application of SNP molecular marker in identification of cabbage clubroot resistance and/or cabbage breeding with clubroot resistance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116622897A true CN116622897A (en) | 2023-08-22 |
Family
ID=87617202
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310760891.XA Pending CN116622897A (en) | 2023-06-26 | 2023-06-26 | Application of SNP molecular marker in identification of cabbage clubroot resistance and/or cabbage breeding with clubroot resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116622897A (en) |
-
2023
- 2023-06-26 CN CN202310760891.XA patent/CN116622897A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106967803B (en) | High-throughput molecular marker for detecting fertility restorer gene of radish Ogura-CMS (fertility restorer gene) and application of high-throughput molecular marker | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN111748643B (en) | SNP molecular marker of gene CRs related to Chinese cabbage clubroot disease resistance and application thereof | |
| CN112143823B (en) | KASP marker of Chinese cabbage clubroot resistance gene Crr5 and application thereof | |
| CN109593876A (en) | The KASP label serotype specific primer group and its application of high throughput detection AhFAD2B gene mutation site | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN110373491B (en) | KASP molecular marker for detecting rice blast-resistant broad-spectrum gene Pi1 and application | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| CN116287387A (en) | SNP locus and KASP molecular marker closely linked with PMMoV resistance gene L3 of capsicum and application | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN109811077A (en) | With the KASP label of wheat dwarf stem gene close linkage and its application | |
| CN107287210B (en) | Rice appearance quality gene qAQ7 and molecular marking method and application thereof | |
| CN111560460B (en) | SNP (Single nucleotide polymorphism) markers related to soybean gray spot disease resistant No. 7 physiological race traits and application thereof | |
| CN116622897A (en) | Application of SNP molecular marker in identification of cabbage clubroot resistance and/or cabbage breeding with clubroot resistance | |
| CN116676414A (en) | Application of SNP molecular marker A08-12266524 in identification of cabbage clubroot resistance | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN112410459A (en) | KASP molecular marker for detecting rice blast resistance gene Pi25 and application thereof | |
| CN116622896A (en) | Application of SNP molecular marker A08-12271831 in identification of cabbage clubroot resistance | |
| CN111808853B (en) | Biological material for detecting Chinese cabbage clubroot disease resistance gene CRs and application thereof | |
| CN115369123B (en) | KASP (KASP) mark of dominant orange gene BrOr of Chinese cabbage and application thereof | |
| CN114686614B (en) | KASP molecular marker for detecting pea leaf configuration and application thereof | |
| CN111424109B (en) | SNP molecular marker for identifying powdery mildew resistance traits of melons and application thereof | |
| CN115772579B (en) | Eggplant bacterial wilt resistance trait closely linked SNP molecular marker and application thereof | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof | |
| CN115896320B (en) | SNP molecular marker closely linked with spinach downy mildew resistance gene RPF2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |