CN116622878A - KASP molecular marker for pulp hardness property of watermelon and application thereof - Google Patents
KASP molecular marker for pulp hardness property of watermelon and application thereof Download PDFInfo
- Publication number
- CN116622878A CN116622878A CN202310361042.7A CN202310361042A CN116622878A CN 116622878 A CN116622878 A CN 116622878A CN 202310361042 A CN202310361042 A CN 202310361042A CN 116622878 A CN116622878 A CN 116622878A
- Authority
- CN
- China
- Prior art keywords
- watermelon
- molecular marker
- genotype
- pulp
- hardness
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000219109 Citrullus Species 0.000 title claims abstract description 84
- 235000012828 Citrullus lanatus var citroides Nutrition 0.000 title claims abstract description 84
- 239000003147 molecular marker Substances 0.000 title claims abstract description 63
- 239000000463 material Substances 0.000 claims abstract description 53
- 238000000034 method Methods 0.000 claims abstract description 22
- 210000000349 chromosome Anatomy 0.000 claims abstract description 6
- 238000009394 selective breeding Methods 0.000 claims abstract description 6
- 239000003550 marker Substances 0.000 claims abstract description 5
- 235000013372 meat Nutrition 0.000 claims description 17
- 238000000137 annealing Methods 0.000 claims description 7
- 238000006243 chemical reaction Methods 0.000 claims description 7
- 238000003205 genotyping method Methods 0.000 claims description 5
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 238000003556 assay Methods 0.000 claims description 3
- 238000012217 deletion Methods 0.000 claims description 3
- 230000037430 deletion Effects 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 3
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 238000009395 breeding Methods 0.000 abstract description 10
- 230000001488 breeding effect Effects 0.000 abstract description 10
- 238000012216 screening Methods 0.000 abstract description 8
- 238000011161 development Methods 0.000 abstract description 4
- 238000010187 selection method Methods 0.000 abstract description 2
- 235000013311 vegetables Nutrition 0.000 abstract description 2
- 108090000623 proteins and genes Proteins 0.000 description 10
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 9
- 238000004925 denaturation Methods 0.000 description 5
- 230000036425 denaturation Effects 0.000 description 5
- 238000004458 analytical method Methods 0.000 description 4
- 230000003321 amplification Effects 0.000 description 3
- 210000002421 cell wall Anatomy 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 235000013399 edible fruits Nutrition 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 238000009396 hybridization Methods 0.000 description 3
- 230000006872 improvement Effects 0.000 description 3
- 239000013642 negative control Substances 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 108700028369 Alleles Proteins 0.000 description 2
- 238000013507 mapping Methods 0.000 description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 244000144730 Amygdalus persica Species 0.000 description 1
- 244000241235 Citrullus lanatus Species 0.000 description 1
- 235000009831 Citrullus lanatus Nutrition 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 241000220223 Fragaria Species 0.000 description 1
- 229920002488 Hemicellulose Polymers 0.000 description 1
- 235000007688 Lycopersicon esculentum Nutrition 0.000 description 1
- 235000006040 Prunus persica var persica Nutrition 0.000 description 1
- 240000003768 Solanum lycopersicum Species 0.000 description 1
- 239000001913 cellulose Substances 0.000 description 1
- 229920002678 cellulose Polymers 0.000 description 1
- 239000003086 colorant Substances 0.000 description 1
- 230000002860 competitive effect Effects 0.000 description 1
- 230000001276 controlling effect Effects 0.000 description 1
- 238000010219 correlation analysis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 235000011389 fruit/vegetable juice Nutrition 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000037353 metabolic pathway Effects 0.000 description 1
- 238000006241 metabolic reaction Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000036961 partial effect Effects 0.000 description 1
- 239000001814 pectin Substances 0.000 description 1
- 229920001277 pectin Polymers 0.000 description 1
- 235000010987 pectin Nutrition 0.000 description 1
- 239000003375 plant hormone Substances 0.000 description 1
- 230000002786 root growth Effects 0.000 description 1
- 238000005204 segregation Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 235000021012 strawberries Nutrition 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular marker development and molecular marker assisted breeding of vegetable quality traits, is suitable for rapid screening of pulp hardness of watermelons and molecular marker assisted breeding, and particularly relates to a novel and simple molecular marker and an assisted selection method. The invention discloses a KASP molecular marker ClFH based on tight linkage of watermelon pulp hardness, wherein the KASP molecular marker is an InDel InDel marker, and is positioned at 13154621bp of a chromosome 6 of watermelon. The invention also discloses a KASP molecular marker ClFH primer combination for identifying the hardness property of the watermelon pulp. The invention also discloses the application of the molecular marker: the method is used for molecular auxiliary selective breeding of watermelon materials or offspring thereof with different pulp hardness.
Description
Technical Field
The invention belongs to the technical field of molecular marker development and molecular marker assisted breeding of vegetable quality traits, is suitable for rapid screening of pulp hardness of watermelons and molecular marker assisted breeding, and particularly relates to a novel and simple molecular marker and an assisted selection method.
Background
Watermelon (Citrullus lanatus) is an important horticultural crop. Pulp hardness of watermelons is an important factor affecting quality and shelf life of watermelon fruits, and also affects consumer selection. The hardness of pulp can seriously affect the mouthfeel, and too soft fruit can lead to soft mouthfeel, reduced freshness and easy hollowness, and poor storage (Risse et al, 1990); too hard fruit results in less juice and poor mouthfeel (Harker et al, 2003). Therefore, the improvement of the quality of the watermelon is increasingly paid attention to by researching the gene for regulating the hardness of the pulp.
The changes in pulp firmness are affected by a number of factors, a complex process involving multiple genes involved in the co-regulation of multiple metabolic pathways, involving a range of physiological and biochemical changes, including changes in cell wall material content and changes in related plant hormones and metabolic reactions (Brummell and Harpster,2001, gao et al 2020). Cell wall components including pectin, cellulose, hemicellulose, and the like play a key role in the variation of pulp hardness of watermelons. Much research into cell wall components and related enzyme genes has focused on crops such as tomatoes (Jiang et al, 2019), peaches (Brummell et al, 2004), and strawberries (Villarreal, 2008,Figueroa et al, 2010). At present, most research on the hardness property of watermelon pulp is focused on QTL positioning and transcriptome research, but is basically limited on preliminary positioning of related genes and transcription analysis of differential expression genes, so that a certain genetic distance exists between an obtained molecular marker and a target gene, and the molecular marker is not closely linked, thereby the molecular marker which is closely linked with the hardness property of watermelon pulp and has strong operability is lacked in application to assist the breeding of watermelon quality. Therefore, in the aspects of pulp hardness and variety breeding assisted by the watermelon molecular marker, a target gene for regulating and controlling pulp hardness of the watermelon still needs to be further determined, and a stable high-flux molecular marker is developed.
The references referred to above are as follows:
BRUMMELL D A,DAL CIN V,CRISOSTO C H,et al.2004.Cell wall metabolism during maturation,ripening and senescence of peach fruit.Journal of Experimental Botany[J],55:2029-2039；
BRUMMELL D A,HARPSTER M H 2001.Cell wall metabolism in fruit softening and quality and its manipulation in transgenic plants.Plant Molecular Biology[J],47:311-340；
FIGUEROA C R,ROSLI H G,CIVELLO P M,et al.2010.Changes in cell wall polysaccharides and cell wall degrading enzymes during ripening of Fragaria chiloensis and Fragaria xananassa fruits.Scientia Horticulturae[J],124:454-462；
Gao Y,Guo Y,Su Z,et al.2020.Transcriptome analysis of genes related to fruit texture in watermelon.Scientia Horticulturae[J],262:109075；
HARKER F R,GUNSON F A,JAEGER S R 2003.The case for fruit quality:an interpretive review of consumer attitudes,and preferences for apples.Postharvest Biology and Technology[J],28:333-347；
JIANG F L,LOPEZ A,JEON S,et al.2019.Disassembly of the fruit cell wall by the ripening-associated polygalacturonase and expansin influences tomato cracking.Horticulture Research[J],6:17；
RISSE L A,BRECHT J K,SARGENT S A,et al.1990.STORAGE CHARACTERISTICS OF SMALL WATERMELON CULTIVARS.Journal of the American Society for Horticultural Science[J],115:440-443；
VILLARREAL N M,ROSLI H G,MARTINEZ G A,et al.2008.Polygalacturonase activity and expression of related genes during ripening of strawberry cultivars with contrasting fruit firmness.Postharvest Biology and Technology[J],47:141-150；
disclosure of Invention
The invention aims to provide a KASP molecular marker for the hardness property of watermelon pulp and application thereof.
In order to solve the technical problems, the invention provides a KASP molecular marker for identifying different watermelon pulp hardness by positioning the watermelon pulp hardness trait genes based on BSA mixed pool sequencing;
the KASP molecular marker ClFH is an InDel InDel marker and is positioned at 13154621bp of the No. 6 chromosome of the watermelon; the sequences of 100bp before and after the molecular marker locus are as follows:
TCGAAACAAAACTTTTAAGTACGAATATATATATACATTAATTCCTTGCTTTAATAAAC TTATAAATTTCAGATAATGGAAACTATAGATCGAAAAGAAA[AAAAAAAAAAG/-]AAAAA AAAAAGAAAAAAAAAAAGTATTGAAGATCTTTATTTGTAAGAGACAAAGGAAAGATAG ACTAAATGATGGGATGGGAAAGAGGG；
wherein the inclusion is a fragment of InDel and the mutant appears as a deletion of InDel.
In addition, the invention also provides a KASP molecular marker ClFH primer combination for identifying the hardness property of the watermelon pulp, wherein the nucleotide sequence is 5'-3'
Forward primer F1:
GAAGGTGACCAAGTTCATGCTCAATACTTTTTTTTTTTCTTTTTTTTTTC
forward primer F2:
GAAGGTCGGAGTCAACGGATTCAATACTTTTTTTTTTTCTTTTTTTTTTT
reverse primer R:
TCAGATAATGGAAACTATAGATCGA
the invention also provides the application of the molecular marker, and the molecular marker is used for molecular auxiliary selective breeding of watermelon materials or offspring thereof with different pulp hardness.
Improvement of the use as a molecular marker of the present invention: judging which genotypes of different watermelon materials and filial generation belong to the following: homozygous HH genotype, heterozygous HH genotype.
The invention also provides a method for identifying the hardness of the watermelon pulp by using the molecular marker, which comprises the following steps:
(1) Setting mutant watermelon material ZJU152 (pulp hardness is high) as HH (Hard) genotype;
(2) Extracting genome DNA of a watermelon sample to be detected; PCR amplification is carried out on the watermelon genome DNA on an ABI Stepone PCR instrument by utilizing the ClFH molecular marker primer group; detecting fluorescent signals by using an ABI Stepone PCR instrument, and analyzing genotyping; according to the difference of fluorescent signals of the PCR products, the genotype of each watermelon to be detected is further identified, and a homozygous HH genotype, a homozygous HH genotype and a heterozygous HH genotype are identified;
(3) When the parting result of the sample is homozygous HH genotype, identifying the sample of the watermelon to be detected as hard meat character;
and when the parting result of the sample is homozygous hh genotype, identifying the sample of the watermelon to be detected as soft meat character.
The invention also provides a development method of the molecular marker, which comprises the following steps:
(1) Hybridization is carried out by taking hard pulp watermelon material ZJU152 and soft pulp watermelon material ZJU163 as parents, and then selfing is carried out, thus obtaining F separated from soft pulp and hard pulp 6 Recombining the inbred population;
(2) Extraction of parent seedlings and filial generation F of watermelon by CTAB (cetyl trimethyl ammonium bromide, hexadecyl trimethyl ammonium bromide) method 6 Group seedling genomic DNA;
(3) Select F 6 The extremely pulp hardness materials in the population construct a soft-meat and hard-meat mixing pool, and BSA (segregation population analysis, bulked Segregant analysis) is used for positioning the region or gene related to the pulp hardness property.
(4) And identifying SNP variation and InDel InDel variation closely linked with the pulp hardness property of the watermelon.
(5) Screening the watermelon flesh hardness property molecular marker by adopting a KASP (competitive allele specific polymerase chain reaction, kompetitive Allele Specific Polymerase Chain Reaction) method based on the linkage variation;
(6) Develop a KASP molecular marker ClFH closely linked with the hardness property of the pulp of the watermelon.
The method for identifying the pulp hardness materials of different watermelons by using the molecular marker comprises the following steps:
(1) Polymorphism analysis of molecular markers in hard meat material ZJU152 and soft meat material ZJU163 and progeny populations thereof:
the KASP molecular marker is designed and developed for detecting genotype polymorphism of the parent material of the meat and the offspring thereof. The KASP molecular marker primer is composed of forward primers F1 and F2 and a reverse primer R. Primers (molecular markers) were synthesized by Shanghai Biotechnology Co., ltd and amplified on an ABI Step One PCR instrument.
The PCR reaction system is as follows: 20-50 ng/. Mu.l of watermelon genomic DNA, 5.0. Mu.l of KASP Master Mix, 0.14. Mu.l of KASP Assay Mix (F1: F2: R=2: 2:5 by volume ratio, 10 ng/. Mu.l of each of the three primer concentrations) and 10.14. Mu.l of the total volume;
the PCR reaction procedure was: 30 ℃,1 minute (reading fluorescent signal); 94 ℃,15 minutes (pre-denaturation); 94 ℃,20 seconds (denaturation); annealing at 61 ℃ (-0.6 ℃/cycle) for 60 seconds, 10 cycles; 94 ℃,20 seconds (denaturation); annealing at 55℃for 60s, 31 cycles. 30℃for 1 minute (reading fluorescent signal).
After the amplification is completed, fluorescent signals are detected and genotyping is analyzed. If the typing is insufficient, the amplification can be continued. 94 ℃,20 seconds (denaturation); annealing at 55℃for 60s, 3 cycles. 30℃for 1 minute (reading fluorescent signal). The fluorescence signal was read every 3 cycles of increase to check for typing until complete typing.
The genotyping result is shown in figure 1, the molecular marker can be obviously typed in materials with different pulp hardness, and the genotype can be judged according to different fluorescence signals. Wherein red is homozygous genotype HH of hard meat material ZJU152, blue is homozygous genotype HH of soft meat material ZJU163, and green is hybrid F 1 Heterozygous genotype Hh.
Description: in the present invention, ZJU152, ZJU163 and offspring as well as the watermelon varieties described in Table 1 can be sufficiently typed according to the above PCR reaction procedure.
The molecular marker is used for carrying out the auxiliary selective breeding of the hardness property molecules of the watermelon pulp:
the KASP molecular marker closely linked with the pulp hardness character is designed and developed, and the preliminary screening of pulp hardness varieties of watermelons can be carried out, so that the aim of molecular marker assisted breeding is fulfilled. In addition, the soft meat material ZJU163 and the hard meat material ZJU152 are hybridized, then backcross and selfing are combined with molecular marker auxiliary selection, and single plants with proper pulp hardness in the isolated population are selected for breeding improvement, so that the taste and shelf life of the pulp of the watermelon can be directionally selected and improved, and the molecular breeding process of the target property of the pulp of the watermelon is accelerated.
In summary, the invention develops a KASP molecular marker ClFH (Flesh Hardness) based on the hardness property of the watermelon pulp, namely, the invention provides a molecular marker closely linked with the hardness property of the watermelon pulp, and the molecular marker can be used for screening different pulp hardness materials and auxiliary selective breeding of the pulp hardness materials.
Drawings
The following describes the embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 is a diagram of parent materials ZJU152 and ZJU163 and F thereof 1 A typing map of ClFH molecular markers;
wherein the genotype of ZJU163 is hh, which appears blue; the genotype of ZJU152 is HH, which appears red; f (F) 1 The genotype of (2) is Hh, which is represented as green; black crosses represent negative controls without fluorescent signal.
FIG. 2 is a cross-section F of watermelon material with different pulp hardness 6 A typing map of ClFH molecular markers for the generation population;
wherein blue represents hh genotype consistent with soft-meat material ZJU 163; red represents HH genotype consistent with hard meat material ZJU 152; green representation and F 1 A consistent Hh genotype; black crosses represent negative controls without fluorescent signal;
the ClFH molecular marker shows obvious separation in the filial generation material, which shows the reliability of the marker, and can be used for screening the filial generation materials with different hardness.
FIG. 3 is a parting chart of ClFH molecular markers of watermelon natural population materials with different pulp hardness;
wherein blue represents hh genotype consistent with soft-meat material ZJU 163; red represents HH genotype consistent with hard meat material ZJU 152; black crosses represent negative controls without fluorescent signal.
FIG. 4 is a pulp hardness ranking of natural populations of watermelons of different genotypes (only information of partial varieties is shown).
FIG. 5 is a pulp hardness distribution of natural populations of watermelons of different genotypes;
the result shows that the pulp hardness of the homozygous HH genotype watermelons is significantly lower than that of the HH genotype watermelons.
Detailed Description
The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:
example 1, major QTL positioning for pulp hardness Property of watermelon
Parent material is selected from a laboratory germplasm resource library. ZJU152 is wild type watermelon material, and pulp hardness is high; ZJU163 is a cultivation type watermelon material, and has small pulp hardness. Constructing a recombinant inbred line group F by utilizing the inbred after the parent hybridization 6 . The hardness of the center pulp was measured using a ta.xt-21 texturometer (Stable Micro Systems ltd., godalming, surrey, UK).
Extraction of parent seedlings and filial generation F of watermelon by CTAB (cetyl trimethyl ammonium bromide, hexadecyl trimethyl ammonium bromide) method 6 Group seedling genomic DNA; and selecting offspring extreme phenotype materials to construct a BSA mixed pool, carrying out genome re-sequencing, carrying out correlation analysis by a delta SNP-index method, selecting a 99% confidence interval, and positioning to an interval positioned on chromosome 6 12236196-15073822.
EXAMPLE 2 development and validation of the KaSP molecular marker for the pulp hardness trait of watermelon
According to the gene mapping results of example 1, SNP and InDel of the parent material in chromosome 6 interval were extracted and analyzed, and related molecular markers were developed for fine mapping using KASP technique.
The method comprises the following steps:
1. DNA extraction
Extraction of parent seedlings and filial generation F of watermelon by CTAB (cetyl trimethyl ammonium bromide, hexadecyl trimethyl ammonium bromide) method 6 Group seedling genomic DNA.
2. PCR amplification
The PCR reaction system is as follows: 20-50 ng/. Mu.l of watermelon genomic DNA, 5.0. Mu.l of KASP Master Mix, 0.14. Mu.l of KASP Assay Mix (F1: F2: R=2: 2:5 by volume ratio, 10 ng/. Mu.l of each of the three primer concentrations) and 10.14. Mu.l of the total volume;
the PCR reaction procedure was: 30 ℃,1 minute (reading fluorescent signal); 94 ℃,15 minutes (pre-denaturation); 94 ℃,20 seconds (denaturation); annealing at 61 ℃ (-0.6 ℃/cycle) for 60 seconds, 10 cycles; 94 ℃,20 seconds (denaturation); annealing at 55℃for 60s, 31 cycles. 30℃for 1 minute (reading fluorescent signal).
The PCR amplification is directly carried out on an ABI Step One PCR instrument, the genotyping condition can be directly obtained after the instrument detects fluorescent signals, and the obtained result is shown in figure 1. The software divides the test samples into homozygous HH genotypes, homozygous HH genotypes and heterozygous HH genotypes according to the different genotypes.
The forward primers F1 and F2 are preceded by respective fluorescent linkers (shown in different colors on the typing map, e.g., red for HH genotype, blue for HH genotype, green for HH genotype). If the material being detected is homozygous, only one of the corresponding primers will be selected for amplification (e.g., homozygous hh genotype will react only with F1). Finally, according to the fluorescence difference, distinguishing whether the detected material is homozygous HH genotype or HH genotype. If the detected material is heterozygous, both primers will amplify, and the fluorescent signal generated will be different from that of homozygous genotype, thus achieving the differentiation of heterozygous genotypes.
And finally obtaining KASP molecular marker ClFH closely linked with the hardness property of the watermelon pulp through molecular marker screening. The molecular marker is InDel InDel, and the combined sequence of the molecular marker primer is as follows:
forward primer F1:
GAAGGTGACCAAGTTCATGCTCAATACTTTTTTTTTTTCTTTTTTTTTTC
forward primer F2:
GAAGGTCGGAGTCAACGGATTCAATACTTTTTTTTTTTCTTTTTTTTTTT
reverse primer R:
TCAGATAATGGAAACTATAGATCGA
wherein, the InDel marker is positioned at 13154621bp of the watermelon chromosome 6, and the sequence of 100bp before and after the molecular marker locus is:
TCGAAACAAAACTTTTAAGTACGAATATATATATACATTAATTCCTTGCTTTAATAAAC TTATAAATTTCAGATAATGGAAACTATAGATCGAAAAGAAA[AAAAAAAAAAG/-]AAAAA AAAAAGAAAAAAAAAAAGTATTGAAGATCTTTATTTGTAAGAGACAAAGGAAAGATAG ACTAAATGATGGGATGGGAAAGAGGG。
wherein the inclusion is a fragment of InDel and the mutant appears as a deletion of InDel.
According to FIG. 1, the soft meat material ZJU163 is homozygous hh genotype, which is shown in blue in the figure; the hard meat material ZJU152 is homozygous HH genotype, represented as red in the figure; ZJU152 and ZJU163 hybridization F 1 The generation is represented by heterozygous Hh genotype, which is shown green in the figure.
According to FIG. 2, the ClFH is utilized at F 6 Typing is carried out in the generation group, and the genotype of the material which is the same as ZJU163 and corresponds to blue is hh; genotype of material corresponding to red with ZJU152 is HH; and F is equal to 1 The genotype of the corresponding material which is green is Hh.
Experiment 1 pulp hardness was measured for different varieties of watermelon germplasm by the pulp hardness method of example 1, and the results obtained by measuring the pulp hardness according to the method and the developed molecular markers described in example 2 are shown in table 1.
TABLE 1 evaluation results of pulp hardness and ClFH molecular markers of 126 parts of watermelon germplasm materials
Description: the above-mentioned watermelon germplasm materials are reported in A.Mahmoud et al An allelic variant in the ACS, gene promotes primary root growth in Waterelon. Theoretical and Applied Genetics, 3357-3373 (2022).
According to theory, it is speculated that the watermelon with genotype HH should be soft meat material, while the watermelon with genotype HH should be hard meat material. The theoretical results are consistent with the measured hardness results. The ClFH molecular marker can detect different genotypes of different hardness materials in natural population, and further shows that the molecular marker can be used for molecular auxiliary selective breeding of different watermelon hardness materials. In table 1, there is less watermelon material identified as HH due to the type of laboratory germplasm resource material.
In conclusion, the molecular marker can be used for carrying out initial screening of the pulp hardness variety of the watermelon so as to achieve the aim of molecular marker assisted breeding. The molecular marker mark can screen varieties of extremely hard materials.
Finally, it should also be noted that the above list is merely a few specific embodiments of the present invention. Obviously, the invention is not limited to the above embodiments, but many variations are possible. All modifications directly derived or suggested to one skilled in the art from the present disclosure should be considered as being within the scope of the present invention.
Claims (7)
1. The KASP molecular marker ClFH based on the tight linkage of the pulp hardness character of the watermelon is characterized in that: the KASP molecular marker is an InDel InDel marker and is positioned at 13154621bp of a watermelon chromosome 6.
2. The KASP molecular marker ClFH tightly linked based on the pulp hardness trait of watermelon according to claim 1, characterized in that:
the sequences of 100bp before and after the molecular marker locus are as follows:
TCGAAACAAAACTTTTAAGTACGAATATATATATACATTAATTCCTTGCTTTAATAAACTTATAAATTTCAGATAATGGAAACTATAGATCGAAAAGAAAAAAAAAAAAAG/-AAAAAAAAAAGAAAAAAAAAAAGTATTGAAGATCTTTATTTGTAAGAGACAAAGGAAAGATAGACTAAATGATGGGATGGGAAAGAGGG；
wherein the underline corresponds to a fragment of InDel and the mutant appears as a deletion of InDel.
3. A KASP molecular marker ClFH primer combination for identifying watermelon flesh hardness character which characterized in that: the nucleotide sequence is 5'-3';
forward primer F1:
GAAGGTGACCAAGTTCATGCTCAATACTTTTTTTTTTTCTTTTTTTTTTC
forward primer F2:
GAAGGTCGGAGTCAACGGATTCAATACTTTTTTTTTTTCTTTTTTTTTTT
reverse primer R:
TCAGATAATGGAAACTATAGATCGA。
4. use of a molecular marker according to claim 1 or 2: the method is used for molecular auxiliary selective breeding of watermelon materials or offspring thereof with different pulp hardness.
5. Use of a molecular marker according to claim 4: judging which genotypes of different watermelon materials and filial generation belong to the following: homozygous HH genotype, heterozygous HH genotype.
6. A method for identifying pulp hardness of watermelons using the molecular markers according to claim 1 or 2, characterized by comprising the steps of:
(1) Setting mutant watermelon material ZJU152 as HH genotype;
(2) Extracting genome DNA of a watermelon sample to be detected; PCR amplification of watermelon genomic DNA on an ABI Stepone PCR instrument using the ClFH molecular marker primer set of claim 3; detecting fluorescent signals by using an ABI Stepone PCR instrument, and analyzing genotyping; according to the difference of fluorescent signals of the PCR products, the genotype of each watermelon to be detected is further identified, and a homozygous HH genotype, a homozygous HH genotype and a heterozygous HH genotype are identified;
(3) When the parting result of the sample is homozygous HH genotype, identifying the sample of the watermelon to be detected as hard meat character;
and when the parting result of the sample is homozygous hh genotype, identifying the sample of the watermelon to be detected as soft meat character.
7. The method according to claim 6, wherein:
the PCR reaction system is as follows: 20-50 ng/. Mu.l of watermelon genomic DNA, 5.0. Mu.l of KASP Master Mix, 0.14. Mu.l of KASP Assay Mix (F1: F2: R=2: 2:5 by volume ratio, 10 ng/. Mu.l of each of the three primer concentrations) and 10.14. Mu.l of the total volume;
the PCR reaction procedure was: 30 ℃ for 1 minute; 94 ℃ for 15 minutes; 94 ℃ for 20 seconds; annealing at 61 ℃ (-0.6 ℃/cycle) for 60 seconds, 10 cycles; 94 ℃ for 20 seconds; annealing at 55 deg.c for 60s and 31 cycles; 30℃for 1 minute.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310361042.7A CN116622878A (en) | 2023-04-06 | 2023-04-06 | KASP molecular marker for pulp hardness property of watermelon and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310361042.7A CN116622878A (en) | 2023-04-06 | 2023-04-06 | KASP molecular marker for pulp hardness property of watermelon and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116622878A true CN116622878A (en) | 2023-08-22 |
Family
ID=87596222
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310361042.7A Pending CN116622878A (en) | 2023-04-06 | 2023-04-06 | KASP molecular marker for pulp hardness property of watermelon and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116622878A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385084A (en) * | 2023-11-23 | 2024-01-12 | 西北农林科技大学 | Molecular marker closely linked with hardness of apple fruits, primer and application thereof |
-
2023
- 2023-04-06 CN CN202310361042.7A patent/CN116622878A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385084A (en) * | 2023-11-23 | 2024-01-12 | 西北农林科技大学 | Molecular marker closely linked with hardness of apple fruits, primer and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dwiningsih et al. | Development of single nucleotide polymorphism (SNP) markers in tropical crops | |
| US10806108B2 (en) | Soybean markers linked to SCN resistance | |
| Pandurangan et al. | Introduction to marker-assisted selection in wheat breeding | |
| CN118186144B (en) | KASP molecular marker for watermelon leaf shape cracking degree character and application thereof | |
| CN109988862A (en) | PCR label relevant to wild cabbage Dominant male sterile gene and its application | |
| CN117887895B (en) | KASP molecular marker for pumpkin fruit length character and application thereof | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN116622878A (en) | KASP molecular marker for pulp hardness property of watermelon and application thereof | |
| US7396921B2 (en) | Compositions and kits for detecting a sequence mutation in cinnamyl alcohol dehydrogenase gene associated with altered lignification in loblolly pine | |
| CN114107548A (en) | KASP molecular marker for detecting color of waxberry fruits and application thereof | |
| Luo et al. | Inheritance of RAPD markers in an interspecific F1 hybrid of grape between Vitis quinquangularis and V. vinifera | |
| CN112011640B (en) | KASP molecular marker, primer and application for identifying pH of watermelon fruit | |
| CN112251535A (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN114480721B (en) | Method for identifying whether melon variety to be detected is thin-skin melon or thick-skin melon and special SNP primer combination thereof | |
| CN111996280B (en) | SNP marker co-separated from brassica napus dwarf compact trait and application thereof | |
| CN117683938B (en) | KASP molecular marker closely linked with tomato fruit width and application thereof | |
| CN117887885B (en) | Soybean oil content-related major single nucleotide polymorphism site and application thereof | |
| CN113278726B (en) | Molecular marker Oil-4-3776551 for assisting in identifying high and low soybean Oil content, kit and method | |
| Hyten | Genotyping Platforms for Genome-Wide Association Studies: Options and Practical Considerations | |
| CN117512200A (en) | Molecular marker closely linked with peanut sucrose content and application thereof | |
| CN118127208A (en) | Wheat stripe rust gene Yr30 linked KASP molecular marker and application thereof | |
| CN118028515A (en) | InDel molecular marker closely linked with capsicum fruit width gene, primer, kit and application | |
| CN118531156A (en) | SNP molecular marker combination and application thereof in pumpkin germplasm identification and/or breeding | |
| CN115820909A (en) | Method for screening wheat with different thousand grain weights and primer group used by method | |
| CN118600088A (en) | Molecular marker related to sucrose content of soybean leaves and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |