CN116622605A

CN116622605A - Recombinant bacillus subtilis and construction method and application thereof

Info

Publication number: CN116622605A
Application number: CN202310468440.9A
Authority: CN
Inventors: 陈勇; 任培芳; 余斌; 孙文俊; 陈天鹏; 董奇伟
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2023-04-27
Filing date: 2023-04-27
Publication date: 2023-08-22

Abstract

The invention discloses a recombinant bacillus subtilis and a construction method and application thereof. According to the invention, by utilizing a CRISPR/cas9 technology, a starting strain B.S168 delta 2 for knocking out sporulation serine protease htrC and alkaline serine protease aprX is firstly constructed, then chassis cells B.S168 delta 3, B.S168 delta 4, B.S168 delta 5, B.S168 delta 6, B.S168 delta 7, B.S168 delta 8, B.S168 delta 9 and B.S168 delta 10 for knocking out extracellular protease genes are constructed on the basis of the starting strain B.S168 delta 2, and then chassis cells B.S168 delta 8, B.S168 delta 9 and B.S168 delta 10 which are most suitable for secreting and expressing pullulanase are selected on the basis, compared with the strain B.S168 delta 9 which is constructed by the original strain B.amble, and has the advantages of remarkably improved activity of the strain B.S168 delta than the strain B.168.

Description

Recombinant bacillus subtilis and construction method and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to recombinant bacillus subtilis and a construction method and application thereof.

Background

In recent years, microbial chassis cells constructed based on metabolic engineering techniques and synthetic biological methods have been widely used for the production of various natural high-value-added chemicals, high-quality clean energy and biological materials. Synthetic biology aims to create pathways or production hosts that do not exist in nature, or to modify living systems that already exist in nature, for unique targets or products to meet synthetic and production needs. Synthetic biology combines mainly the multidisciplinary knowledge of biology, chemistry, thermodynamics, etc., to create a production host by performing a series of analyses, assembly and coordination of discovered biological elements.

Bacillus subtilis (Bacillus subtilis) is often used as a model strain for bacterial genetics and cell metabolism studies as a typical gram-positive bacterium and model industrial microorganism. Bacillus subtilis has the advantages of non-pathogenicity, strong extracellular secretion protein capability, no obvious codon preference and the like, is GRAS (generally recognized as safe) -grade food safety host bacteria, has the advantages of clear physiological and biochemical characteristics, simple genetic operation, strong secretion and expression capability, convenient culture and fermentation and the like, and has wide application in the production of functional nutriment, fine chemicals and enzyme preparations. As an important industrial production strain, the subilis has been developed into chassis cells of different types through metabolic engineering modification, is modified into a microbial cell factory, is used for producing target products such as industrial enzymes, vitamins, functional sugar, health-care products, prodrugs and the like, and has strong industrial production and application capabilities.

However, since the heterologous protein expressed by b.subtilis 168 is easily degraded by endogenous proteases secreted by itself, the ability to express the heterologous protein using the b.subtilis 168 cell system is limited and only low yields of the desired protein can be produced. Thus, most researchers selected protease deficient strain b.subtilis WB800N as the starting strain. However, b.subtilis WB800N also has some problems such as extremely low transformation efficiency, with neomycin resistance gene, and the like. There is also a significant lag in the development of B.subtilis chassis cells compared to E.coli (Escherichia coli). Therefore, by applying a synthetic biological means, the construction of a B.subtilis chassis cell for knocking out extracellular protease so as to optimize production has important scientific significance and application value.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the recombinant bacillus subtilis which is safe, simpler in operation process and capable of efficiently secreting and expressing pullulanase.

The invention also solves the technical problem of providing a construction method of the recombinant bacillus subtilis.

The invention finally solves the technical problems of providing the application of the recombinant bacillus subtilis in producing the pullulanase by fermentation and the application of the recombinant bacillus subtilis serving as a chassis strain in constructing genetically engineered bacteria for producing the pullulanase by fermentation.

In order to solve the technical problems, the invention adopts the following technical scheme:

a recombinant bacillus subtilis is a chassis strain, which is obtained by taking bacillus subtilis B.S168 delta 2 as an initial strain and over-expressing a pullulanase gene amyX on the basis of constructing a strain for knocking out extracellular protease genes.

Wherein, the bacillus subtilis B.S168 delta 2 is an improved strain of bacillus subtilis B.subtilis 168, namely, two protease genes htrC and aprX are knocked out on the basis of an original strain. .

Specifically, the nucleotide sequences of the protease genes htrC and aprX are shown as SEQ ID NO.17 and SEQ ID NO. 19, and the corresponding amino acid sequences are shown as SEQ ID NO.18 and SEQ ID NO. 20.

Wherein the extracellular protease gene is any one or the combination of a plurality of aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA.

Preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE and nprB, or aprE, epr, bpr, mpr, nprE, nprB and vpr, or aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA.

Most preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE, nprB and vpr.

Specifically, the nucleotide sequences of the extracellular protease genes aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA are shown as SEQ ID NO.1, 3,5, 7, 9, 11, 13 and 15, and the corresponding amino acid sequences are shown as SEQ ID NO.2, 4, 6, 8, 10, 12, 14 and 16.

Wherein, the pullulanase gene amyX is derived from bacillus subtilis 168, the nucleotide sequence of which is shown as SEQ ID NO.21, and the corresponding amino acid sequence is shown as SEQ ID NO. 22.

The construction method of the recombinant bacillus subtilis comprises the following steps:

(1) Construction of the starting strain b.s168 Δ2: obtaining an initial strain B.S168 delta 2 by knocking out protease genes htrC and aprX of bacillus subtilis B.subilis 168;

(2) Construction of extracellular protease gene knockout strains: obtaining an extracellular protease gene knockout strain by iteratively knocking out extracellular protease genes of an original strain B.S168 delta 2;

(3) Overexpression of the pullulanase gene amyX: and (3) over-expressing the pullulanase gene amyX of the extracellular protease gene knockout strain obtained in the step (1), and constructing a bacillus subtilis expressed pullulanase chassis strain, namely recombinant bacillus subtilis.

Wherein, in the step (2) and the step (3), the extracellular protease gene-knocked-out strain is any one of B.S168 delta 3, B.S168 delta 4, B.S168 delta 5, B.S168 delta 6, B.S168 delta 7, B.S168 delta 8, B.S168 delta 9 and B.S168 delta 10.

Preferably, the extracellular protease gene-knock-out strain is any one of b.s168 Δ8, b.s168 Δ9 and b.s168 Δ10.

More preferably, the extracellular protease gene-knock-out strain is b.s168.DELTA.9.

Specifically, the gene knocked out by the knockout strain B.S168 delta 8 is as follows: htrC, aprX, aprE, epr, bpr, mpr, nprE and nprB; the gene knocked out by the knockout strain B.S168.DELTA.9 is: htrC, aprX, aprE, epr, bpr, mpr, nprE, nprB and vpr; the gene knocked out by the knockout strain B.S168.DELTA.10 is: htrC, aprX, aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA.

In the step (2), the bacillus subtilis expression pullulanase chassis strain is any one of B.S168 delta 8amyX, B.S168 delta 9amyX and B.S168 delta 10 amyX.

Preferably, the Bacillus subtilis expresses the pullulanase chassis strain B.S168.DELTA.9amyX.

The application of the recombinant bacillus subtilis in the fermentation production of pullulanase is also within the scope of the invention.

Wherein the fermentation medium is any one of a Terrific Broth medium (TB medium), a Super Broth medium (SB medium), a jar fermentation medium (G medium) and a Luria-Bertani medium (LB medium).

Preferably, the fermentation medium is a tank fermentation medium (G medium) having the formula: glutinous rice starch 2g/L, peptone 3g/L, KH ₂ PO ₄ 0.05g/L，MgSO ₄ ·7H ₂ O 0.01g/L，MnSO ₄ ·7H ₂ O 0.01g/L，pH 6.0。

Wherein, the fermentation conditions are as follows: culturing at 35℃and 160rpm for 2-5d.

The result of the enzyme activity verification and detection of the pullulanase shows that the enzyme activity of the modified strain B.S168 delta 9amyX after being fermented by the G culture medium reaches the maximum of 18U/mL, and compared with the original strain B.S168 under the same fermentation condition, the enzyme activity of the modified strain B.S168amyX is improved by 89 times and is 1.2 times of the enzyme activity of the modified strain B.S168amyX after being fermented. The modified strain B.S168 delta 9amyX has great improvement on the yield of the original pullulanase.

The application of the recombinant bacillus subtilis serving as the chassis strain in constructing genetically engineered bacteria for fermenting and producing pullulanase is also within the scope of the invention.

The beneficial effects are that:

1. the invention utilizes CRISPR/cas9 non-resistance residue knockout gene technology, constructs 8 kinds of iterative chassis cells for knocking out eight kinds of extracellular protease genes on the basis of knocking out 2 kinds of protease of original strain B.S168, can rapidly select the chassis cells optimally expressing pullulanase, and eliminates the problem of the extracellular protease of bacillus subtilis on the secreted target protein hydrolysis. The transformed chassis cells have the advantages of high transformation efficiency, no resistance gene residue, almost no extracellular protease, no influence on extracellular target protein accumulation and the like, and have important scientific significance and application value for the later optimized production.

2. The recombinant strain B.S168 delta 9amyX is used as a chassis cell for producing the pullulanase, and the enzyme activity of the pullulanase is far higher than that of the original strain under the same fermentation condition.

Drawings

The foregoing and/or other advantages of the invention will become more apparent from the following detailed description of the invention when taken in conjunction with the accompanying drawings and detailed description.

Fig. 1: iterative knockdown of nucleic acid electrophoretogram of 10 protease genes. a) The htrC protease gene verification graph is knocked out by the original strain, the size of a PCR verification fragment after successful knocking out is 2065bp, and the strain is named as B.S168 delta 1. b) The gene verification diagram of the aprX protease is knocked out, the size of a PCR verification fragment after successful knocking out is 2078bp, and the strain is named as B.S168 delta 2. c) The gene verification diagram of the aprE extracellular protease is knocked out, the size of a PCR verification fragment after successful knocking out is 2066bp, and the strain is named as B.S168 delta 3. d) The size of PCR verification fragment after the successful knockout is 2081bp, and the strain is named as B.S168 delta 4. e) The gene verification diagram of the extracellular protease of the knockout bpr shows that the size of a PCR verification fragment is 2074bp after the knockout is successful, and the strain is named as B.S168 delta 5. f) The verification diagram of the gene of the mpr extracellular protease is knocked out, the size of a PCR verification fragment after successful knockout is 2076bp, and the strain is named as B.S168 delta 6. g) The size of the PCR verification fragment after the successful knockout is 2072bp, and the strain is named as B.S168 delta 7. h) The size of PCR verification fragment after successful knockout is 2064bp, and the strain is named as B.S168 delta 8. r) knockout vpr extracellular protease gene verification diagram, wherein the size of PCR verification fragment after successful knockout is 2159bp, and the strain is named as B.S168 delta 9. j) The size of PCR verification fragment after successful knockout is 2070bp, and the strain is named as B.S168 delta 10.

Fig. 2: 12% gelatin plate liquefaction experiments of the starting strain 168 Δ2 and 8 engineered strains b.s168 Δ3, b.s168 Δ4, b.s168 Δ5, b.s168 Δ6, b.s168 Δ7, b.s168 Δ8, b.s168 Δ9, b.s168 Δ10.

Fig. 3: the enzyme activity of pullulan was verified by 1% pullulan plates.

Fig. 4: reducing sugar standard curve under DNS-Ghose method.

Fig. 5: strains b.s168, b.s168+amyx, b.s168.DELTA.9amyx enzyme activities.

Detailed Description

The experimental methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials, unless otherwise specified, are commercially available.

In the examples described below, bacillus subtilis 168 was purchased from Wohan vast Ling biosciences, inc., and the Terrific Broth medium (TB medium), super Broth medium (SB medium) and Luria-Bertani medium (LB medium) were purchased from Beijing Soy Hill Biotech, inc., and the plasmids pJOE8999 and pBE2R were purchased from Wohan vast Ling biosciences, inc.

Example 1: construction of 10 protease CRISPR/cas9 knockout plasmids

The upper homologous arm fragments and the lower homologous arm fragments are respectively amplified by PCR with primers X up-F and X up-R by taking a bacillus subtilis 168 genome as a template to obtain upper homologous arm fragments of 10 proteases, the lengths of the upper homologous arm fragments are 1040bp, and the primers X down-F and X down-R are respectively amplified by PCR to obtain lower homologous arm fragments of 10 proteases, the lengths of the lower homologous arm fragments are 1040bp. The pJOE8999 plasmid is used as a template, and primers X N-F and X N-R are used for PCR to obtain N20 fragments of 10 proteases, wherein the lengths of the N20 fragments are 269bp.

The PCR products are respectively subjected to gel recovery treatment by using a Takara gel recovery kit (Code No. 9762) to obtain three fragment products, the three fragments are used as templates, and primers X N-F2 and X down-R are used for obtaining the connecting products of the three fragments in a Cross-over PCR mode, wherein the connecting products are respectively htrC striking plate, aprX striking plate, aprE striking plate, epr striking plate, nprE striking plate, bpr striking plate, mpr striking plate, nprB striking plate, vpr striking plate and wprA striking plate, and the lengths of the three fragments are 2289bp. The 5 'end of the knockout piece is provided with a homologous sequence actgttgggaagggcgatcg at the enzyme cutting site PvuI in the plasmid pJOE8999, and the 3' end of the knockout piece is provided with a homologous sequence Tctagattaagaaataatct at the enzyme cutting site and XbaI in the plasmid pJOE8999, so that the plasmid pJOE8999 can be cloned by a NoruI kit (C112) and the knockout piece in one step after being subjected to double enzyme cutting by the PvuI and the XbaI.

The primers required for constructing the htrC and aprX protease and aprE, epr, nprE, bpr, mpr, nprB, vpr, wprA extracellular protease CRISPR/cas9 knockout plasmid are shown in the following table 1, wherein X represents any one of 10 proteases.

Wherein, the nucleotide sequences of the extracellular protease genes aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA are shown in SEQ ID NO.1, 3,5, 7, 9, 11, 13 and 15, and the corresponding amino acid sequences are shown in SEQ ID NO.2, 4, 6, 8, 10, 12, 14 and 16; the nucleotide sequences of the protease genes htrC and aprX are shown as SEQ ID NO.17 and 19, and the corresponding amino acid sequences are shown as SEQ ID NO.18 and 20.

TABLE 1 primers required for construction of 10 protease CRISPR/cas9 knockout plasmids

Wherein, the system of upper and lower homology arm PCR is as follows:

(1) Reaction system for PCR amplification: buffer 25. Mu.l, dNTPs 10. Mu.l, primer F1.5. Mu.l, primer R1.5. Mu.l, template 1. Mu.l, ddH ₂ 0.19. Mu.l of the total system was 50. Mu.l.

(2) The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 94℃for 30sec, annealing at 54℃for 30sec, elongation at 60℃for 1.5min,30 cycles; extending at 72deg.C for 10min, and preserving at 4deg.C.

Wherein, the system of Cross-over PCR is as follows:

(1) The reaction system for PCR amplification is as follows: buffer 25. Mu.l, dNTPs 10. Mu.l, primer X N20-F2.5. Mu.l, primer X Down-R1.5. Mu.l, three fragments 1. Mu.l, ddH respectively ₂ 0.17. Mu.l of the total system was 50. Mu.l.

(2) The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 94℃for 30sec, annealing at 54℃for 30sec, extension at 60℃for 3min,30 cycles; extending at 72deg.C for 10min, and preserving at 4deg.C.

The Cross-over PCR product and the plasmid pJOE8999 subjected to double digestion by PvuI and XbaI are subjected to one-step cloning by using a Northey kit (C112), and finally 10 protease knockout plasmids pJOE8999+htrC, pJOE8999+aprX, pJOE8999+aprE, pJOE8999+epr, pJOE8999+nprE, pJOE8999+bpr, pJOE8999+mpr, pJOE8999+nprB, pJOE8999+vpr and pJOE8999+wprA are successfully constructed.

Example 2: construction of Bacillus subtilis chassis Strain

1. Construction of initial cell Bacillus subtilis 168 delta 2

(1) Preparation of Bacillus subtilis 168 competent

a. Inorganic salt mother liquor: 40g/L anhydrous dipotassium hydrogen phosphate, 20g/L anhydrous potassium dihydrogen phosphate, 10g/L ammonium sulfate, 20g/L trisodium citrate dihydrate and 1g/L magnesium sulfate heptahydrate. Sterilizing at 121deg.C for 15min.

Gmi solution: 10mL of inorganic salt mother solution, 4mL of 20% glucose, 1mL of 5% casein hydrolysate, 3mL of 10% yeast extract and distilled water to reach a constant volume of 100mL. Sterilizing at 115deg.C for 20min, and sterilizing each component independently.

Gmii solution: 10mL of inorganic salt mother solution, 4mL of 20% glucose, 0.5mL of 5% casein, 2mL of 10% yeast extract, 1mL of 1M magnesium chloride, 1mL of 1M calcium chloride and distilled water to a volume of 100mL. The components are sterilized separately.

d. The activated bacillus subtilis 168 single colonies were inoculated into shake tubes of 5mL GMI solution and cultured at 30 ℃ at 125rpm overnight for 16 h.

e. 2mL of GMI solution was inoculated into 18mL of fresh GMI solution and incubated for 3.5h (37 ℃ C., 200 rpm). 10mL of the seed solution was inoculated into 90mL of GMII culture solution and cultured at 37℃and 200rpm for 90min.

The cells were collected by centrifugation at f.4 ℃for 10min, and 10mL of the liquid was retained for resuspension of the bacterial liquid. 500 mu L of the mixture is divided into 1 tube and stored in a refrigerator at the temperature of minus 80 ℃.

(2) 2 protease knockout plasmid introduced into bacillus subtilis 168

a. The constructed 2 protease knockout plasmids were extracted using the AxyPrep plasmid DNA miniprep kit.

b. The bacillus subtilis 168 was taken out and competent at 45℃for 3-5min in a water bath, 1. Mu.g of htrC protease was added to knock out plasmid DNA, incubated at 37℃for 90min, spread on LB plates of 5. Mu.g/mL Kan, and incubated at 30℃for 18h.

c. Single spots on the plates were picked, streaked on LB plates, incubated in an incubator at 48℃for 12h, and colony PCR verified with the verification primers.

d. The correct transformants were picked up by colony PCR, shake-cultured at 48℃and 200rpm for 12 hours, streaked on LB plates with an inoculating loop, and cultured in an incubator at 37℃for 12 hours.

e. Single spots were picked, streaked onto LB plates, incubated for 12h at 37℃in an incubator, and colony PCR verified with verification primers (Table 2).

f. The colony PCR-corrected transformant was cultured overnight at 37℃to obtain a modified bacterium B.S168.DELTA.1 (knockout gene htrC) by adding 800. Mu.l of the bacterial liquid to 800. Mu.l of 40% glycerol and storing in a sterile tube.

g. The modified strain B.S168.DELTA.1 is prepared into competence, the aprX gene knockout plasmid is introduced, and the knockout process is the same as the operation, so that the modified strain B.S168.DELTA.2 (knockout genes htrC and aprX) is obtained.

2. Preparation of Bacillus subtilis 168 delta 2 competent

(1) Inorganic salt mother liquor: 40g/L anhydrous dipotassium hydrogen phosphate, 20g/L anhydrous potassium dihydrogen phosphate, 10g/L ammonium sulfate, 20g/L trisodium citrate dihydrate and 1g/L magnesium sulfate heptahydrate. Sterilizing at 121deg.C for 15min.

(2) GMI solution: 10mL of inorganic salt mother solution, 4mL of 20% glucose, 1mL of 5% casein hydrolysate, 3mL of 10% yeast extract and distilled water to reach a constant volume of 100mL. Sterilizing at 115deg.C for 20min, and sterilizing each component independently.

(3) GMII solution: 10mL of inorganic salt mother solution, 4mL of 20% glucose, 0.5mL of 5% casein, 2mL of 10% yeast extract, 1mL of 1M magnesium chloride, 1mL of 1M calcium chloride and distilled water to a volume of 100mL. The components are sterilized separately.

(4) Activated bacillus subtilis 168.DELTA.2 single colonies were inoculated into shake tubes of 5mL of GMI solution and cultured at 30℃overnight at 125rpm for 16 h.

(5) 2mL of GMI solution was inoculated into 18mL of fresh GMI solution and incubated for 3.5h (37 ℃ C., 200 rpm). 10mL of the seed solution was inoculated into 90mL of GMII culture solution and cultured at 37℃and 200rpm for 90min.

(6) The cells were collected by centrifugation at 4℃for 10min, and 10mL of the liquid was retained for resuspension of the bacterial liquid. 500 mu L of the mixture is divided into 1 tube and stored in a refrigerator at the temperature of minus 80 ℃.

2. 8 extracellular protease knockout plasmids were introduced into Bacillus subtilis 168.DELTA.2

(1) The constructed 8 extracellular protease knockout plasmids were extracted using the AxyPrep plasmid DNA miniprep kit.

(2) The bacillus subtilis 168 delta 2 is taken out, competent in 45 ℃ and water bath is carried out for 3-5min, 1 mug of first extracellular protease is added to knock out plasmid DNA, the mixture is cultured for 90min at 37 ℃, the mixture is coated on an LB plate of 5 mug/mL Kan, and the mixture is cultured for 18h at 30 ℃.

(3) Single spots on the plates were picked, streaked on LB plates, incubated in an incubator at 48℃for 12h, and colony PCR verified with the verification primers.

(4) The correct transformants were picked up by colony PCR, shake-cultured at 48℃and 200rpm for 12 hours, streaked on LB plates with an inoculating loop, and cultured in an incubator at 37℃for 12 hours.

(5) Single spots were picked, streaked onto LB plates, incubated for 12h at 37℃in an incubator, and colony PCR verified with verification primers (Table 2).

(6) The transformant with the correct colony PCR was cultured overnight at 37℃to obtain a modified bacterium B.S168.DELTA.3 (knockout gene htrC, aprX, aprE) by adding 800. Mu.l of the bacterial liquid to 800. Mu.l of 40% glycerol and storing in a sterile tube.

(7) The modified strain B.S168.DELTA.3 was prepared to be competent, and then second to eight extracellular protease knockout plasmids were introduced in sequence, and the above-described operations were repeated, to finally obtain modified strains B.S168.DELTA.4 (knockout gene htrC, aprX, aprE, epr), B.S168.DELTA.5 (knockout gene htrC, aprX, aprE, epr, nprE), B.S168.DELTA.6 (knockout gene htrC, aprX, aprE, epr, nprE, bpr), B.S168.DELTA.7 (knockout gene htrC, aprX, aprE, epr, nprE, bpr, mpr), B.S168.DELTA.8 (knockout gene htrC, aprX, aprE, epr, nprE, bpr, mpr, nprB), B.S168.DELTA.9 (knockout gene htrC, aprX, aprE, epr, nprE, bpr, mpr, nprB, vpr), and B.S168.DELTA.10 (knockout gene htrC, aprX, aprE, epr, nprE, bpr, mpr, nprB, vpr, wprA) (FIG. 1).

TABLE 2 verification primers required for verifying construction of 10 protease knockout strains

Example 3: gelatin plate liquefaction experiment of original strain bacillus subtilis 168 delta 2 and 8 modified strains

The original strain bacillus subtilis 168 delta 2 (B.S168 delta 2) and 8 modified strains (B.S168 delta 3, B.S168 delta 4, B.S168 delta 5, B.S168 delta 6B.S168 delta 7, B.S168 delta 8, B.S168 delta 9 and B.S168 delta 10) are respectively cultivated in LB liquid culture medium under the culture condition of 37 ℃ and 200rpm for overnight; 50 μl of each bacterial liquid is coated on a 12% gelatin LB solid medium plate, and the sealing film sealing plate is placed in an incubator and cultured for 36h at 25 ℃.

Taking out the cultured flat plate, putting the flat plate into a refrigerator at 4 ℃ for 30min, and taking out and observing the flat plate. When extracellular protease was present, the 12% gelatin LB solid medium plate would be in a liquefied state. As a result, as shown in FIG. 2, the starting strain B.S168.DELTA.2 grew in the 12% gelatin LB solid medium plate, and the liquefaction was the weakest starting from B.S168.DELTA.8, including B.S168.DELTA.9 and B.S168.DELTA.10, with little liquefaction. The following examples screen for the three engineered strains, B.S168.DELTA.8, B.S168.DELTA.9, and B.S168.DELTA.10, since the amounts of extracellular proteases were extremely small and the secreted target protein was not hydrolyzed.

Example 4: construction and screening of bacillus subtilis expressed pullulanase chassis strain

1. Construction of Bacillus subtilis expression pullulanase chassis strain

(1) The expression plasmid pBE2RB+amyX is constructed by using the pullulanase gene amyX from bacillus subtilis 168, the plasmid pBE2RB is constructed by the laboratory according to the purchased pBE2R plasmid, 432bp of Apr sp in the original plasmid is removed, and the plasmid is replaced by BamHI enzyme cutting sites. The primer is shown in Table 3, the nucleotide sequence of the pullulanase gene amyX is shown in SEQ ID NO.21, and the corresponding amino acid sequence is shown in SEQ ID NO. 22.

TABLE 3 construction of primers for expression plasmid pBE2RB+amyX

(2) The genome of bacillus subtilis 168 is used as a template, pBE2RB+amyX-F and pBE2RB+amyX-R are used as PCR upper and lower primers, a pullulanase gene amyX fragment is obtained, the size of the fragment is 2214bp, homologous sequences at the position of the plasmid pBE2RB cut by BamHI are AGAGGAATGTACACGGATCC and GGATCCGGTTATGTATTAAT respectively at the upstream and downstream of the fragment, and the plasmid pBE2RB can be cloned in one step by using a Norpraise kit (C112) and a PCR fragment after being cut by BamHI, so that the finally successfully constructed expression plasmid pBE2RB+amyX is obtained.

(3) The constructed pBE2RB+amyX expression plasmid was extracted using the AxyPrep plasmid DNA minikit.

(4) The original strain B.S168 and the modified strain B.S168.DELTA.8, B.S168.DELTA.9 and B.S168.DELTA.10 were taken out, and were competent at 45℃for 3-5min in a water bath, 1. Mu.g of pBE2RB+amyX expression plasmid DNA was added, and incubated at 37℃for 90min, spread on LB plates of 5. Mu.g/mL Kan, and incubated at 37℃for 12h.

(5) Single spots on the plates were picked, streaked onto LB plates of 5. Mu.g/mL Kan, incubated for 12h at 37℃in an incubator, and colony PCR verified with verification primers (Table 4).

(6) The colony PCR-correct transformants were picked, shake-cultured at 37℃and 200rpm for 12 hours, streaked on LB plates of 5. Mu.g/mL Kan with an inoculating loop, and cultured in an incubator at 37℃for 12 hours.

(7) Single spots were picked, streaked onto LB plates of 5. Mu.g/mL Kan, incubated in an incubator at 37℃for 12h, and colony PCR verified with verification primers (Table 4).

(8) The colony PCR-correct transformants were cultured overnight at 37℃and 800. Mu.l of the bacterial liquid was taken and stored in a sterile tube together with 800. Mu.l of 40% glycerol.

TABLE 4 expression plasmid pBE2RB+amyX introduction of Bacillus subtilis validation primers

Primer(s)	Sequence(s)
		YpBE2R-F	TAGCGGTACCATTATAGGTAAGAGAGGAATGTAC
YpBE2R-R	GCTTGTACATATTGTCGTTAGAACGCG

2. Screening of Bacillus subtilis expression pullulanase chassis strains

(1) Strain culture: five engineered strains B.S168amyX, B.S 168. DELTA.8 amyX, B.S 168. DELTA.9 amyX, B.S 168. DELTA.10 amyX and E.coli (BL 21) amyX (laboratory save strain) were cultured in Kan-resistant LB liquid medium containing 5. Mu.g/mL, and the original strain B.S168 was cultured in non-resistant LB medium at 37℃at 200rpm overnight; 10 μl of each bacterial liquid is taken and placed on a non-resistant 1% pullulan plate, air-dried in an ultra-clean bench, and the sealing film sealing plate is inverted in an incubator for culturing at 37 ℃ for 36h.

(2) Verifying optimal chassis cells: after the completion of the cultivation, 10mL of 100% ethanol was poured onto the surface of the plate on which the colonies were grown, and after standing for 30 minutes, a clear transparent ring was observed, and the transparent ring of the B.S168.DELTA.9 amyX strain was the largest, as shown in FIG. 3 (a). After scraping the bacterial sludge and observing it, the residual amount of Fang Pulu blue polysaccharide under the bacterial sludge was seen, with minimal white precipitation of the B.S1688amyX strain, followed by the B.S168.DELTA.9 amyX strain, as shown in FIG. 3 (b). Pullulan can be specifically hydrolyzed by pullulanase, and pullulan can combine with ethanol to form a white precipitate. From FIG. 3 (a), it can be seen that the transparent circle of the B.S168.DELTA.9 amyX strain is the largest, i.e., pullulan around the colony is hydrolyzed in a large amount, and it can be considered that the B.S168.DELTA.9 amyX strain secretes the largest amount of pullulanase and the highest enzymatic activity. As can be seen from a review of fig. 3 (b) after scraping the bacterial sludge, the white precipitate under the colony of the engineered strain b.s1688amyx was minimal, followed by strain b.s168 Δ9amyx, probably due to the fact that strain b.s1688amyx was not knocked out of extracellular protease had better ability to penetrate the plates, resulting in substantial hydrolysis of the colony down Fang Pulu blue polysaccharide by pullulanase. Enough pullulanase can be expressed for the strain B.S1688amyX, but the expressed pullulanase cannot be effectively secreted outside cells, contrary to the patent of the invention, the characterization experimental result of the transparent ring is combined, and finally the modified strain B.S168 delta 9amyX is selected as the optimal strain for secreting and expressing the pullulanase.

(3) Culture medium for fermentation verification of optimal chassis cells:

the seed culture medium comprises the following components: peptone 3g/L, KH ₂ PO ₄ 0.5g/L，MgSO ₄ ·7H ₂ O 0.02g/L，MnSO ₄ ·7H ₂ O0.01 g/L, and the initial pH of the culture medium is 6.0.

Fermentation media are divided into four categories, the first category being Terrific broth (TB medium), the components being: 1.2g/L of casein hydrolysate, 2.4g/L of yeast powder, 1.254g/L of dipotassium hydrogen phosphate, 0.231g/L of potassium dihydrogen phosphate and 5mL/L of glycerol; the second type is Super Broth medium (SB medium), which consists of: 1.2g/L casein hydrolysate, 2.4g/L yeast powder and 0.5g/L sodium chloride; the third category is self-contained pot fermentation medium (G medium), which comprises the following components: glutinous rice starch 2g/L, peptone 3g/L, KH ₂ PO ₄ 0.05g/L，MgSO ₄ ·7H ₂ O 0.01g/L，MnSO ₄ ·7H ₂ O0.01 g/L, and the initial pH value of the culture medium is 6.0; the fourth type of medium is Luria-Bertani medium (LB medium), which comprises the following components: 1g/L peptone, 0.5g/L yeast powder and 1g/L sodium chloride.

(4) Performing optimal chassis cell fermentation verification; the free fermentation was performed with the optimal strain b.s168.DELTA.9 amyX for secretion of pullulanase, the b.s168 and b.s1688amyX strains as control strains. Strain B.S168 was activated in LB liquid medium, B.S168amyX, B.S168.DELTA.9 amyX in Kan-resistant LB liquid medium containing 5. Mu.g/mL, at 37℃for 12h, a small amount of bacterial liquid was dipped with an inoculating loop and three-fold lines on Kan-resistant LB solid medium containing 5. Mu.g/mL, and placed in an incubator at 37℃for 12h. Single colonies were picked and activated in Kan-resistant LB liquid medium containing 5. Mu.g/mL at 37℃for 18h. Seed culture is carried out in a 250mL triangular flask filled with 50mL of seed culture medium according to the inoculum size of 1% v/v, the culture is carried out for 12h at 37 ℃, then fermentation culture is carried out in a 250mL triangular flask filled with 50mL of four different fermentation culture mediums according to the inoculum size of 2% v/v, the culture is carried out for 2-5d at 35 ℃ and 160rpm, and the supernatant obtained by centrifuging the fermentation broth at 4 ℃ and 8000r/min for 10min is the crude enzyme solution. The enzyme activity was verified by making a reducing sugar standard curve by the DNS-Ghose method, as shown in FIG. 4. The enzyme activity of the modified strain B.S168 delta 9amyX after fermentation by the G medium reaches the maximum of 18U/mL, which is 89 times higher than that of the original strain B.S168 under the same fermentation condition and 1.2 times higher than that of the strain B.S168amyX after fermentation (figure 5). The modified strain B.S168 delta 9amyX has great improvement on the yield of the original pullulanase.

The step of manufacturing a reducing sugar standard curve by the DNS-Ghose method is as follows:

dissolving 50g of sodium hydroxide in a proper amount of distilled water, fully dissolving, cooling to room temperature, transferring into a 500mL volumetric flask, and fixing the volume with distilled water to obtain 10% sodium hydroxide solution; 6.9g of sodium sulfite is added into 15.2mL of 10% sodium hydroxide solution, and the mixture is fully dissolved, thus obtaining the first solution. Weighing 10g of 3, 5-dinitrosalicylic acid, dissolving in a proper amount of distilled water, and transferring into a 1000mL volumetric flask to fix the volume, namely, 1% (w/v) of 3, 5-dinitrosalicylic acid solution; 255g of potassium sodium tartrate is added into 300mL of prepared 10% sodium hydroxide solution to be fully dissolved; after dissolution, 880mL of the prepared 1% 3, 5-dinitrosalicylic acid solution is added, and the mixture is fully and uniformly mixed to obtain solution B. Mixing solution A and solution B thoroughly, and storing in brown bottle for 7-10 days.

Glucose standard preparation: 10mg of anhydrous glucose was weighed and dissolved in 1mL of pure water to obtain 10mg/mL of glucose mother liquor, and specific gradient dilution is shown in Table 5 below.

TABLE 5 specific dilution gradient for glucose Standard formulation

Sequence number	Concentration before dilution (mg/mL)	Volume of standard solution (μL)	Pure water volume (mu L)	Concentration after dilution (mg/mL)
					1	10	100	900	1
2	1	500	500	0.5
					3	0.5	400	600	0.2
4	0.2	500	500	0.1
					5	0.1	500	500	0.05

Preparing 3 clean 8-tube PCR tubes, respectively adding 40 μl of glucose series standard solution with serial numbers of 1-5 into corresponding numbered PAdding 60 mu L of DNS reagent into the CR small tube, and placing the mixture into a PCR instrument for incubation for 10min at 99.9 ℃; rapidly cooling to 4 ℃ after the incubation is finished, adding 100 mu L of deionized water into each tube, fully mixing uniformly, adding 100 mu L of deionized water into a 96-well plate, and measuring the absorbance at 540 nm; the standard solutions of each number were measured in triplicate and averaged for standard curve drawing. The spectrophotometry value of the glucose standard solution is taken as an abscissa, the glucose concentration is taken as an ordinate, and a standard curve is drawn, as shown in fig. 4, wherein the standard curve formula is y= 0.9404x-0.0012, and R is as follows ² ＝1。

Wherein, the enzyme activity of the pullulanase is specifically defined as follows: the amount of enzyme that produces 1. Mu. Mol of reducing sugar per unit time at the optimum temperature is defined as one unit of enzyme activity.

The detection method of the pullulanase enzyme activity comprises the following steps: pullulan was dissolved in acetic acid-sodium acetate buffer at ph=4.5 to prepare a pullulan substrate at a final concentration of 1%. Adding 20 mu L of 1% pullulan substrate into 20 mu L of crude enzyme solution, reacting for 10min at 40 ℃ in a PCR instrument, rapidly adding 60 mu L of DNS reagent, and incubating for 10min at 99.9 ℃ in the PCR instrument; and after the incubation is finished, rapidly cooling to 4 ℃, adding 100 mu L of deionized water into each tube, fully and uniformly mixing, taking 100 mu L of deionized water, adding into a 96-well plate, measuring the absorbance value of the mixture at 540nm, wherein each sample needs blank control, each sample needs to be parallel to three, and carrying the difference between the sample and the control into a standard curve to convert so as to obtain the enzyme activity corresponding to each sample.

In conclusion, the invention utilizes CRISPR/cas9 technology to knock out genes htrC and aprX on the basis of an original strain B.S168 to construct an original strain B.S168 delta 2, then on the basis of the original strain B.S168 delta 2, eight chassis cells B.S168 delta 3, B.S168 delta 4, B.S168 delta 5, B.S168 delta 6, B.S168 delta 7, B.S168 delta 8, B.S168 delta 9 and B.S168 delta 10 which are most suitable for secreting and expressing pullulanase are constructed, and compared with the enzyme activity of the original strain B.S168, the constructed recombinant strain B.S168 delta 9amyX is obviously improved.

The invention provides a recombinant bacillus subtilis, a construction method and an application thought and method thereof, and a method for realizing the technical scheme is a plurality of methods and approaches, the above is only a preferred embodiment of the invention, and it should be pointed out that a plurality of improvements and modifications can be made by one of ordinary skill in the art without departing from the principle of the invention, and the improvements and modifications are also considered as the protection scope of the invention. The components not explicitly described in this embodiment can be implemented by using the prior art.

Claims

1. The recombinant bacillus subtilis is characterized in that the recombinant bacillus subtilis is obtained by taking bacillus subtilis B.S168 delta 2 as an initial strain and over-expressing a pullulanase gene amyX on the basis of constructing a strain for knocking out extracellular protease genes.

2. The recombinant bacillus subtilis according to claim 1, wherein b.s168 Δ2 is an engineered strain of bacillus subtilis b.subilis 168, in which two protease genes htrC and aprX are knocked out on the basis of the original strain.

3. The recombinant bacillus subtilis according to claim 1, wherein the extracellular protease gene is any one or a combination of a plurality of aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA; preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE and nprB, or aprE, epr, bpr, mpr, nprE, nprB and vpr, or aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA; most preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE, nprB and vpr.

4. The recombinant bacillus subtilis according to claim 3, wherein the extracellular protease genes aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA have nucleotide sequences shown in SEQ ID nos. 1, 3,5, 7, 9, 11, 13 and 15 and corresponding amino acid sequences shown in SEQ ID nos. 2, 4, 6, 8, 10, 12, 14 and 16.

5. The recombinant bacillus subtilis according to claim 1, wherein the pullulanase gene amyX is derived from bacillus subtilis 168, the nucleotide sequence of which is shown in SEQ ID No.21, and the corresponding amino acid sequence of which is shown in SEQ ID No. 22.

6. The method for constructing a recombinant bacillus subtilis according to any one of claims 1 to 5, comprising the steps of:

(3) Overexpression of the pullulanase gene amyX: and (3) over-expressing the pullulanase gene amyX of the extracellular protease gene knockout strain obtained in the step (2), and constructing a bacillus subtilis expressed pullulanase chassis strain, namely recombinant bacillus subtilis.

7. Use of the recombinant bacillus subtilis of any one of claims 1-5 in fermentation to produce pullulanase.

8. The use according to claim 7, wherein the fermentation medium is any one of Terrific Broth, super Broth, pot fermentation medium and Luria-Bertani medium; preferably, the fermentation medium is a pot fermentation medium, and the formula is as follows: glutinous rice starch 2g/L, peptone 3g/L, KH ₂ PO ₄ 0.05g/L，MgSO ₄ ·7H ₂ O 0.01g/L，MnSO ₄ ·7H ₂ O 0.01g/L，pH 6.0。

9. The use according to claim 7, wherein the fermentation is performed under the following conditions: culturing at 35℃and 160rpm for 2-5d.

10. Use of the recombinant bacillus subtilis according to any one of claims 1-5 as a chassis strain in the construction of genetically engineered bacteria for the fermentative production of pullulanase.