CN116622758A - Method for improving genetic transformation and gene editing efficiency of plants - Google Patents

Abstract

The application belongs to the field of plant genetic engineering. In particular, the present application relates to a method for improving genetic transformation and gene editing efficiency of plants. More particularly, the present application relates to improving the regeneration efficiency of genetic transformation of plants and/or improving the efficiency of editing plant genes by expressing histone demethylase genes.

Description

Method for improving genetic transformation and gene editing efficiency of plants

Technical Field

The application belongs to the field of plant genetic engineering. In particular, the present application relates to a method for improving genetic transformation and gene editing efficiency of plants. More particularly, the present application relates to improving the regeneration efficiency of genetic transformation of plants and/or improving the efficiency of gene editing in plants by expressing histone demethylase genes.

Background

Crop genetic breeding is subject to artificial selection breeding, hybridization breeding, mutation breeding and molecular marker assisted breeding by using molecular technology as a means. With the gradual decrease of genetic diversity of the used species, the bottleneck effect of traditional breeding is more and more obvious: it is difficult to develop breakthrough new varieties by using conventional breeding technology, and the requirements of human beings and the development of sustainable agriculture cannot be met. The rapid development of life sciences has led to the entry from the "reading" phase of biological genetic information into the post-genomic era, where accurate "writing" of genomes, to even "brand new designs" is becoming increasingly true. The biological technical means aiming at designing and creating new characters or life bodies has great prospect in the fields of disease treatment, medicine, manufacturing, agriculture and the like.

Genome editing technology is a revolutionary technical means in the current life science, and can realize accurate, efficient and specific rewriting of genome, thereby having revolutionary promotion effect on research and exploration of the whole life science. Gene editing refers to deleting, replacing, inserting and the like of a target gene so as to rewrite genetic information, thereby obtaining new functions or phenotypes and even creating new species. The development of a breeding technology which is suitable for crops and takes a gene editing technology as a means can break the defects of traditional breeding and realize molecular design breeding which is accurately modified from genome. Has important strategic significance for the development of future agriculture.

Current gene editing techniques mainly include ZFNs, TALENs, and CRISPR/Cas systems. The CRISPR/Cas system is currently the simplest and widely used gene editing technology system due to its efficiency and flexibility. In the CRISPR/Cas system, the Cas protein can target any position in the genome under the guidance of an artificially designed guide RNA (guide RNA). The base editing system is a novel gene editing technology developed based on a CRISPR system and is divided into a cytosine base editing system and an adenine base editing system, cytosine deaminase and adenine deaminase are respectively fused with Cas9 single-stranded nickase, and under the targeting action of guide RNA, the Cas9 single-stranded nickase generates a single-stranded DNA region, so that the deaminase can efficiently deaminate C and A nucleotides on single-stranded DNA at a target position respectively to be changed into U bases and I bases, and further, the C and the A nucleotides are repaired into T bases and G bases in the process of repairing cells. The base editing technology overcomes the defect of traditional DSB mediated gene editing, and can efficiently realize accurate replacement of single base. The CRISPR/Cas system mediated powerful genome modification technology system can provide powerful technical support for plant genomics research and novel plant molecular design breeding, and can accelerate the cultivation of new crop varieties and realize sustainable development of agriculture.

One key step in plant gene editing is the delivery of a gene editing nuclease protein or encoding nucleic acid to plant cells to effect editing of a gene of interest. Current delivery techniques for plant genome editing are mainly achieved by genetic transformation and tissue culture techniques, mainly including agrobacterium-mediated methods and gene gun methods. Significant progress has been made in plant transformation and genetic modification over the past few years, but the transformation of major crops such as wheat has been limited by factors such as genotype, period of transformed material, and the like.

Brief Description of Drawings

Figure 1 shows a map of the vector applied in an embodiment of the application.

Fig. 2 shows that histone demethylase JMJ706 can significantly improve the efficiency of wheat callus regeneration.

Detailed Description

1. Definition of the definition

In the present application, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology-related terms and laboratory procedures as used herein are terms and conventional procedures that are widely used in the corresponding arts. For example, standard recombinant DNA and molecular cloning techniques for use in the present application are well known to those skilled in the art and are more fully described in the following documents: sambrook, j., fritsch, e.f., and Maniatis, t., molecular Cloning: a Laboratory Manual; cold Spring Harbor Laboratory Press: cold Spring Harbor,1989 (hereinafter "Sambrook"). Meanwhile, in order to better understand the present application, definitions and explanations of related terms are provided below.

As used herein, the term "and/or" encompasses all combinations of items connected by the term, and should be viewed as having been individually listed herein. For example, "a and/or B" encompasses "a", "a and B", and "B". For example, "A, B and/or C" encompasses "a", "B", "C", "a and B", "a and C", "B and C" and "a and B and C".

The term "comprising" is used herein to describe a sequence of a protein or nucleic acid, which may consist of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described herein. Furthermore, it will be clear to those skilled in the art that the methionine encoded by the start codon at the N-terminus of a polypeptide may be retained in some practical situations (e.g., when expressed in a particular expression system) without substantially affecting the function of the polypeptide. Thus, in describing a particular polypeptide amino acid sequence in the present specification and claims, although it may not comprise a methionine encoded at the N-terminus by the initiation codon, a sequence comprising such methionine is also contemplated at this time, and accordingly, the encoding nucleotide sequence may also comprise the initiation codon; and vice versa.

"genome" as used herein encompasses not only chromosomal DNA present in the nucleus of a cell, but also organelle DNA present in subcellular components of the cell (e.g., mitochondria, plastids).

"exogenous" with respect to a sequence means a sequence from a foreign species, or if from the same species, a sequence that has undergone significant alteration in composition and/or locus from its native form by deliberate human intervention.

"nucleic acid sequence", "polynucleotide", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are a single-or double-stranded RNA or DNA polymer, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides are referred to by their single letter designations as follows: "A" is adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "D" represents A, T or G, "I" represents inosine, and "N" represents any nucleotide.

"polypeptide", "peptide", and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms including, but not limited to, glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

As used herein, an "expression construct" refers to a vector, such as a recombinant vector, suitable for expression of a nucleic acid sequence of interest in an organism. "expression" refers to the production of a functional product. For example, expression of a nucleic acid sequence may refer to transcription of the nucleic acid sequence (e.g., transcription into mRNA or functional RNA) and/or translation of RNA into a precursor or mature protein.

The "expression construct" of the present application may be a linear nucleic acid fragment (including DNA or RNA fragment), a circular plasmid, a viral vector.

An "expression construct" of the application may comprise a regulatory sequence and a nucleic acid sequence of interest operably linked thereto. The regulatory sequences and the nucleic acid sequences of interest may be of different origin or of the same origin but arranged in a manner different from that normally occurring in nature.

"regulatory sequence" and "regulatory element" are used interchangeably and refer to a nucleotide sequence that is located upstream (5 'non-coding sequence), intermediate or downstream (3' non-coding sequence) of a coding sequence and affects transcription, RNA processing or stability, or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. "promoter" refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment. In some embodiments of the application, the promoter is a promoter capable of controlling transcription of a gene in a cell, whether or not it is derived from the cell. The promoter may be a constitutive or tissue specific or developmentally regulated or inducible promoter.

As used herein, the term "operably linked" refers to a regulatory element (e.g., without limitation, a promoter sequence, a transcription termination sequence, etc.) linked to a nucleic acid sequence (e.g., a coding sequence or an open reading frame) such that transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operably linking a regulatory element region to a nucleic acid molecule are known in the art.

"introducing" a nucleic acid molecule (e.g., an expression construct) into a plant cell refers to presenting the nucleic acid molecule to the plant cell such that the nucleic acid molecule enters the interior of the plant cell.

"regeneration" refers to the process of growing an intact plant from one or more plant cells (e.g., plant protoplasts, calli, or explants).

2. Improved plant regeneration and transformation

In one aspect, the application provides a method of increasing the efficiency of regeneration of a plant cell, the method comprising a) introducing into the plant cell an expression construct comprising a nucleic acid sequence encoding a histone demethylase. In some embodiments, the method further comprises b) regenerating a whole plant from the plant cells obtained in a).

In one aspect, the application provides a method of increasing the efficiency of transformation of an exogenous nucleic acid sequence of interest in a plant or transforming an exogenous nucleic acid sequence of interest into a plant, the method comprising:

(a) Introducing into cells of said plant an expression construct comprising a nucleic acid sequence encoding a histone demethylase;

(b) Introducing into said plant cell at least one expression construct comprising at least one exogenous nucleic acid sequence of interest

Building a body;

(c) Regenerating an intact plant from said plant cell.

In another aspect, the present application provides a method of increasing the efficiency of gene editing in a plant or performing gene editing in a plant, the method comprising:

(a) Introducing into cells of said plant an expression construct comprising a nucleic acid sequence encoding a histone demethylase,

(b) Introducing into the plant cell at least one expression construct comprising at least one exogenous sequence of interest, wherein the at least one exogenous sequence of interest encodes a component of a gene editing system;

(c) Regenerating an intact plant from said plant cell.

The application also provides a kit for carrying out the method of the application comprising at least an expression construct comprising a nucleic acid sequence encoding a histone demethylase.

The application also provides the use of an expression construct comprising a nucleic acid sequence encoding a histone demethylase to increase plant cell regeneration efficiency in plant transformation, to increase the transformation efficiency of an exogenous nucleic acid sequence of interest in a plant, or to increase the efficiency of gene editing in a plant.

In some embodiments, the histone demethylase is an H3K27me3 demethylase. In some embodiments, the histone demethylase is a plant-derived histone demethylase. In some embodiments, the histone demethylase is derived from histone demethylase JMJ706 of rice.

Histone demethylase JMJ706 is responsible for H3K27me3 demethylation in rice or wheat and is an important enzyme for apparent modification in plants. The inventors have surprisingly found that overexpression of rice-derived JMJ706 or wheat-derived JMJ30 in a plant, such as a wheat cell, can significantly increase the efficiency of regeneration of the plant, such as a wheat cell, into a whole plant, such as a wheat plant, and also significantly increase the efficiency of transformation of an exogenous nucleic acid sequence of interest into a plant, such as a wheat plant. When the exogenous nucleic acid sequence of interest encodes a gene editing system, the efficiency of gene editing can be significantly improved.

In some embodiments, histone demethylases suitable for use in the present application comprise, for example, the amino acid sequence set forth in SEQ ID NO. 1, or an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to SEQ ID NO. 1. In some embodiments, a nucleic acid sequence encoding a histone demethylase suitable for use in the present application comprises, for example, a nucleotide sequence set forth in SEQ ID NO. 2, or a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to SEQ ID NO. 2.

In some embodiments, the nucleic acid sequence encoding the histone demethylase and the at least one exogenous nucleic acid sequence of interest are disposed in the same expression construct. In some embodiments, the histone demethylase-encoding nucleic acid sequence and the at least one exogenous nucleic acid sequence of interest are disposed in separate expression constructs. In some embodiments, the nucleic acid sequence encoding the histone demethylase is placed in one expression construct and the at least one exogenous nucleic acid sequence of interest is placed in another expression construct.

In some embodiments, the nucleic acid sequence encoding a histone demethylase and/or the at least one exogenous nucleic acid sequence of interest is operably linked to a transcriptional regulatory element.

Methods for expressing different proteins by the same expression construct are known in the art. For example, different proteins may be placed under the control of different transcriptional regulatory elements (e.g., different promoters) in the same expression construct. Alternatively, the different proteins may be fused by self-cleaving peptides (e.g., 2A peptides, including but not limited to P2A, E2A, F a and T2A, etc.) and then placed under the control of the same transcriptional regulatory elements (e.g., different promoters) such that upon translation or post-translation separate different proteins are produced by self-cleavage of the self-cleaving peptides. Alternatively still, an Internal Ribosome Entry Site (IRES) can be inserted between the nucleic acid sequences encoding the different proteins.

The "at least one exogenous nucleic acid sequence of interest" may be any nucleic acid sequence that is desired to be transformed into a plant. For example, the exogenous nucleic acid sequence of interest may encode a nucleic acid sequence encoding a trait important for agronomic, insect resistance, disease resistance, herbicide resistance, sterility, and commercial products. Nucleic acid sequences of interest may also include those involved in oil, starch, carbohydrate or nutrient metabolism, as well as those affecting fruit size, sucrose loading, etc.

In some preferred embodiments, the "at least one exogenous nucleic acid sequence of interest" encodes a component of a gene editing system, such that gene editing can be performed on a plant.

"Gene editing", also known as genome editing, uses sequence-specific nucleases or derivatives thereof to make nucleotide insertions, deletions or substitutions in the genome of an organism. Gene editing is typically performed by causing a site-specific Double Strand Break (DSB) at a desired location in the genome, and then introducing the desired DNA insertion, deletion or substitution during repair of the DSB. However, gene editing may also encompass base editing techniques that do not involve DSBs, transcriptional activation or inhibition, and epigenetic modification techniques, so long as they have sequence specificity.

The present application is not particularly limited to the gene editing system used. For example, gene editing systems suitable for use in the present application include, but are not limited to, zinc Finger Nuclease (ZFN), meganuclease (MGN), transcription activator-like effector nuclease (TALEN), and CRISPR (Clustered regularly interspaced short palindromic repeats ) systems.

A "zinc finger nuclease" is an artificial restriction enzyme prepared by fusing a zinc finger DNA binding domain to a DNA cleavage domain. The single zinc finger DNA binding domain of ZFNs typically contains 3-6 separate zinc finger repeats, each of which can recognize a unique sequence of, for example, 3 bp. By combining different zinc finger repeats, different genomic sequences can be targeted.

Meganuclease (meganuclease) generally refers to a homing endonuclease capable of recognizing a nucleic acid sequence of 14-40 bases in length. The long recognition sequence enables the meganuclease to have very strong specificity, thereby reducing off-target effects thereof.

A "transcription activator-like effector nuclease" is a restriction enzyme that can be engineered to cleave a specific DNA sequence, typically prepared by fusing the DNA binding domain of a transcription activator-like effector (TALE) to a DNA cleavage domain. TALEs are engineered to bind to virtually any desired DNA sequence.

"CRISPR systems" generally comprise two components that can form a complex with sequence specificity: CRISPR nucleases or variants thereof, and corresponding guide RNAs. Thus, for a CRISPR system, the "at least one exogenous nucleic acid sequence of interest" of the present application may comprise a nucleic acid sequence encoding a CRISPR nuclease or variant thereof, and a nucleic acid sequence encoding a corresponding guide RNA.

In some preferred embodiments, the gene editing system is a CRISPR system. A number of different CRISPR gene editing systems are known in the art, all of which are applicable to the present application. For example, suitable CRISPR gene editing systems can be found inhttp://www.addgene.org/crispr/. CRISPR gene editing systems encompass systems that alter genomic sequences, as well as systems for transcriptional regulation but do not alter genomic sequences.

As used herein, the term "CRISPR nuclease" generally refers to a nuclease that is present in a naturally occurring CRISPR system. "CRISPR nuclease variants" include modified forms of natural CRISPR nucleases, artificial mutants (including nicking enzyme mutants), catalytically active fragments, or fusions with other functional proteins/polypeptides, and the like. Artificial functional variants of various CRISPR nucleases are known in the art, such as high specificity variants or nicking enzyme variants, or fusion proteins thereof with cytidine deaminase or adenosine deaminase, etc. CRISPR nucleases or variants thereof can recognize, bind and/or cleave target nucleic acid structures by interacting with corresponding guide RNAs. The skilled artisan knows how to select a suitable CRISPR nuclease or variant thereof to achieve the objects of the present application.

The CRISPR nuclease or variant thereof used in the CRISPR gene editing system of the application may be selected from, for example, cas3, cas8a, cas5, cas8b, cas8C, cas10d, cse1, cse2, csy1, csy2, csy3, GSU0054, cas10, csm2, cmr5, cas10, csx11, csx10, csf1, cas9, csn2, cas4, cpf1 (Cas 12 a), C2C1, C2C3 or C2 protein, or functional variants of these nucleases.

In some embodiments, the CRISPR nuclease or variant thereof comprises a Cas9 nuclease or variant thereof. CRISPR gene editing systems based on Cas9 nucleases or variants thereof are also referred to herein as CRISPR-Cas9 gene editing systems. The Cas9 nuclease may be a Cas9 nuclease from a different species, such as spCas9 from streptococcus pyogenes(s).

Cas9 nuclease variants can include Cas9 nickases (nCas 9), wherein one of the two subdomains (HNH nuclease subdomain and RuvC subdomain) of the DNA cleavage domain of the Cas9 nuclease is inactivated to form the nickase. In some embodiments, deletion of the sequence to be edited, or substitution of the sequence to be edited in the presence of a donor sequence, can be achieved using Cas9 nickase in combination with two grnas targeting upstream and downstream of the sequence to be edited.

In some embodiments, the CRISPR nuclease or variant thereof may further comprise a Cpf1 (Cas 12 a) nuclease or variant thereof, e.g., a high-specificity variant. The Cpf1 nucleases may be Cpf1 nucleases from different species, for example Cpf1 nucleases from Francisella novicida U, acidoaerococcus sp.BV3L6 and Lachnospiraceae bacterium ND 2006. CRISPR gene editing systems based on Cpf1 nucleases or variants thereof are also referred to herein as CRISPR-Cpf1 systems.

In some embodiments, the CRISPR nuclease variants can further comprise a base editor (base editor). The base editor is typically a fusion protein comprising a deaminase and a CRISPR nuclease variant lacking DNA cleavage activity.

As used herein, "CRISPR nuclease variants lacking DNA cleavage activity" include, but are not limited to, cas9 nicking nuclease (nCas 9), nuclease-dead Cas9 nuclease (dCas 9), or nuclease-dead Cpf1 nuclease (dCpf 1). Nuclease-dead Cas9 nuclease (dCas 9) or nuclease-dead Cpf1 nuclease (dCpf 1) completely lacks DNA cleavage activity. A variety of CRISPR nuclease variants are known in the art that lack DNA cleavage activity.

As used herein, "deaminase" refers to an enzyme that catalyzes a deamination reaction. In some embodiments of the application, the deaminase refers to a cytosine deaminase that is capable of accepting single-stranded DNA as a substrate and is capable of catalyzing deamination of cytidine or deoxycytidine to uracil or deoxyuracil, respectively. In some embodiments of the application, the deaminase refers to an adenine deaminase that is capable of accepting single stranded DNA as a substrate and is capable of catalyzing the formation of inosine (I) from adenosine or deoxyadenosine (a). A variety of suitable cytosine deaminase or adenine deaminase enzymes are known in the art that accept single stranded DNA as a substrate. Suitable cytosine deaminases include, but are not limited to, for example, apodec 1 deaminase, activation-induced cytidine deaminase (AID), apodec 3G, CDA1, human apodec 3A deaminase. In some preferred embodiments, the cytosine deaminase is human apodec 3A. Examples of suitable adenine deaminases include, but are not limited to, the DNA-dependent adenine deaminases disclosed by Nicloe M.Gaudelli et al (doi: 10.1038/aperture 24644, 2017).

Base editing in a target nucleotide sequence, such as a C to T conversion or a to G conversion, can be achieved by fusion with deaminase (forming a so-called "base editor") using CRISPR nuclease variants that lack DNA cleavage activity. A variety of base editors are known in the art, and a person skilled in the art knows how to select an appropriate base editor to achieve the objects of the application. CRISPR gene editing systems based on base editors are also known as base editing systems.

As used herein, "guide RNA" and "gRNA" are used interchangeably to refer to an RNA molecule capable of forming a complex with a CRISPR nuclease or variant thereof and of targeting the complex to a target sequence due to having a identity to the target sequence. For example, the grnas employed by Cas9 nucleases or variants thereof are typically composed of crrnas and tracrRNA molecules that are partially complementary to form a complex, wherein the crrnas comprise a guide sequence that has sufficient identity to a target sequence to hybridize to the complementary strand of the target sequence and direct the CRISPR complex (Cas 9+crrna+tracrrna) to specifically bind to the target sequence. However, it is known in the art that one-way guide RNAs (sgrnas) can be designed which contain both the features of crrnas and tracrrnas. Whereas the gRNA employed by the Cpf1 nuclease or variant thereof typically consists of only mature crRNA molecules, which may also be referred to as sgrnas. It is within the ability of the person skilled in the art to design a suitable gRNA based on the CRISPR nuclease used or variant thereof and the target sequence to be edited.

The sequence-specific nucleases for gene editing in the present application, such as zinc finger nucleases, transcription activator-like effector nucleases or CRISPR nucleases or variants thereof, may also comprise subcellular localization signals (e.g., nuclear localization signals), peptide linkers, detectable tags, and the like. For example, base editors in CRISPR base editing systems typically contain one or more Nuclear Localization Signals (NLS) to facilitate their entry into the nucleus, enabling editing of chromosomal DNA.

The expression constructs of the application may be introduced into plant cells by one of a variety of methods known in the art, including, but not limited to, gene gun methods, PEG-mediated protoplast transformation, and agrobacterium-mediated transformation.

In some embodiments, the plant cells of the application are cells suitable for regeneration into whole plants by tissue culture.

Methods for regenerating whole plants by culturing transformed immature embryos are known in the art. Transformants may also be screened during the regeneration process based on the selectable marker carried on the introduced expression construct. In some embodiments, the regeneration is performed in the absence of a selective pressure. In some embodiments, moderately stringent screening conditions may be used to screen transformants. The moderately stringent conditions refer to conditions that do not completely inhibit the growth of non-transformants. For example, moderately stringent screening conditions do not inhibit the growth of transformants but partially inhibit the growth of non-transformants. For example, under moderately stringent screening conditions, non-transformants may grow but slower or weaker than transformants. Moderately stringent screening conditions are those that one skilled in the art can determine for a particular plant and a particular selectable marker.

In some embodiments, the expression constructs of the application are transiently transformed into plant cells. Transient transformation refers to the introduction of a construct into a cell that is rendered functional but not integrated into the cell genome. This is particularly useful for gene editing, as non-transgenic modified plants can be produced.

Plants suitable for transformation or gene editing by the methods of the application may be monocotyledonous or dicotyledonous plants. For example, examples of such plants include, but are not limited to, wheat, strawberry, rice, corn, soybean, sunflower, sorghum, canola, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, tapioca, and potato. The method of the application is particularly suitable for genetic transformation or genetic editing in plant varieties or genotypes which were previously difficult to transform. In some embodiments, the plant is wheat, e.g., the wheat is a different variety of wheat plants, e.g., KN199, bobwhite, etc.

In order to obtain efficient expression in plants, in some embodiments of the application, the coding nucleic acid sequence or nucleic acid sequence of interest is codon optimized for the plant species.

Codon optimization refers to a method of modifying a nucleic acid sequence to enhance expression in a host cell of interest by replacing at least one codon of the native sequence with a more or most frequently used codon in the gene of the host cell (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons while maintaining the native amino acid sequence).

In one aspect, the application provides plants and progeny thereof obtained by the methods of the application.

Examples

A further understanding of the present application may be obtained by reference to the specific examples which are set forth to illustrate, but are not intended to limit the scope of the present application. It will be apparent that various modifications and variations can be made to the present application without departing from the spirit of the application, and therefore, such modifications and variations are also within the scope of the application as claimed.

Example 1 over-expression of histone demethylase improved wheat genetic transformation and gene editing efficiency.

1. Control group selection

pUBI-GFP and mGRF4-GIF1 were selected as negative and positive controls for this study. Among them, mGRF4-GIF1 (WO 2021185358A 1) was a protein complex established by the group of the inventors, and it was found that the regeneration and editing efficiency of wheat could be effectively promoted by the transient expression of mGRF4-GIF1 (Qia, F., xing, S., xue, C.et al., sci.China Life Sci., 2022).

2. Experimental vector construction

The research selects histone demethylases JMJ703, JMJ704 and JMJ706 of diploid rice for research, and detects whether the histone demethylases JMJ703, JMJ704 and JMJ706 have an improvement effect on genetic transformation and gene editing of wheat through different constructions.

First NCBI found the rice JMJ703 gene (amino acid sequence shown in SEQ ID NO:3, nucleotide sequence shown in SEQ ID NO: 4), JMJ704 gene (amino acid sequence shown in SEQ ID NO:5, nucleotide sequence shown in SEQ ID NO: 6), and rice JMJ706 gene (amino acid sequence shown in SEQ ID NO:1, nucleotide sequence shown in SEQ ID NO: 2). The above coding sequences were cloned under the control of ZmUBI promoter into gene editing vector p163, and the obtained vectors were named pOsJMJ703, pOsJMJ704, and pOsJMJ706, respectively. And constructing a control vector in the same way. The vector map is shown in FIG. 1.

3. Transformation and regeneration of wheat plants

The vector constructed above was transformed into wheat callus by gene gun. The results of wheat callus regeneration are shown in FIG. 2. It can be seen that over-expression of rice JMJ706 significantly improved the efficiency of wheat callus regeneration compared to the negative control group.

Sequence listing

SEQ ID NO. 1 Rice JMJ706 amino acid sequence

MQQVEGRNCLPAEVRIGLETLKRRRLERMRLTAQNNAGDGPPVPARSGGDALRTPANCGVRLHANNGTALPSRTTQNKDPFAKRRVDKFDMSSLEWIDKIEECPVYYPTKEEFEDPIGYIQKIAPVASKYGICKIVSPVSASVPAGVVLMKEQPGFKFMTRVQPLRLAKWAEDDTVTFFMSERKYTFRDYEKMANKVFAKKYSSASCLPAKYVEEEFWREIAFGKMDFVEYACDVDGSAFSSSPHDQLGKSNWNLKNFSRLSNSVLRLLQTPIPGVTDPMLYIGMLFSMFAWHVEDHYLYSINYHHCGAFKTWYGIPGDAAPGFEKVASQFVYNKDILVGEGEDAAFDVLLGKTTMFPPNVLLDHNVPVYKAVQKPGEFVITFPRSYHAGFSHGFNCGEAVNFAISDWFPLGSVASRRYALLNRTPLLAHEELLCRSAVLLSHKLLNSDPKSLNKSEHPHSQRCLKSCFVQLMRFQRNTRGLLAKMGSQIHYKPKTYPNLSCSMCRRDCYITHVLCGCNFDPVCLHHEQELRSCPCKSNQVVYVREDIQELEALSRKFEKDICLDKEISGFDSYKQAEKNEPFFEITRNLRNTEVNLIEDAFSGATAADAAKSSPATSTLTSFAQHDVPVLAEAIVCANQADQLYSTTEQTISSPLVKGTDAVGANSSSMADANNGTGSCNASAVEYSGNSDSESEIFRVKRRSGVSVKPASDAKTSNLSDQQVLRRLKKVRPEIQQHNKRPEDYGHCSVPSGRMSMKNLNSSSSCGEEHWRMKRRQLETQQDESSYSAKQKSYSYPSTSYSFRGEFVEMSRDAAAEVRPKRLKIRLPSSSTNRVVEQGSSGQRFTRDDKSLGC

WPAI*

SEQ ID NO. 2 Rice JMJ706 coding sequence

ATGCAACAGGTGGAGGGCAGGAACTGTCTTCCTGCGGAGGTCAGGATTGGCCTCGAGACGCTCAAGAGGCGCCGGCTTGAGAGGATGCGTTTGACTGCTCAGAACAATGCCGGCGACGGTCCTCCGGTGCCCGCAAGGAGCGGTGGGGATGCGCTAAGGACTCCCGCAAACTGCGGGGTCAGGTTGCATGCTAACAATGGCACAGCTCTACCTAGCAGAACCACCCAGAACAAGGACCCTTTTGCAAAGCGCAGGGTGGACAAGTTTGATATGTCTAGCCTAGAATGGATTGACAAGATCGAAGAATGCCCTGTGTACTATCCTACCAAGGAGGAGTTCGAGGATCCCATTGGTTATATACAGAAGATTGCACCTGTGGCTTCGAAATACGGAATTTGCAAAATCGTATCTCCAGTAAGCGCTTCTGTTCCTGCTGGTGTCGTGTTGATGAAGGAACAGCCTGGTTTCAAGTTCATGACCAGGGTTCAGCCGCTTCGCCTCGCCAAATGGGCTGAAGATGACACGGTCACTTTCTTCATGAGCGAAAGAAAGTACACTTTCCGGGATTATGAGAAAATGGCCAACAAGGTGTTCGCCAAGAAATACTCAAGTGCTAGTTGTCTCCCAGCTAAGTACGTGGAGGAGGAATTCTGGCGCGAAATTGCTTTTGGTAAAATGGATTTTGTTGAATATGCCTGTGATGTTGATGGTAGTGCTTTCTCCTCTTCTCCTCATGATCAACTTGGGAAAAGCAACTGGAACTTGAAGAATTTTTCACGGCTTTCCAATTCTGTGCTTAGACTTCTGCAGACACCAATTCCAGGAGTAACAGATCCAATGCTTTATATCGGGATGCTCTTCAGCATGTTTGCTTGGCATGTGGAAGATCATTATTTGTACAGCATCAATTACCATCATTGTGGGGCATTTAAGACATGGTATGGCATACCGGGTGATGCTGCTCCTGGGTTTGAAAAGGTGGCTAGCCAGTTTGTATACAACAAGGATATTTTGGTTGGTGAAGGAGAGGATGCAGCATTTGATGTTCTCTTGGGGAAGACAACAATGTTCCCCCCAAATGTCTTGTTAGACCACAACGTTCCTGTTTATAAAGCTGTGCAAAAACCTGGGGAGTTTGTCATTACTTTCCCTCGTTCCTACCACGCGGGTTTCAGCCACGGCTTCAATTGTGGCGAGGCTGTCAACTTTGCTATCAGTGACTGGTTTCCTCTGGGTTCTGTGGCCAGCAGACGCTACGCGCTTCTGAACAGAACACCCTTGCTTGCACACGAGGAGTTACTTTGCCGTTCTGCAGTGCTTCTGTCCCACAAACTGTTAAACAGCGACCCAAAATCCCTCAATAAATCTGAGCATCCACATTCACAGCGTTGTTTGAAGTCTTGCTTTGTGCAGTTGATGCGATTCCAGAGAAACACACGTGGCCTACTTGCTAAAATGGGCTCTCAGATACATTATAAGCCAAAAACATACCCGAATCTCTCATGTAGCATGTGTCGGCGTGATTGCTACATTACACATGTGTTGTGTGGATGCAACTTTGACCCAGTCTGTCTTCATCACGAACAAGAACTCCGGAGCTGCCCTTGTAAATCTAACCAGGTTGTCTACGTTAGGGAGGACATACAGGAGCTAGAAGCTCTATCAAGAAAATTTGAGAAGGATATTTGCTTGGATAAGGAAATAAGTGGTTTTGACTCATACAAGCAGGCCGAAAAGAATGAGCCATTTTTTGAGATAACTCGGAACCTCAGGAACACTGAAGTAAATTTGATAGAGGATGCCTTCTCAGGAGCAACTGCTGCTGATGCTGCAAAGAGTTCTCCTGCAACGTCAACACTGACATCTTTTGCACAACATGATGTGCCTGTTCTTGCTGAAGCAATTGTCTGTGCTAATCAAGCCGACCAATTATACTCCACCACCGAGCAAACCATCAGCTCACCTTTAGTCAAAGGAACTGATGCTGTGGGTGCAAATTCATCCAGCATGGCTGATGCTAATAACGGAACTGGTTCTTGTAATGCTTCAGCTGTGGAATACAGTGGAAATTCAGATTCTGAATCTGAAATATTTCGAGTCAAGCGCAGGTCTGGCGTATCAGTAAAGCCTGCATCTGATGCCAAGACATCAAACTTGTCTGATCAACAGGTTCTCAGGCGGTTGAAGAAGGTGCGCCCTGAAATACAACAGCACAATAAGCGACCAGAAGACTATGGTCACTGTTCAGTTCCCTCAGGTCGTATGAGTATGAAGAATTTGAATTCATCCTCCTCATGTGGTGAAGAACACTGGAGGATGAAGCGGCGGCAGTTGGAGACTCAGCAGGATGAGAGCAGTTATTCTGCAAAGCAGAAGTCGTACTCGTATCCATCCACCAGCTATTCTTTCCGAGGAGAGTTTGTGGAAATGAGTAGAGATGCTGCTGCAGAAGTCCGACCAAAGCGACTGAAAATCCGGCTACCTTCTTCTAGCACGAACAGAGTGGTTGAGCAGGGCAGTTCAGGGCAAAGATTTACAAGGGATGACAAGTCGCTTGGTTGTTGGCCTGCAATTTAG

SEQ ID NO. 3 Rice JMJ703 coding sequence

ATGATGGGGGTTACCACCACGCTCAACGAGGACACTGAACCCTCTATTCCACCTGGATTTGGACCTTTTGCTACCCTTCCGTTATGGGGAATCCACAATGATGCCAAACCTGCTGTTACTCATTCTACTCCTGTTCAAGCATTGCAAAGCATTAGAAAAGACAGCGAAGAATGCCAACCCAGTGCGGCTGTGTCTCGGAGTGATACACCTTGCAGCACTTCCGGAACCCAGACATGCAGAAAATCACTGCGTAACAGACCCCCAATAGACTATAGCCGCTTTGAACATATATCGGATGAAGATTCTGATGTCGAAATAGTGGAAAAGGATGTAAGTTCAACGAGACGCAGACAACAGCTACCGAAAGGAGTACTTCGAGGATGTGCAGAATGCAGTGACTGTCAAAAGGTTATCGCAAAATGGAATCCAGCTGGTGCACGCAGGCCTGTTCTTGATGAGGCTCCTGTTTTCTATCCAACAGAGGAGGAATTTGAAGACACTCTAAAATACATTGAGAGTATACGGCCAATGGCGGAACCATATGGTATTTGCCGTATTGTCCCACCATCTTCTTGGAAGCCTCCATGCCTTCTTAAAGATAAAAGCATATGGGAAGGATCAAAATTCTCTACTCGGGTACAAAAGGTTGACAAGCTCCAAAACCGTAAATCATCAAAAAAGGGCAGAAGAGGTGGAATGATGAAGAGGAGAAAGCTTGCAGAGTCAGAGGAGAACAGTGCCACTGCTCACACTCAGACAGGGATGCAGCAAAGTCCAGAGAGATTTGGATTTGAACCTGGGCCAGAGTTCACGTTACAGACATTTCAGAAATATGCAGATGATTTCAGTAAGCAGTACTTTAGGAAAGATACATCGATGGATTCAGTACCATCAGTGGAAGATATTGAAGGTGAGTACTGGCGCATCGTTGAGGTTCCCACAGAAGAGATAGAGGTGATATATGGTGCTGATCTGGAGACTGGAACTTTCGGCAGTGGTTTTCCAAAATTATCTCCTGAGACAAAATCTGATGCTGAGGATAAATATGCACAATCTGGTTGGAATCTAAATAACTTGCCTAGACTACAAGGTTCAGTTCTTTCTTTCGAGGGCGGTGACATTTCTGGTGTTCTAGTGCCTTGGGTGTATGTTGGCATGTGTTTTTCATCATTCTGCTGGCATGTTGAAGACCATCATTTATACTCACTAAACTACATGCATTGGGGTGCCCCAAAGTTGTGGTATGGAGTTCCAGGAAAGGATGCTGTGAATTTGGAATCTGCAATGAGGAAACATCTACCTGAATTATTTGAGGAGCAACCTGATTTGCTACACAACCTTGTTACCCAGTTTTCACCATCGCTGCTGAAATCTGAAGGAGTACATGTATACCGTTGTGTTCAGCATGAGGGCGAGTTTGTCTTGACATTCCCAAGGGCGTACCATGCTGGTTTCAATTGTGGCTTCAATTGTGCCGAAGCTGTTAATGTGGCTCCTATTGATTGGTTACCGATTGGACATAATGCTGTAGAGCTTTATCGTGAGCAAGCTAGGAAAATAACCATTTCTCATGATAAGTTGTTGTTGGGGGCTGCAAGAGAAGCAATAAGAGCTCAGTGGGATATCCTATTCCTCAAGAGGAATACTGCTGATAATATGAGGTGGAAGAGTATATGCGGAGCTGATAGCACTATATTCAAGGCTCTTAAGGCACGAATTGAGACAGAGTTGGTGCAAAGGAAAACTCTAGGTGTTCCAGCTCAATCAAGGAAAATGGATGCTGAATTCGATTCCATTGATAGGGAATGTGCCTTGTGCTACTATGATTTACATCTTTCTGCTTCTGGCTGTCCATGCTGCCCAGAGAAATATGCTTGCCTTGTACATGCAAAGCAACTTTGCTCATGTGACTGGGACAAAAGGTTTTTCCTATTCCGCTATGATGTCAATGAGCTAAATATCTTAGCTGATGCTTTAGGGGGGAAATTAAGTGCCATTCATAGATGGGGCGTCTCTGATCTTGGATTAAGTTTGAGTTCATGTGTCAAACGAGAAAAGGTCCAAGATTCCAAGACTGTTCGCAGATTAACTGATGGTCCAAGAAGGTCTTACATGTCACAGGCATCAGCAGTATCCTTGGTTTCTTCTTCTACTTCCAATGAACAGAAAGATGAAGGAAATAAGATCATGAAGATAGCTAGCCCACAGACAAATAATGTGTGCCCTTCTGTCGAGCAAAGGAAATCAGAGAATATTTCACCATTGAAGGAGCCATGTGTAAGGAATGAGTTGTCATGTACAACAAATTCTGATAGTAACGGATTGCAATATAATGGAGGACTTGGAGGCCATAAAGGATCTGCACCAGGCTTGCCAGTTTCTTCTAGCCCATCATTTTCTTCCAACGTTGCAACAAGGCCCATTAGTACTTCAAGTGTATCCATGAAAATTGTGCAAGGCTTGGTGGCATCTAAAAGTTGTATACAAGCTTCCTCTCGAACTGGAGACAGTAGATCATTGCTTGGTGAGCATCATAACAGATCACCGGCAATGATTCATGATGGAACCAACATGAAGTCCAGTTTGGAAAGCTCAAACAATTCTTGCAGGTTGATTGCATCTGACTATAATGCAACTCCGTGTCATTCATCCAAGGATCAGGTATTAGTAACACCAGGGACTAATGCCTCAGTAGTGACTCTGAAAGATAGCAGCCAGGTCCATAGTGCGTCAAGTCAGCAGTTTGTCAGAACTGGCCCATGGACACAAAGTGCTTCTCATGAAGCATCATCACCTAGTACCTCTGCTTTGAAGCCTTCTTTAGATCCCCCTGCCATGAAAAATCTGTATGGGGGTTTTACTCAAGGCAGTGCCCATCCTGGACCTCCAAGTTTCAGTAATCAGCAACCAAATGATGGGCGTCTTCAAAGAACATCTGAATCTCTACCAGGTGTGGAAGCTAGAGCTAGGGGACATCCAACTGTCACGGCACAGCCTGCACTAGAAATTCACAGCAGGAATGGAGGTGCACAGAAGGGTCCTCGCATAGCCAATGTTGTGCATCGTTTCAAGTGCTCTGTTGAACCTCTCGAAATTGGTGTTGTGCTATCAGGGAGGCTGTGGTCTTCAAGCCAAGCAATCTTCCCGAAAGGGTTTAGAAGCAGAGTGAAATACTTCAGCATTGTGGATCCAATCCAAATGGCATACTACATATCGGAAATACTGGATGCTGGGATGCAGGGGCCTCTGTTTATGGTAAAATTAGAGAACTGTCCAGGTGAAGTTTTCATTAACTTATCTCCAACCAAGTGTTGGAACATGGTCCGTGAAAGGCTGAACATGGAAATAAGGAGGCAACTTAATATGGGAAAATCAAATCTTCCTACATTGCAGCCTCCAGGATCAGTTGATGGTCTTGAAATGTTTGGTTTATTATCACCACCAATAGTTCAGGCAATTTGGGCGCGGGACAGAGATCACATCTGTACAGAGTACTGGAGATCAAGGCCCCATGTTCTCATTGAGGATCCAAACAATCGGCATATGTTATCTCAGGGTCCACCTCTCCTTGCCCTGAGGGGTCTCATCCAAAGGGCTAACCGGGATGAATTGCAAGTCCTGCGGAGTTTGATGACGAACAGCAACAATTTGGATGATAGCTCCAGGCAACAGGCCGCGCACATTATCGAAGAGGAGATTGCGAAGCAATTGTGCTGA

SEQ ID NO. 4 Rice JMJ703 amino acid sequence

MMGVTTTLNEDTEPSIPPGFGPFATLPLWGIHNDAKPAVTHSTPVQALQSIRKDSEECQPSAAVSRSDTPCSTSGTQTCRKSLRNRPPIDYSRFEHISDEDSDVEIVEKDVSSTRRRQQLPKGVLRGCAECSDCQKVIAKWNPAGARRPVLDEAPVFYPTEEEFEDTLKYIESIRPMAEPYGICRIVPPSSWKPPCLLKDKSIWEGSKFSTRVQKVDKLQNRKSSKKGRRGGMMKRRKLAESEENSATAHTQTGMQQSPERFGFEPGPEFTLQTFQKYADDFSKQYFRKDTSMDSVPSVEDIEGEYWRIVEVPTEEIEVIYGADLETGTFGSGFPKLSPETKSDAEDKYAQSGWNLNNLPRLQGSVLSFEGGDISGVLVPWVYVGMCFSSFCWHVEDHHLYSLNYMHWGAPKLWYGVPGKDAVNLESAMRKHLPELFEEQPDLLHNLVTQFSPSLLKSEGVHVYRCVQHEGEFVLTFPRAYHAGFNCGFNCAEAVNVAPIDWLPIGHNAVELYREQARKITISHDKLLLGAAREAIRAQWDILFLKRNTADNMRWKSICGADSTIFKALKARIETELVQRKTLGVPAQSRKMDAEFDSIDRECALCYYDLHLSASGCPCCPEKYACLVHAKQLCSCDWDKRFFLFRYDVNELNILADALGGKLSAIHRWGVSDLGLSLSSCVKREKVQDSKTVRRLTDGPRRSYMSQASAVSLVSSSTSNEQKDEGNKIMKIASPQTNNVCPSVEQRKSENISPLKEPCVRNELSCTTNSDSNGLQYNGGLGGHKGSAPGLPVSSSPSFSSNVATRPISTSSVSMKIVQGLVASKSCIQASSRTGDSRSLLGEHHNRSPAMIHDGTNMKSSLESSNNSCRLIASDYNATPCHSSKDQVLVTPGTNASVVTLKDSSQVHSASSQQFVRTGPWTQSASHEASSPSTSALKPSLDPPAMKNLYGGFTQGSAHPGPPSFSNQQPNDGRLQRTSESLPGVEARARGHPTVTAQPALEIHSRNGGAQKGPRIANVVHRFKCSVEPLEIGVVLSGRLWSSSQAIFPKGFRSRVKYFSIVDPIQMAYYISEILDAGMQGPLFMVKLENCPGEVFINLSPTKCWNMVRERLNMEIRRQLNMGKSNLPTLQPPGSVDGLEMFGLLSPPIVQAIWARDRDHICTEYWRSRPHVLIEDPNNRHMLSQGPPLLALRGLIQRANRDELQVLRSLMTNSNNLDDSSRQQAAHIIEEEIAKQLC*

SEQ ID NO. 5 Rice JMJ704 coding sequence

ATGGTTTCCTCCCGCGACCCCGGCGAGGAGGCCAGCGCGCCGCCGCCCCCGCCCCCGCGCCGCGGCGAGAAGCGGCGAATGCGCGGCCGCACCCCGTCGCCGGAGCCGGCCTCCGCGCCGCAGGATCTCTGCCCATCAGGAGCTTGCGGGGACAATGTTGCTGGAGCTACAACTACAAATGGAAAGTGGCATCCACATGAATCGTACAGACCTGAAATTGATGATGCCCCTGTTTTCACTCCAACGGAAGAGGAGTTTAAAGATCCAATTAGATATATTACGAGCATTCGTCCCCAAGCAGAAAAGTATGGAATTTGTCGTATTGTTCCACCATCTTCTTGGCGACCGCCTTGTTCTCTGAAGGAGAAGAACTTCTGGGAATGTACAGAGTTCAATACCCGTGTTCAACAAGTTGACAAGCTTCAAAACCGGGAACCCACAAAGAAAAAATCACAACCTCGAGTTCAGAAGAAGAGGAAGAGGAGAAAGAGACTGAGATTTGGGATGACTCACAGGCGTCCTAGTGCAAATACATCAGAAGACTGCGCAGATGCAGACGAGAAGTTTGGCTTTCAATCTGGCTCAGATTTCACACTAGATGAGTTTCAGAAATATGCAGATGAGTTTAAGCAGCAGTATTTTGGAATAAAGGGAAGTGACGAAATCCCTCTTTCTGAAATTAAAAAGAAGAAAAAAAATTGGCAACCATCGGTCGATGAAATAGAGGGAGAATATTGGCGGATAGTTGTATGCCCCACTGACGAAGTTGAGGTGGATTATGGTGCTGATTTGGACACTTCAATGTTCAGTAGTGGATTCTCTAAATTATCTTCAGATTCAAATAGACGAGATCCATATGGTTTATCTTGTTGGAATTTGAACAATCTTCCACGTATTCCTGGGTCTGTACTGTCATTTGAAACTGAGGATATATCTGGCGTCGTAGTCCCTTGGCTTTATGTAGGGATGTGCTTCTCATCATTCTGTTGGCACGTGGAAGATCATTTCCTTTATTCTATGAATTACATGCATTTTGGTGAACCAAAAGTATGGTATGGTGTTCCTGGTGCTGATGCAGTGAAGCTGGAAGAAGCTATGAGAAAGAACTTACCAAGATTGTTTGAAGAACAGCCTGATCTCCTACATGAGCTGGTTACGCAATTATCTCCTTCTGTTCTTAAATCAGAAGGAGTTCCTGTTTATCGTGTTGTTCAGAATCCAGGCGAGTTTGTTCTAACGCTACCGCGAGCTTACCATTCTGGGTTCAACTGTGGCTTCAACTGTGCGGAGGCAGTAAATGTCGCACCTGTGGATTGGCTGCCTCACGGACAATGTGCTGTTGAGCTCTACAGGGAGCAGCGGCGCAAGACATCCATATCACATGACAAATTATTACTAAAAACTGCAAATGAAGCTGTCAGACAGCTTTGGATGAACCTTAGCGACTGCAAAAGTGAACAAGGAGTATACAGATGGCAGGATACTTGCGGAAAGGACGGAATGCTGACAAGTGCAATTAAGACAAGGGTTAAAATGGAGAAGGCAGCACGGGGAGGGAATATGGCACTGCGATATAAGAAAATGGATGGGGATTATGATTCAGCTGACCGGGAATGCTTTTCATGTTTTTATGATCTCCATTTGTCAGCTGTCAGCTGCCAATGCTCCCCAAATCGTTTTGCTTGCTTAAACCATGCAAACATTCTATGTTCATGTGAAATGGACAGAAAAACCGCGTTGTTGCGGTATACCATAGAGGAGCTCCATACTCTTGTTGCAGCTCTAGAGGGTGATCCAACTGCGGTCTACCAGTGGGGACAGAATGATTTAGGTTTAGTCTGCCCATCTGGTTCTACTCAGTACAAGAAGATGGACTTGGGTGAAAACACGGAATTTCCGGATTCAGCAACCAACGTCAATCATGGCTGCAGCTTAGGAAGTCAAGATCAATATCACTATGACCCCGCAAAGCCAGCAGGATACCAGCAAGAGAAGGGAATCCAGATTGCTTCAGAAAAACATGATAAGAACAAGATGGTTGTCAATCTTGAGTCTCCAGCAACAGCTAGTAATCCAAGCAGGTCAAAGTCTGACTGCAGTGGCTCACTGTCCTTGAATCATTCATCTGAGTTACCATCTTCAAGAATTCAAACAGGAAATTCTACGCTAGCTTCCATTACCACAGAGAAACTGTTTGGTGTTGACATTAAATCCAATTTAGCACAGTCTTCTGATGGCCAAGTTAGTCAATTGGCCAAGCCTTCCTCGAGCCAAACTGATGAAGTCTCTAAGCCAGCAATAGCTAAGTATACGGTTGAGCTGCTAGACAGTGGAACAATGATGATTGGTAAAAAGTGGTGCAATCAGCAAGCTATATTCCCCAAAGGATTTAAGAGTCGAGTTACATTTCATAGTGTACTAGATCCAACAAGGACATGCTGCTACATCTCCGAAGTTCTTGATGCTGGGCTTCTTGGACCATTGTTTAGGGTGACTGTCGAAGGTCTTCCAGAAGTTTCGTTTACTCACACATCACCAATGCAATGTTGGGACAGTGTAAGAGACAGAGTAAATGAAGAAATAGCAAAACAAATAAGTTTTGGAAAATCTGGCCTTCCTGATTTTCTATCCTGCAATTCTTTGAATGGACTTGAAATGTTTGGGTTCTTATCCTCCCCTATAATTAAGGAAATCGAGGCTCTAGATCCCTGTCACCAATGCTTGGACTATTGGTTGTCAAGGGTTTCTTCTGTTGGAACTGAACTCCCCTCGGAATCTGTGATGGCAGCAATGGTTAATGACTCCACTAACCCCCCAATAAAGTTGCTCGGGATTGAGATTAACCGGAGGGAATCAGAACAATCAAGTAGCTTCAATAATTCCTGTGTGAGGAGGTCACACTTGGCAGGTTGCTGA

SEQ ID NO. 6 Rice JMJ704 amino acid sequence

MVSSRDPGEEASAPPPPPPRRGEKRRMRGRTPSPEPASAPQDLCPSGACGDNVAGATTTNGKWHPHESYRPEIDDAPVFTPTEEEFKDPIRYITSIRPQAEKYGICRIVPPSSWRPPCSLKEKNFWECTEFNTRVQQVDKLQNREPTKKKSQPRVQKKRKRRKRLRFGMTHRRPSANTSEDCADADEKFGFQSGSDFTLDEFQKYADEFKQQYFGIKGSDEIPLSEIKKKKKNWQPSVDEIEGEYWRIVVCPTDEVEVDYGADLDTSMFSSGFSKLSSDSNRRDPYGLSCWNLNNLPRIPGSVLSFETEDISGVVVPWLYVGMCFSSFCWHVEDHFLYSMNYMHFGEPKVWYGVPGADAVKLEEAMRKNLPRLFEEQPDLLHELVTQLSPSVLKSEGVPVYRVVQNPGEFVLTLPRAYHSGFNCGFNCAEAVNVAPVDWLPHGQCAVELYREQRRKTSISHDKLLLKTANEAVRQLWMNLSDCKSEQGVYRWQDTCGKDGMLTSAIKTRVKMEKAARGGNMALRYKKMDGDYDSADRECFSCFYDLHLSAVSCQCSPNRFACLNHANILCSCEMDRKTALLRYTIEELHTLVAALEGDPTAVYQWGQNDLGLVCPSGSTQYKKMDLGENTEFPDSATNVNHGCSLGSQDQYHYDPAKPAGYQQEKGIQIASEKHDKNKMVVNLESPATASNPSRSKSDCSGSLSLNHSSELPSSRIQTGNSTLASITTEKLFGVDIKSNLAQSSDGQVSQLAKPSSSQTDEVSKPAIAKYTVELLDSGTMMIGKKWCNQQAIFPKGFKSRVTFHSVLDPTRTCCYISEVLDAGLLGPLFRVTVEGLPEVSFTHTSPMQCWDSVRDRVNEEIAKQISFGKSGLPDFLSCNSLNGLEMFGFLSSPIIKEIEALDPCHQCLDYWLSRVSSVGTELPSESVMAAMVNDSTNPPIKLLGIEINRRESEQSSSFNNSCVRRSHLAGC*

Claims (10)

1. A method of increasing the efficiency of plant cell regeneration, the method comprising:

(a) Introducing into said plant cell an expression construct comprising a nucleic acid sequence encoding a histone demethylase,

(b) Regenerating an intact plant from said plant cell.

2. A method of transforming at least one exogenous nucleic acid sequence of interest into a plant, the method comprising:

(a) Introducing into cells of said plant an expression construct comprising a nucleic acid sequence encoding a histone demethylase,

(b) Introducing into said plant cell at least one expression construct comprising at least one exogenous nucleic acid sequence of interest; and

(c) Regenerating an intact plant from said plant cell.

3. A method of gene editing in a plant, the method comprising:

(a) Introducing into cells of said plant an expression construct comprising a nucleic acid sequence encoding a histone demethylase,

(b) Introducing into the plant cell at least one expression construct comprising at least one exogenous nucleic acid sequence of interest, wherein the at least one exogenous nucleic acid sequence of interest encodes a component of a gene editing system;

(c) Regenerating an intact plant from said plant cell.

4. The method of claim 2 or 3, wherein the nucleic acid sequence encoding the histone demethylase and the at least one exogenous nucleic acid sequence of interest are disposed in the same expression construct.

5. The method of any one of claims 1-4, wherein the histone demethylase comprises an amino acid sequence having at least 75% sequence identity to SEQ ID No. 1.

6. The method of claim 5, wherein the histone demethylase is from rice.

7. The method of any one of claims 3-6, wherein the gene editing system is selected from the group consisting of CRISPR systems, TALENs, meganucleases, and zinc finger nucleases.

8. The method of claim 7, wherein the gene editing system is a CRISPR system, such as a base editing system.

9. The method of any one of claims 1-8, wherein the cell is selected from the group consisting of a protoplast cell, a callus cell, a cell of an immature embryo, and an explant cell.

10. The method of any one of claims 1-9, wherein the plant is selected from the group consisting of wheat, strawberry, rice, corn, soybean, sunflower, sorghum, canola, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, tapioca, and potato.