CN116615460A - Beta-ghost protein (SPTBN 1) deficiency protects mice from high fat diet-induced liver disease and cancer progression - Google Patents

Abstract

The present disclosure provides methods of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, comprising administering a therapeutically effective amount of at least one siRNA molecule targeting SPTBN 1.

Description

Beta-ghost protein (SPTBN 1) deficiency protects mice from high fat diet-induced liver disease and cancer progression

Government support

The present invention was completed with government support under U01 CA230690R 01M 023146 awarded by the national institute of health. The government has certain rights in this invention.

Reference to an electronically submitted sequence Listing

The contents of the electronically submitted sequence listing (name: 3973_018PC02_seqliping_ST25. Txt; size: 37,736 bytes; and creation date: 2021, 11, 3) in the ASCII text file filed herewith are incorporated by reference in their entirety.

Technical Field

The present disclosure provides methods of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the methods comprising administering a therapeutically effective amount of an siRNA molecule that targets SPTBN 1.

Background

Nonalcoholic related fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) are caused by obesity and metabolic disorders and affect up to one third of the world population (1, 2). These diseases include a range of diseases including lipid accumulation in the liver (steatosis), injury, inflammation, hepatocyte balloon-like changes (cell death) and progressive fibrosis (cirrhosis), ultimately leading to carcinogenesis (3, 4). Lipid accumulation in the liver promotes chronic oxidation and Endoplasmic Reticulum (ER) stress, cell death, immune cell infiltration, fibrosis and disease progression. These effects are exacerbated by factors such as increased Free Fatty Acid (FFA) intake, sedentary lifestyle and hyperinsulinemia. Liver cancer incidence can vary between 2.4% (without cirrhosis) to 12.8% (with cirrhosis), depending on whether NASH occurs with or without cirrhosis (1, 3). Obesity doubles the risk of liver cancer death and, together with NASH, leads to a dramatic increase in this cancer (5, 6). Despite new treatments for NASH, there are few single agents that reverse fibrosis and steatosis, and NASH therefore presents major clinical challenges (5, 7). Thus, understanding the molecular mechanisms focused on abnormal lipid accumulation, fibrosis and the fatal shift to liver cancer can find new approaches to NASH in specific populations susceptible to disease progression.

Priming of NAFLD is thought to involve the production of secondary head fat with abnormal accumulation of free fatty acids, triglycerides and cholesterol. Activation of the hepatocyte death receptor pathway, tumor Necrosis Factor (TNF) and caspase results in tissue damage and steatohepatitis observed in NASH (8, 9). De novo adipogenesis is stimulated by activation of transcription factor Sterol Regulatory Element (SRE) binding proteins (SREBPs) and repression of energy sensing pathways such as those involving Adenosine Monophosphate (AMP) activated protein kinase (AMPK). SREBP1 is the major adipogenic transcription factor driving fatty acid synthesis and leading to liver steatosis (10). The SREBP proteins are retained in the endoplasmic reticulum by interaction with the proteins INSIG and SCAP. SREBP activation in response to sterol depletion or ER stress requires dissociation of the INSIG and SCAP-induced cleavage of the SREBP by the site 1 protease (S1P), followed by a second cleavage of the site 2 protease (S2P) to produce the mature form of the SREBP protein, which translocates into the nucleus and regulates target gene transcription (11). In stress-cultured cells with activated caspase-3, SREBP1 and SREBP2 are cleaved and activated by caspase-3, but the physiological background of this process is unknown (12). The cleaved nuclear form is called n-SREBP, and the full length ER-localized form is called precursor SREBP.

The extent of fibrosis is considered to be the strongest predictor of progression of NALFD to NASH and ultimately hepatocellular carcinoma (HC C) (1, 13, 14). Key to liver fibrosis is activation of the transforming growth factor beta (TGF-beta) pathway (15, 16). TGF-. Beta.1 is an initial member of this family, and this ligand signals through the two serine-threonine kinase receptors (TGFBR 2 and TGFBR 1) that activate the SMAD transcriptional regulator. SMAD complexes containing SMAD3 play a key role in fibrosis progression by causing excessive extracellular matrix gene expression, such as those encoding collagen COL1A1, COL1A2, COL3A1, COL5A2, COL6A1 and COL6A3, and stimulating genes encoding the protease inhibitors metalloproteinase Tissue Inhibitor (TIMP) and plasminogen activator inhibitor-1 (PAI-1) (16). The SMAD3 complex also represses the gene encoding peroxisome proliferator activated receptor gamma coactivator 1 alpha (PGC-alpha) (17). The pro-fibrosis of TGF- β1 by SMAD3 involves a variety of mechanisms and cell types including enhanced infiltration or proliferation of tissue resident fibroblasts (or both), myofibroblast production, induction of epithelial-mesenchymal transition (EMT), and inhibition of collagen lysis (18).

SPTBN1 (also known as β2-ghost protein, β2SP) is a multidomain adaptor protein that is functional in the cytoplasm and nucleus (19-21). In particular, SPTBN1 promotes TGF- β receptor activation of SMAD3 in the cytoplasm (22) and interacts with SMAD3 in the nucleus to modulate specific target genes (23, 24). SPTBN1 is a dynamic tetrameric protein consisting of two antiparallel dimers of the alpha and beta subunits. SPTBN1 binding partners include ankyrin, which functions to link proteins on the cell membrane to the cytoskeleton containing gholicus, and laminin, which functions in the nucleus to organize chromatin and regulate gene expression, and the chromatin regulator CTCF (CCCTC binding factor) (19, 23, 25, 26). SPTBN1 is a substrate for caspases 3 and 7, and cleavage at the peptide sequence of SPTBN1 1454DEVD1457 results in two fragments (160 and 80 kDa), with distinct and separate functions in apoptosis and transcription (27). The importance of SPTBN1 in liver disease stems from the discovery that mice treated with shRNA targeting SPTBN1 exhibit less acetaminophen-induced hepatotoxicity (27).

An increase in the amounts of liver SMAD3 and SPTBN1, as well as TGF- β pathway members associated with the pro-fibrotic pathway, was observed in about 40% of HCCs, and many HCCs were associated with NASH (24, 28).

Disclosure of Invention

The present disclosure provides methods of treating a disease, disorder or condition, such as obesity, non-alcohol-related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma, in a subject in need thereof, comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits SPTBN1 expression.

Detailed Description

The role of SPTBN1 in liver tumorigenesis was studied by generating liver-specific SPTBN1 conditional knockout (LSKO) mice. LSKO mice or mice treated with siRNA targeting SPTBN1 were shown to be protected from the deleterious effects of high fat diet by mechanisms involved in reducing expression of pro-fibrotic genes and genes involved in de novo adipogenesis. The mice did not become obese or developed NASH or HCC. The translational importance of the results was confirmed by analyzing the expression of SPTBN1 in human NASH and HCC and finding that siRNA targeting SPTBN1 reversed transcriptional changes in genes involved in fatty acid metabolism and fibrosis induced in human 3D culture models of NASH. Thus, the results identify a previously unknown role of SPTBN1 in modulating caspase-3 induced SREBP activity in response to High Fat Diet (HFD) -induced stress conditions.

In one embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcoholic steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN 1.

In another embodiment, at least one siRNA molecule that inhibits the expression of SPTBN1 comprises 15 to 30 nucleotides.

In another embodiment, at least one siRNA molecule that inhibits the expression of SPTBN1 comprises 15 to 20 nucleotides.

In another embodiment, at least one siRNA molecule that inhibits SPTBN1 expression comprises an overhang region of 1 to 6 nucleotides.

In another embodiment, at least one siRNA molecule that inhibits SPTBN1 expression does not comprise an overhang region.

In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is depicted in SEQ ID No. 7.

In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is depicted in SEQ ID No. 8.

In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is depicted in SEQ ID No. 9.

In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is depicted in SEQ ID No. 10.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 is homologous to at least 10 nucleotides of SEQ ID No. 7. In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is homologous to at least 15 nucleotides of SEQ ID No. 7.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 is homologous to at least 10 nucleotides of SEQ ID No. 8. In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is homologous to at least 15 nucleotides of SEQ ID No. 8.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 is homologous to at least 10 nucleotides of SEQ ID No. 9. In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is homologous to at least 15 nucleotides of SEQ ID No. 9.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 is homologous to at least 10 nucleotides of SEQ ID No. 10. In another embodiment, at least one siRNA molecule that inhibits expression of SPTBN1 is homologous to at least 15 nucleotides of SEQ ID No. 10.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 90% sequence identity to SEQ ID No. 7. In another embodiment, at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 95% sequence identity to SEQ ID No. 7.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 90% sequence identity to SEQ ID No. 8. In another embodiment, at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 95% sequence identity to SEQ ID No. 8.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 90% sequence identity to SEQ ID No. 9. In another embodiment, at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 95% sequence identity to SEQ ID No. 9.

In another embodiment, the present disclosure provides a method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein the at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 90% sequence identity to SEQ ID No. 10. In another embodiment, at least one siRNA molecule that inhibits the expression of SPTBN1 has at least 95% sequence identity to SEQ ID No. 10.

In another embodiment, the present disclosure provides a method for treating obesity in a subject in need thereof. In another embodiment, treating obesity comprises reducing the amount of body fat in the subject and/or reducing the weight of the subject.

In another embodiment, the present disclosure provides a method for treating non-alcohol-related fatty liver disease in a subject in need thereof. In another embodiment, treating a non-alcohol-associated fatty liver disease comprises lowering blood triglycerides in the subject.

In another embodiment, the present disclosure provides a method for treating non-alcoholic steatohepatitis in a subject in need thereof. In another embodiment, treating non-alcoholic steatohepatitis comprises lowering blood triglycerides in the subject.

In another embodiment, the present disclosure provides a method for treating hepatocellular carcinoma in a subject in need thereof. In another embodiment, treating hepatocellular carcinoma comprises reducing tumor mass in a subject.

In another embodiment, one to ten siRNA molecules, such as one to five siRNA molecules, such as one to three siRNA molecules, that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, a siRNA molecule that inhibits the expression of SPTBN1 is administered to a subject. In another embodiment, two siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, three siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, four siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, five siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, six siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, seven siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, eight siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, nine siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject. In another embodiment, ten siRNA molecules that inhibit the expression of SPTBN1 are administered to a subject.

The term "treating" and similar terms as used herein refer to the elimination, alleviation or amelioration of a disease or condition and/or symptoms associated therewith. Although not precluded, treating a disease or condition does not require complete elimination of the disease, condition, or symptoms associated therewith.

The term "therapeutically effective amount" as used herein refers to an amount of a therapeutic agent (e.g., an siRNA molecule that inhibits SPTBN1 expression) sufficient to cause an improvement in one or more symptoms of the disorder, or to prevent the progression of the disorder, or to cause regression of the disorder. For example, with respect to the treatment of cancer, in one embodiment, a therapeutically effective amount will refer to an amount of a therapeutic agent that causes a therapeutic response, such as normalization of blood count, reduction in tumor growth rate, reduction in tumor mass, reduction in the number of metastases, increase in time to tumor progression, and/or increase in time to survival of a subject by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% or more. With respect to the treatment of obesity, in one embodiment, a therapeutically effective amount will refer to an amount of therapeutic agent that results in a reduction in body fat or body weight of a subject of at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% or more. With respect to the treatment of NAFLD or NASH, in one embodiment, a therapeutically effective amount will refer to an amount of therapeutic agent that results in a reduction in blood triglycerides in a subject of at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% or more.

The terms "G", "C", "a", "T" and "U" each generally denote naturally occurring nucleotides containing guanine, cytosine, adenine, thymine and uracil, respectively, as bases. However, it is understood that the term "nucleotide" may also refer to a substituted nucleotide, or a substituted portion thereof, as described in further detail below. The skilled artisan is well aware that guanine, cytosine, adenine and uracil can be substituted with other moieties without substantially altering the base pairing properties of oligonucleotides comprising nucleotides carrying such substituted moieties. For example, but not limited to, a nucleotide containing inosine as its base may be base paired with a nucleotide containing adenine, cytosine, or uracil. Thus, in the nucleotide sequence of the dsRNA characteristic of the invention, the nucleotide containing uracil, guanine or adenine may be substituted with a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide may be substituted with guanine and uracil, respectively, to form G-U Wobble base pairing with the target mRNA. Sequences containing such substituted moieties are suitable for use in the compositions and methods of the features of the present invention.

The terms "nucleobase" and "base" include purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase also includes alternative nucleobases, which may be different from naturally occurring nucleobases, but which function during nucleic acid hybridization. Herein, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymine, uracil, xanthine, and hypoxanthine, as well as alternative nucleobases. Such variants are described, for example, in Hirao et al (2012) Accounts of Chemical Re search, volume 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry suppl.37.1.4.1.

The term "nucleoside" refers to a monomeric unit of an oligonucleotide or polynucleotide having a nucleobase and a sugar moiety. Nucleosides can include those that occur naturally as well as alternative nucleosides, such as those described herein. The nucleobases of nucleosides can be naturally occurring nucleobases or alternative nucleobases. Similarly, the sugar moiety of a nucleoside may be a naturally occurring sugar or an alternative sugar.

The term "substituted nucleoside" refers to nucleosides having a substituted sugar or a substituted nucleobase such as those described herein.

In some embodiments, nucleobase moieties are modified by changing a purine or pyrimidine to a modified purine or pyrimidine, e.g., a substituted purine or substituted pyrimidine, e.g., a "surrogate nucleobase" selected from the group consisting of isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-uridine, 5-bromouridine, 5-thiazolo-uridine, 2-thio-uridine, pseudouridine, 1-methylpseuduridines, 5-methoxyuridine, 2' -thio-thymine, inosine, diaminopurine, 6-aminopurine, 2, 6-diaminopurine, and 2-chloro-6-aminopurine.

The nucleobase moiety can be represented by a letter code, such as A, T, G, C or U, for each respective nucleobase, wherein each letter can optionally include an equivalent functional alternative nucleobase.

"sugar" or "sugar moiety" includes naturally occurring sugars having furanose rings. Sugar also includes "substitute sugar" which is defined as furan capable of substituting nucleosidesSugar ring structure. In certain embodiments, the replacement sugar is a non-furanose (or 4' -substituted furanose) ring or ring system or an open system. Such structures include simple changes relative to the native furanose ring (such as six-membered rings), or may be more complex, as in the case of non-circular systems used in peptide nucleic acids. Replacement sugars may also include sugar substitutes in which the furanose ring has been replaced with another ring system (such as, for example, a morpholino or hexitol ring system). Sugar moieties useful in preparing oligonucleotides having motifs include, but are not limited to, beta-D-ribose, beta-D-2 '-deoxyribose, substituted sugars (such as 2', 5 'and disubstituted sugars), 4' -S-sugars (such as 4 '-S-ribose, 4' -S-2 '-deoxyribose and 4' -S-2 '-substituted ribose), bicyclic substituted sugars (such as 2' -O-CH) ₂ -4 'or 2' -O- (CH) ₂ ) ₂ -4' bridged ribose-derived bicyclic sugar) and sugar substitutes (such as when the ribose ring has been replaced with a morpholino or hexitol ring system). The type of heterocyclic base and internucleoside linkages used at each position are variable and are not factors in determining the motif. In most nucleosides with alternative sugar moieties, heterocyclic nucleobases are typically maintained to allow hybridization.

"nucleotide" as used herein refers to a monomeric unit comprising a nucleoside and an internucleoside-linked oligonucleotide or polynucleotide. Internucleoside linkages may or may not include phosphate linkages. Similarly, the "linked nucleosides" may or may not be linked by phosphate linkages. Many "alternative internucleoside linkages" are known in the art, including but not limited to phosphate, phosphorothioate and borophosphate linkages. Alternative nucleosides include Bicyclic Nucleosides (BNA) (e.g., locked Nucleosides (LNA) and limited ethyl (cEt) nucleosides), peptide Nucleosides (PNA), phosphotriesters, phosphorothioates, phosphoramides, and other variants of the phosphate backbone of the natural nucleoside, including those described herein.

"substituted nucleotide" as used herein refers to a nucleotide having a substituted nucleoside or a substituted sugar and internucleoside linkage, which may include a substituted nucleoside linkage.

The terms "oligonucleotide" and "polynucleotide" as used herein are defined as molecules that a skilled artisan generally comprehends as comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, reference is made to a covalently linked nucleotide or nucleobase portion of a nucleoside or a modified sequence or order thereof. The oligonucleotides of the invention may be artificial and chemically synthesized and are typically purified or isolated. Oligonucleotides are also intended to include (i) compounds having one or more furanose moieties replaced by furanose derivatives or by any cyclic or acyclic structure that can serve as a covalent attachment point for a base moiety, (ii) compounds having one or more phosphodiester linkages modified, such as phosphoramide or phosphorothioate linkages, or completely replaced by suitable linking moieties, such as methylal or riboacetal linkages, and/or (iii) compounds having one or more linked furanose-phosphodiester linkage moieties replaced by any cyclic or acyclic structure that can serve as a covalent attachment point for a base moiety. The oligonucleotides of the invention may comprise one or more substituted nucleosides or nucleotides (e.g., including those described herein). It is also understood that oligonucleotides include compositions that lack sugar moieties or nucleobases but are still capable of forming pairs or hybridization with a target sequence.

"oligonucleotide" refers to a short polynucleotide (e.g., 100 or fewer linked nucleosides).

As used herein, the term "strand" refers to an oligonucleotide comprising a linked nucleotide strand. "strand comprising a nucleobase sequence" refers to an oligonucleotide comprising a linked nucleobase strand, which is described by the sequences mentioned using standard nucleobase nomenclature.

The term "antisense" as used herein refers to a nucleic acid comprising an oligonucleotide or polynucleotide that is sufficiently complementary to all or part of a gene, primary transcript or treated mRNA to interfere with expression of an endogenous gene (e.g., MLH 3). A "complementary" polynucleotide is a polynucleotide capable of base pairing according to standard Watson-Crick complementarity rules. Specifically, a purine will base pair with a pyrimidine to form a combination of guanine and cytosine pairing (G: C) and adenine and thymine pairing (A: T in the case of DNA), or adenine and uracil pairing (A: U in the case of RNA). It will be appreciated that even if two polynucleotides are not perfectly complementary to each other, they can hybridize to each other, provided that each polynucleotide has at least one region that is substantially complementary to each other.

The terms "antisense strand" and "guide strand" refer to strands of a dsRNA that comprise a region that is substantially complementary to a target sequence, such as an MLH3 mRNA.

The terms "sense strand" and "passenger strand" as used herein refer to the strand of a dsRNA comprising a region that is substantially complementary to a region of the term antisense strand as defined herein.

The term "dsRNA" refers to an agent comprising a sense strand and an antisense strand, the agent comprising the term linked nucleoside as defined herein. dsRNA includes, for example, siRNA and shRNA, which mediate targeted cleavage of RNA transcripts via an RNA-induced silencing complex (RISC) pathway. dsRNA directs the sequence-specific degradation of mRNA through a process called RNA interference (RNAi). The dsRNA reduces expression of MLH3 in a cell, e.g., a cell in a subject such as a mammalian subject. Typically, the majority of the linked nucleosides for each strand of the dsRNA are ribonucleosides, but as described in detail herein, each or both strands may also comprise one or more non-ribonucleosides, e.g., deoxyribonucleosides and/or alternative nucleosides.

The terms "siRNA" and "short interfering RNA" (also referred to as "small interfering RNA") refer to an RNA agent, preferably a double-stranded agent, of about 10-50 nucleotides in length, optionally having overhanging ends comprising, for example, 1, 2, or 3 overhanging linked nucleosides, capable of directing or mediating RNA interference. Naturally occurring siRNA is produced from longer dsRNA molecules (e.g., >25 linked nucleosides in length) by the RNAi machinery of the cell (e.g., dicer or a homolog thereof).

The terms "shRNA" and "short hairpin RNA" as used herein refer to an RNA agent having a stem-loop structure comprising first and second regions of complementary sequence that are complementary to and oriented to allow base pairing between the regions, the first and second regions being linked by a loop region, the loop resulting from a lack of base pairing between nucleobases within the loop region.

In the context of the present invention, a "chimeric" dsRNA or "chimera" is a dsRNA containing two or more chemically distinct regions, each region consisting of at least one monomeric unit, i.e. a nucleoside or nucleotide in the case of dsRNA.

The duplex region may be any length that allows for specific degradation of the desired target RNA via the RISC pathway, and may be base pairs ranging from about 9 to 36 base pairs in length, such as about 10-30 base pairs in length, such as about 15-30 base pairs in length, or about 18-20 base pairs in length, such as about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Ranges and lengths intermediate to those described above are also considered part of the present invention.

The two strands forming the duplex structure may be different parts of one longer oligonucleotide molecule or they may be separate oligonucleotide molecules. When two strands are part of one larger molecule, and thus form a duplex structure connection by an uninterrupted connecting nucleotide strand between the 3 'end of one strand and the 5' end of the corresponding other strand, the connecting strand is referred to as a "hairpin loop". The hairpin loop may comprise at least one unpaired nucleobase. In some embodiments, the hairpin loop may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleobases. In some embodiments, the hairpin loop may be 10 or fewer linked nucleosides. In some embodiments, the hairpin loop may be 8 or fewer unpaired nucleobases. In some embodiments, the hairpin loop may be 4-10 unpaired nucleobases. In some embodiments, the hairpin loop may be 4-8 linked nucleosides.

In one embodiment, each strand of the dsRNA comprises 19-23 linked nucleosides, which interact with a target RNA sequence, e.g., an MLH3 target mRNA sequence, to direct cleavage of the target RNA. Without being bound by theory, long double stranded RNA introduced into the cell is known as type III endonuclease cleavage of the Dicer (Sharp et al (2001) Genes Dev.15:485). Dicer is a ribonuclease III-like enzyme that processes RNA into 19-23 base pair short interfering RNA with a characteristic two base 3' overhang (Bernstein et al, (2001) Nature 409:363). The dsRNA is then incorporated into an RNA-induced silencing complex (RISC), in which one or more helices cleave the dsRNA duplex, enabling the complementary antisense strand to direct target recognition (Nykanen et al, (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Elbashir et al, (2001) Genes Dev.15:188). When the two substantially complementary strands of a dsRNA consist of separate RNA molecules, these molecules are not required, but can be covalently linked. When two strands are covalently linked by means other than formation of a duplex structure by an uninterrupted nucleotide chain between the 3 'end of one strand and the 5' end of the corresponding other strand, the linking structure is referred to as a "linker".

The term "linker" or "linking group" refers to a moiety that connects two moieties of a compound, e.g., an organic moiety that covalently attaches two moieties of a compound. The RNA strands may have the same or different numbers of linked nucleosides. The maximum number of base pairs is the number of linked nucleosides in the shortest strand of the dsRNA minus any overhangs present in the duplex. In addition to duplex structure, dsRNA may comprise one or more nucleoside overhangs. In one embodiment of the dsRNA, at least one strand comprises a 3' overhang of at least 1 nucleoside. In another embodiment, at least one strand comprises at least 2 linked nucleosides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 3' overhangs of the linked nucleosides. In other embodiments, at least one strand of the dsRNA comprises a 5' overhang of at least 1 nucleoside. In certain embodiments, at least one strand comprises at least 2 linked nucleosides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 5' overhangs of the linked nucleosides. In still other embodiments, both the 3 'and 5' ends of one strand of the dsRNA comprise an overhang of at least 1 nucleoside.

A linker or linking group also refers to a linkage between two atoms that connects one chemical group or fragment of interest to another chemical group or fragment of interest via one or more covalent bonds. The conjugate moiety may be attached to the dsRNA directly or through a linking moiety (e.g., a linker or tether). The linker serves to covalently attach a third region, e.g., a conjugate moiety, to the dsRNA (e.g., the end of region a or C). In some embodiments of the invention, the conjugate or dsRNA conjugate of the invention may optionally comprise a linker region between the dsRNA and the conjugate moiety. In some embodiments, the linker between the conjugate and the dsRNA is biologically cleavable. Biodegradable linkers containing phosphodiester are described in more detail in WO 2014/076195 (incorporated herein by reference).

As used herein, the term "nucleoside overhang" refers to at least one unpaired nucleobase that protrudes from the duplex structure of a dsRNA or siRNA. For example, nucleoside overhangs exist when the 3 'end of one strand of a dsRNA extends beyond the 5' end of the other strand, or vice versa. The dsRNA may comprise an overhang of at least one nucleoside; alternatively, the overhang may comprise at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, or more. Nucleoside overhangs may comprise or consist of alternative nucleosides, including deoxynucleotides/nucleosides. The overhang may be on the sense strand, the antisense strand, or any combination thereof. In addition, overhanging nucleosides can be present at the 5 'end, 3' end, or both ends of the antisense or sense strand of the dsRNA. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.

The term "a/an" means one or more.

Examples

General procedure and sequence listing

Experimental model and subject details

Study group (patients with NASH)

The Sword bridge group consisted of 58 consecutive NAFLD patients enrolled at the NASH service of the university of Cambridge hospital (NAFL: 19; NASH F0-2:24; NASH F3-4:15). All patients had clinically and biopsy confirmed NAFLD diagnosis (excluding other diagnostic and fatty liver patients of different etiology), were scored histologically by trained human pathologists according to the NASH CRN scoring system (NAS 1), and tissue was flash frozen for research purposes (gene expression by next generation sequencing, see below). All comparisons were made for the NAFLD group. The study was approved by the local ethics committee; following the principles declared by helsinki. All patients gave informed consent for their use of clinical/histologic data and samples for study purposes. For NASH/HCC patient information from UCLA single cell sequencing, detailed patient information is attached in table 1.

Mouse strain, HFD feeding and DEN injection

All animal experiments were performed according to the guidelines for care and use of laboratory animals and were approved by the biomedical research ethics committee of the university of washington, georgery, biomedical research institutes. C57BL/6 mice were purchased from Jackson laboratories and engineered. Male and female mice were used in our study. To generate liver-specific deletions in Sptbn1 mice, the Flox site was inserted into the spo box flanking exon 24 to exon 26 of the Sptbn1 locus. The Neo cassette was then removed by hybridization with Flp mice. The Sptbn1-Flox mice were then hybridized with albumin-Cre to create liver-specific deletions in the Sptbn1 mice. For High Fat Diet (HFD) induced liver steatosis, male and female mice aged 10 to 12 weeks old were fed with a control diet or HFD (ENVIGO, cat# td.06414) for 12 to 20 weeks. Blood glucose, TG and cholesterol levels were measured by a glucometer, cardioChek PA analyzer and PTS panel lipid test strips. For the DEN-induced liver cancer model, 25mg/kg DEN was injected in 14-15 day old male and female mice. Tumor development was analyzed after 6-10 months. Liver and visceral adipose tissue was excised and weighed. Spleen, heart, brain, muscle, brown adipose tissue were also collected for further histological analysis.

Generation of cell lines and cell culture

Sptbn1 ^-/- 、Sptbn1 ^+/- And WT MEFs were generated from Sptbn 1-crossed mice. Human hepatoma cell lines Hep3B and HepG2, huh7 and the mouse immortalized hepatocellular line AML12 were purchased from ATCC and cultured in complete medium DMEM/F12 medium (Corning, catalog No. 10-090-CV) supplemented with 1% streptomycin-penicillin and 10% FBS (Hyclone, catalog No. SH 30396.03). Human immortalized hepatocytes line THLE2 purchased from ATCC was cultured in BEGM medium (Lonza/Clonetics Corporation, catalog number CC 3170) supplemented with 1% streptomycin-penicillin, 10% FBS (Sigma-Aldrich, catalog number F2442), 40ug phosphoethanolamine (Sigma-Aldrich, catalog number P0503) and 3ug human recombinant EGF in addition to BPE (bovine pituitary extract), hydrocortisone, hEGF, insulin, triiodothyronine, transferrin and retinoic acid from BEGM medium kit (Lonza/Clonetics Corporatio n, catalog number CC 3170)Directory number 354052). THLE2 cells were cultured using flasks or plates pre-coated with a mixture of 0.01mg/ml fibronectin, 0.03mg/ml bovine type I collagen, and 0.01mg/ml bovine serum albumin. For HepG2 cell lines stably knocked out Smad3 and/or Sptbn1 by CRISPR/Cas9, hepG2 cells plated on 6-well plates were transfected with Sptbn1/HDR knockdown CRISPR plasmid (Santa Cruz, sc-401818, sc-401818-HDR) on each 3 wells using Lipofectamine LTX (Invitrogen) and Opti-MEM medium (Invitrogen) according to manufacturer's instructions. After 48 hours puromycin (5 μg/ml) was added to the medium to select stable knockdown cells. Each of which The selection medium was changed for 2-3 days.

Details of the method

Reagent(s)

DMEM/F12 medium is available from Corning (catalog number 10-090-CV); streptomycin-penicillin (Corning, catalog No. 30-002-Cl), fetal bovine serum was purchased from HyClone (catalog No. SH 30396.03), phosphoethanolamine (catalog No. P0503), and cell line thal 2 was purchased from ATCC (ATCC catalog No. CRL-2706).

Lipoprotein deficient serum from calf manure was obtained from Sigma-Aldrich (catalog No. S5394). BEGM media kit was obtained from Lonza/Clonetics Corporation (catalog number CC 3170). Human recombinant EGF was purchased from Corning, catalog number 354052. Collagen-coated flasks for THLE2 cells were from Thermo Scientific (catalog No. 132707).

Targeting SPTBN1 by siRNA in mouse and human 3D cultures

To hydrodynamically inject siRNA into the mouse tail, siswtbn 1 and siCtrl were resuspended in nuclease-free water (Life Technologies) to 0.25mM and combined with RNAiMAX transfection reagent (Invitrogen) at 1:1 was incubated at room temperature for 20 minutes. Then pass throughThe QR hydrodynamic delivery solution (Mirus, madison, wis.) dilutes these complexes to 0.625. Mu.M. Mice received 2.0mL of diluted siSptbn1 (1.25 nmol) or siCtrl by hydrodynamic tail intravenous injection as previously described. Injections were repeated at 2 week intervals over 6 weeks after 1 week of HFD feeding. For the human 3D perfusion microphysical system consisting of primary human hepatocytes, liver Kupffer cells and stellate cells, these cells were co-cultured in a medium rich in fatty acids, sugars and insulin for 2 weeks as a culture model of human NASH.

Transfection and cell fractionation

Cells plated on day 0 in 60mm plates were transfected with 3-5 μg of the indicated plasmid mixture using Lipofectamine 3000 (Thermo Fisher Scientific, catalog number L3000015) according to manufacturer's instructions on day 1. For day 2 TGF- β treatment, cells were incubated overnight in serum-free DMEM/F12 medium. TGF-. Beta.1 (Sigma-Aldrich, catalog number T1654; R & D, catalog number 240-B) was then added to the final concentration of 200pM 0.5, 2, 12, 24 or 48 hours prior to harvesting the cells. For knockdown experiments, siRNA (Dharmacon) targeting Sptbn1 or Smad3 was transfected into HepG2 or Hep3B cells by Lipofectamine RNAiMAX (Thermo Fisher, catalog No. 13778150) for 24 to 48 hours.

For cell fractionation, cells were harvested and lysed with cytoplasmic lysis buffer followed by lysis with nuclear lysis buffer according to the manufacturer's instructions for a nuclear/cytoplasmic fractionation kit (Biovision, cat. No. K266-25).

Immunoprecipitation and immunoblotting

The treated or untreated cells were lysed with (20 mM Tris-HCl pH7.4, 150mM NaCl, 1mM EDTA, 1% Triton-X100, 1% sodium deoxycholate, 0.1% SDS) or NP-40 lysis buffer (50 mM Tris-HCl, pH 7.5, 0.15M NaCl, 1% NP-40, 1mM EDTA) freshly prepared with a complete protease inhibitor and phosphatase inhibitor mixture (Sigma-Aldrich, cat. No. 4906845001 and cat. No. 11836170001), followed by SDS-PAGE and immunoblotting using the following antibodies: anti-SPTBN 1 (In house, rabbit), anti-SREBP 1 (Abcam, catalog number Ab 191857), anti-adhesion plaque protein (Proteintech, catalog number 26520-1-AP) and anti-GAP DH (Santa Cruz, catalog number sc-32233), anti-tubulin (Cell Signaling, catalog number 3873), and anti-Smad 3 (Cell Signaling, catalog number 9513). For immunoprecipitation, each fractionated lysate or whole Cell lysate is pre-clarified for 30 min to remove non-specific binding, then protein A/G mixed beads (MilliporeSigma) mixed with anti-SPTBN 1 (Inhouse) (23) or rabbit IgG (Cell signaling, catalog number 2729) are used ^TM Catalog LSKMAGAG 02) was immunoprecipitated for 3 hours or overnight as a control. With washing buffer (10 mM EDTA-Tris, 150mM NaCl, 20mM MgCl) ₂ ) The immunoprecipitated complexes (bead-lysate-antibody mixtures) were washed 4 times and eluted with sample buffer before western blot analysis.

Luciferase assay

For transcription reporter gene assay, hepG2 or Hep3B cells were used at 1X 10 ⁴ Cell/well densityThe cultures were plated in 24-well dishes. The following day, cells were co-transfected with siRNA (control or Smad 3-targeted siRNA) and luciferase reporter gene (containing LDLR promoter or SCD promoter) using Lipofectamine 3000 (Thermo-Fisher, cat No. L3000015). For the absence of SMAD3 (SMAD 3 ^-/- ) Or Sptbn1 (Sptbn 1) ^-/- )、Sptbn1 ^+/- The luciferase reporter gene containing the wild-type LDLR promoter region (pLDLR-luc, adedge accession No. 14940), the LDLR promoter region carrying SREBP non-responsive mutant SRE (pLDLR-luc MUT, adedge accession No. 14945) or SCD1 promoter (gifts of pGL3-SCD1, giovanni Sorrentino doctor and Giannino Del Sal doctor) was co-transfected with Renilla (Promega) into cells using Lipofectamine 3000 (Thermo Fisher, catalog No. L3000015). For rescue experiments, pLDLR-luc or pGL3-SCD1 was co-transfected with control plasmid or V5-Sptbn1 to Sptbn1 ^-/- MEF cells; or co-transfection with Flag-SMAD3 plasmid into Smad3 ^-/- MEF cells. 24 hours after transfection, after overnight serum starvation, with 200pM TGF-beta 1 (R&D, catalog number 240-B) cells were treated for 24 hours. In all luciferase assays, expression plasmid Renilla (Promega) was used as an internal control to correct for transfection efficiency. Cells were extracted using 100 μl luciferase cell culture lysis reagent. Renilla enzyme activity was measured using 10 μl of cell extract. Twenty microliters of cell extract was used for luciferase assay using a dual luciferase assay kit according to manufacturer's instructions (Promega, cat No. E1980). For each sample, luciferase activity was normalized to Renilla Activity (AU) and fold change was calculated.

Immunohistochemistry and immunofluorescence analysis

For immunohistochemical analysis, mouse tissues were fixed in 10% formalin and embedded in paraffin according to standard procedures. FFPE sections were stained with hematoxylin and eosin (H & E) to assess overall morphology and balloon-like changes, triglyceride accumulation was determined with oil red and fibrosis was determined with sirius red. Different cell types were also determined using hepatocyte nuclear factor 4 (HNF 4) (for hepatocytes), desmin (for hepatic stellate cells), CD31 (for hepatic sinus endothelial cells), F4/80 (for macrophages), CD142, ICAM1 and CK19 (for cholangiocytes). Sections were labeled with antibodies specific for SPTBN1, SREBP1 and Smads (Cell Signaling Technology, 2899) antibodies. Diaminobenzidine is used as a chromogen.

For immunofluorescence analysis, cells were incubated at 2X 10 ⁴ The density of individual cells/dishes was seeded onto glass bottom dishes in DMEM/F12 supplemented with 10% FBS or 1% lipoprotein deficient serum (LPDS) for 12 hours. Cells at various time points treated with oleic acid, staurosporine, TNF- α with or without TGF- β were then fixed with 10% formalin for 15 min, then permeabilized with 0.1% saponin for 5 min. Cells were then incubated with blocking solution (0.1% saponin, 10% bovine serum albumin in PBS) for 1 hour at room temperature, followed by incubation with primary antibodies (1:200 anti-rabbit SREBP1, anti-rabbit Sptbn1, and anti-rabbit SMAD 3) overnight at 4 ℃. The following day, cells were washed with PBS and incubated with secondary antibodies (anti-rabbit Alexa Fluor Plus 488, goat anti-mouse Alexa Fluor 568, goat anti-rabbit Alexa Fluor 488, invitrogen) for 1 hour at room temperature. DAPI was used to counterstain the nuclei. Images were taken on an IX81 Olympus microscope and confocal microscope using a X40 objective.

RNA extraction and RNA integrity

Human RNA was isolated using the following protocol: biopsies were homogenized in STAT-60 (AMS biotechnolo gy, CS-502) (1 ml) with a tissue homogenizer, mixed (vortexed) and centrifuged at 13,000g/RT for 5 min; the supernatant was mixed with 200. Mu.l chloroform (Sigma, catalog number 650471) and centrifuged (12,000 g/4 ℃ C./15 min); the supernatant was then mixed with 500ul of isopropanol (Sigma, cat. No. 33539) and centrifuged (10,000 g/4 ℃ C./10 min) to pellet the RNA; the precipitate was washed with ethanol (75%; 1 ml) and dried at room temperature; RNA was resuspended in DEPC treated water (Quality Biological, catalog No. 351-068-131). All reagents, plastic products and supplies used are nuclease-free, sterile and of molecular biology grade. RNA purity was determined using Nanodrop (Thermo Fisher Scientific, delaware USA) (A260/A280 >1.80 And concentration. RNA integrity was studied using a 2100Bioanalyzer value (RNA 6000Nano kit; agilent, santa Clara, california, USA): RNA Integrity (RIN) is greater than or equal to 8 quiltThe lowest cut-off for sequencing was considered. For mice, RNA was extracted from liver tissue or hepatocytes using the RNeasy Plus Mini kit (Qiagen, catalog No. 74134). RNA quality and concentration were assessed using a Thermo Scientific Nanodrop 3300 spectrophotometer (Novogene Co.) prior to RNA sequencing. For real-time PCR analysis, total RNA was extracted using TRIzol reagent (Invitrogen, catalog No. AM 9738) according to manufacturer's instructions. Reverse transcription of 1-2ug total RNA was performed by using Super-Script III first strand kit (Invitroge n). iQ for each cDNA ^TM SYBR Green SuperMix PCR kit (Bio-Rad Laboratories) was amplified in triplicate for 40 cycles on a Bio-Rad system (iCycler thermocycler). The primers used for real-time PCR are listed in the following table.

Whole transcriptome amplification and RNA sequencing

Using IlluminaThe strand mRNA library preparation kit (Illumina) was used to generate a barcode sequencing library using 1 microgram of RNA according to the manufacturer's instructions. The sequencing library was concentration normalized and pooled into a 96-plex pool and sequenced at single ended 50bp (SE 50) on 3 lanes of the Illumina HiSeq 4000 instrument, yielding an average of 1500 ten thousand reads/sample. Library preparation was performed by the genomics and transcriptomics centers of the metabolic science research institute; sequencing was performed at the cancer research genomics center of cambridge institute, uk; are all at the university of Cambridge.

NGS data processing and statistical analysis

RNA sequencing data was aligned with human GRCh38 genome and mice (GRCm 38/mm 10) using hisat2 V2.1.0 2; genes that passed QC were counted using HTSeq2 (v0.11.1) 3. The raw gene level counts were then used for differential gene expression analysis using DESeq2 4. Using Log ₂ Each million copies of transformation (Log ₂ CPM) normalized gene expression and statistical significance was assessed by R using Wald test in DESeq2 (p<0.05). The raw p-value was then adjusted by the Benjamini-Hochberg program to control the False Discovery Rate (FDR) 5.

Bioinformatics functional analysis

Genes differentially expressed within the study group were analyzed using the biological response pathway (IPA, qiagen), the entire transcriptome was entered and filtered in IPA for statistically significant (p < 0.05) hits, log2FC was less than-0.3785 or greater than 0.3785, and Log2CPM >0.5 (for humans) and/or FPKM >1 (for mice). An upstream regulatory network was generated and ranked according to significance of the genes involved (p <0.05 for human) and activation status (Z score). We only considered statistically significant (p < 0.05) Log2FC less than-0.3785 or greater than 0.3785 and enriched those genes in the "significantly regulated" network and/or those genes with FDR <0.05 "biologically relevant" in the comparative analysis.

Structural modeling of human SPTBN1 and SREBP1c

The three-dimensional structure of human SPTBN1 and SREBP1c is still unknown, so by the homology-based fold recognition method, computer structural modeling is performed using a server (53) based on Phyre2 (protein homology/analog recognition engine V2.0) network. This approach uses multiple templates covering different query regions of the amino acid sequence (with different identities and thus different confidence levels) to generate a three-dimensional model of the protein structure. First, template identification was performed by P-BLAST (protein basic local alignment search tool) against the RCSB Protein Database (PDB), where several templates were found to exhibit suitable sequence identity and coverage with SPTBN1 and SREBP1c to model their structures. Templates from PDB and folds from Phyre internal folding libraries had the highest sequence identity and coverage, used to generate models of human SPTBN1 and SREBP1c (table 2). Model optimization was performed using ModLoop (54) optimization loop, followed by Swiss-PDB Viewer (55).

Model optimization and energy minimization were also performed to find the most stable, energy-lowest configuration of SPTBN1 and SREBP1c to avoid any consequent errors and high energy configurations that could lead to physical disturbances and instability of the structure. Swiss-PDB Viewer was used for energy minimization and structure optimization by changing the coordinate geometry, releasing the internal constraints and reducing the overall potential energy of the model.

Structure-based molecular docking

Furthermore, after modeling the SPTBN1 and SREBP1c structures, their binding patterns were explored by using molecular docking methods. The structural coordinates of the SPTBN1 fragment covering D50-T975, Q1132-T2155 and A2198-K2364 and the SREBP1c fragment covering Q295-K374 and P546-S705 were taken from our modeled structure. Docking (38) is performed using a ClusPro 2.0 web server. First, the docking results for higher binding affinities were screened, then the top docking configuration was selected and their possible interactions were further analyzed using PyMOL and liglot+.

Statistics of

Differences between the two groups were assessed using GraphPad Prism using a two-tailed student t-test. The weekly weight gain was compared in pairs. For multiple comparisons, one-way ANOVA was used with the postmortem Bonferroni test. In vitro experiments were performed 2-4 times. All luciferase experiments were performed in triplicate for at least 3 times. Results are expressed as mean ± SEM unless indicated otherwise. For all statistical analyses, p <0.05 was considered statistically significant.

Sequence listing of various human and mouse

Intelligent human angiogenin beta, non-erythrocyte 1 (SPTBN 1), transcriptional variant 1, mRNA

NCBI reference sequence: NM_003128.3

atgacgaccacagtagccacagactatgacaacattgagatccagcagcagtacagtgatgtcaacaaccgctgggatgtcgacgactgggacaatgagaacagctctgcgcggctttttgagcggtcccgcatcaaggctctggcagatgagcgtgaagccgtgcagaagaagaccttcaccaagtgggtcaattccca

ccttgcccgtgtgtcctgccggatcacagacctgtacactgaccttcgagatggacggatgctcatcaag

ctgctggaggtcctctctggagagaggctgcctaaacccaccaagggacgaatgcgcatccactgctta

gagaatgtggacaaggcccttcagttcctgaaggagcagagagtccatcttgagaacatggggtcccat

gacatcgtggatggaaaccaccggctgacccttggcctcatctggaccatcatcctgcgcttccagatcc

aggatatcagtgtggaaactgaagacaacaaagagaagaaatctgccaaggatgcattgctgttgtggt

gccagatgaagacagctgggtaccccaatgtcaacattcacaatttcaccactagctggagggacggca

tggccttcaatgcactgatacacaaacaccggcctgacctgatagattttgacaaactaaagaaatctaac

gcacactacaacctgcagaatgcatttaatctggcagaacagcacctcggcctcactaaactgttggacc

ccgaagacatcagcgtggaccatcctgatgagaagtccataatcacttatgtggtgacttattaccactact

tctctaagatgaaggccttagctgttgaaggaaaacgaattggaaaggtgcttgacaatgctattgaaaca

gaaaaaatgattgaaaagtatgaatcacttgcctctgaccttctggaatggattgaacaaaccatcatcatt

ctgaacaatcgcaaatttgccaattcactggtcggggttcaacagcagcttcaggcattcaacacttaccg

cactgtggagaaaccacccaaatttactgagaaggggaacttggaagtgctgctcttcaccattcagagc

aagatgagggccaacaaccagaaggtctacatgccccgggaggggaagctcatctctgacatcaaca

aggcctgggaaagactggaaaaagcggaacacgaaagagaactggctttgcggaatgagctcataag

acaggagaaactggaacagctcgcccgcagatttgatcgcaaggcagctatgagggagacttggctga

gcgaaaaccagcgtctggtgtctcaggacaactttgggtttgaccttcctgcagttgaggccgccacaaa

aaagcacgaggccattgagacagacattgccgcatacgaggagcgtgtgcaggctgtggtagccgtg

gccagggagctcgaggccgagaattaccacgacatcaagcgcatcacagcgaggaaggacaatgtc

atccggctctgggaatacctactggaactgctcagggcccggagacagcggctcgagatgaacctggg

gctgcagaagatattccaggaaatgctctacattatggactggatggatgaaatgaaggtgctagtattgt

ctcaagactatggcaaacacttacttggtgtggaagacctgttacagaagcacaccctggttgaagcaga

cattggcatccaggcagagcgggtgagaggtgtcaatgcctccgcccagaagttcgcaacagacggg

gaaggttacaagccctgtgacccccaggtgatccgagaccgcgtggcccacatggagttctgttatcaa

gagctttgccagctggcggctgagcgcagggcccgtctggaagagtcccgccgcctctggaagttcttc

tgggagatggcagaagaggaaggctggatacgggagaaggagaagatcctgtcctcggacgattacg

ggaaagacctgaccagcgtcatgcgcctgctcagcaagcaccgggcgttcgaggacgagatgagcg

gccgcagtggccactttgagcaggccatcaaggaaggcgaagacatgatcgcggaggagcacttcgg

gtcggagaagatccgtgagaggatcatttacatccgggagcagtgggccaacctagagcagctctcgg

ccattcggaagaagcgcctggaggaggcctccctgctgcaccagttccaggcagatgctgatgacattg

atgcctggatgctggacatcctcaagattgtctccagcagcgacgtgggccacgatgagtattccacaca

gtctctggtcaagaaacacaaggacgtggcggaagagatcgccaattacaggcccacccttgacacgc

tgcacgaacaagccagcgccctcccccaggagcatgccgagtctccagacgtgaggggcaggctgtc

gggcatcgaggagcggtataaggaggtggcagagctgacgcggctgcggaagcaggcactccagg

acactctggccctgtacaagatgttcagcgaggctgatgcctgtgagctctggatcgacgagaaggagc

agtggctcaacaacatgcagatcccagagaagctggaggatctggaggtcatccagcacagatttgag

agcctagaaccagaaatgaacaaccaggcttcccgggttgcagtggtgaaccagattgcacgccagct

gatgcacagcggccacccaagtgagaaggaaatcaaagcccagcaggacaaactcaacacaaggtg

gagccagttcagagaactggttgacaggaagaaggatgccctcctgtctgccctgagcatccagaacta

ccacctcgagtgcaatgaaaccaaatcctggattcgggaaaagaccaaggtcatcgagtccacccagg

acctgggcaatgacctggctggcgtcatggccctgcagcgcaagctgaccggcatggagcgggactt

ggtggccattgaggcaaagctgagtgacctgcagaaggaggcggagaagctggagtccgagcaccc

cgaccaggcccaggccatcctgtctcggctggccgagatcagcgacgtgtgggaggagatgaagacc

accctgaaaaaccgagaggcctccctgggagaggccagcaagctgcagcagttcctacgggacttgg

acgacttccagtcctggctctctaggacccagacagcgatcgcctcggaggacatgccaaacaccctg

accgaggctgagaagctgctcacgcagcacgagaacatcaagaacgagatcgacaactacgaggag

gactaccagaagatgagggacatgggcgagatggtcacccaggggcagaccgatgcccagtacatgt

ttctgcggcagcggctgcaggccctggacactggatggaacgagctccacaagatgtgggagaacag

acaaaatctcctatcccagtcacatgcctaccagcagttcctcagagacacgaagcaagccgaagccttt

cttaacaaccaggagtatgttctggctcacactgaaatgcctaccaccttggaaggagctgaagcagcaa

ttaaaaagcaagaggacttcatgaccaccatggacgccaatgaggagaagatcaatgctgtggtggag

actggccggaggctggtgagcgatgggaacatcaactcagatcgcatccaggagaaggtggactctat

tgatgacagacataggaagaatcgtgagacagccagtgaacttttgatgaggttgaaggacaacaggg

atctacagaaattcctgcaagattgtcaagagctgtctctctggatcaatgagaagatgctcacagcccag

gacatgtcttacgatgaagccagaaatctgcacagtaaatggttgaagcatcaagcatttatggcagaact

tgcatccaacaaagaatggcttgacaaaatcgagaaggaaggaatgcagctcatttcagaaaagcctga

gacggaagctgtggtgaaggagaaactcactggtttacataaaatgtgggaagtccttgaatccactacc

cagacaaaggcccagcggctctttgatgcaaacaaggccgaacttttcacccagagctgtgcagatcta

gacaaatggctgcacggcctggagagtcagattcagtctgatgactatggcaaagacctgaccagtgtc

aatatcctgctgaaaaagcaacagatgctggagaatcagatggaagtgcggaagaaggagatcgaag

agctccaaagccaagcccaggccctgagtcaggaagggaagagcaccgacgaggtagacagcaag

cgcctcaccgtgcagaccaagttcatggagttgctggagcccttgaacgagaggaagcataacctgctg

gcctccaaagagatccatcagttcaacagggatgtggaggacgagatcttgtgggttggagagaggat

gcctttggcaacttccacggatcatggccacaacctccagactgtgcagctgttaataaagaaaaatcag

accctccagaaagaaatccaggggcaccagcctcgcattgacgacatctttgagaggagccaaaacat

cgtcactgacagcagcagcctcagcgctgaggccatcagacagaggcttgccgacctgaagcagctgt

ggggtctcctcattgaggagacagagaaacgccacaggcggctggaggaggcgcacagggcccag

cagtactactttgacgctgctgaggccgaagcctggatgagcgagcaggagctgtacatgatgtcagag

gagaaggccaaggatgagcagagtgctgtctccatgttgaagaagcaccagatcttagaacaagctgtg

gaggactatgcagagaccgtgcatcagctctccaagaccagccgggccctggtggccgacagccatc

ctgaaagtgagcgcattagcatgcggcagtccaaagtggataaactgtacgctggtctgaaagaccttg

ctgaagagagaagaggcaagctggatgagagacacaggttattccagctcaaccgggaggtggacga

cctggagcagtggatcgctgagagggaggtggtcgcagggtcccatgaactgggacaggactatgag

catgtcacgatgttacaagaacgattccgggagtttgcccgagacaccgggaacattgggcaggagcg

cgtggacacggtcaatcacctggcagatgagctcatcaactctggacattcagatgccgccaccatcgct

gaatggaaggatggcctcaatgaagcctgggccgacctcctggagctcattgacacaagaacacagat

tcttgccgcttcctatgaactgcacaagttttaccacgatgccaaggagatctttgggcgtatacaggaca

aacacaagaaactccctgaggagcttgggagagatcagaacacagtggagaccttacagagaatgca

cactacatttgagcatgacatccaggctctgggcacacaggtgaggcagctgcaggaggatgcagccc

gcctccaggcggcctatgcgggtgacaaggccgacgatatccagaagcgcgagaacgaggtcctgg

aagcctggaagtccctcctggacgcctgtgagagccgcagggtgcggctggtggacacaggggaca

agttccgcttcttcagcatggtgcgcgacctcatgctctggatggaggatgtcatccggcagatcgaggc

ccaggagaagccaagggatgtatcatctgttgaactcttaatgaataatcatcaaggcatcaaagctgaa

attgatgcacgtaatgacagtttcacaacctgcattgaacttgggaaatccctgttggcgagaaaacactat

gcatctgaggagatcaaggaaaaattactgcagttgacggaaaagaggaaagaaatgatcgacaagtg

ggaagaccgatgggaatggttaagactgattctggaggtccatcagttctcaagagacgccagtgtggc

cgaggcctggctgcttggacaggagccgtacctatccagccgagagataggccagagcgtggacgag

gtggagaagctcatcaagcgccacgaggcatttgaaaagtctgcagcaacctgggatgagaggttctct

gccctggaaaggctgactacattggagttactggaagtgcgcagacagcaagaggaagaggagagga

agaggcggccgccttctcccgagccgagcacgaaggtttcagaggaagccgagtcccagcagcagt

gggatacttcaaaaggagaacaagtttcccaaaacggtttgccagctgaacagggatctccacggatgg

cagaaacggtggacacaagcgaaatggtcaacggcgctacagaacaaaggacgagctctaaagagtc

cagccccatcccctccccgacctctgatcgtaaagccaagactgccctcccagcccagagtgccgcca

ccttaccagccagaacccaggagacaccttcggcccagatggaaggcttcctcaatcggaaacacgag

tgggaggcccacaataagaaagcctcaagcaggtcctggcacaatgtttattgtgtcataaataaccaag

aaatgggtttctacaaagatgcaaagactgctgcttctggaattccctaccacagcgaggtccctgtgagt

ttgaaagaagctgtctgcgaagtggcccttgattacaaaaagaagaaacacgtattcaagctaagactaa

atgatggcaatgagtacctcttccaagccaaagacgatgaggaaatgaacacatggatccaggctatctc

ttccgccatctcctctgataaacacgaggtgtctgccagcacccagagcacgccagcatccagccgcgc

gcagaccctccccaccagcgtcgtcaccatcaccagcgagtccagtcccggcaagcgggaaaaggacaaagagaaagacaaagagaagcggttcagcctttttggcaaaaagaaatga(SEQ ID No.1)。

Intelligent human angiogenin beta, non-erythrocyte 1 (SPTBN 1), transcriptional variant 2, mRNA

NCBI reference sequence: NM_178313.2

ATGGAATTGCAGAGGACGTCTAGTATCTCCGGGCCGCTGTCGCCGGCGTACACGGGGCAGGTGCCTTACAACTACAACCAGCTGGAAGGCAGATTCAAGCAGCTGCAAGATGAGCGTGAAGCCGTGCAGAAGAAGACCTTCACCAAGTGGGTCAATTCCCACCTTGCCCGTGTGTCCTGCCGGATCACAGACCTGTACACTGACCTTCGAGATGGACGGATGCTCATCAAGCTGCTGGAGGTCCTCTCTGGAGAGAGGCTGCCTAAACCCACCAAGGGACGAATGCGCATCCACTGCTTAGAGAATGTGGACAAGGCCCTTCAGTTCCTGAAGGAGCAGAGAGTCCATCTTGAGAACATGGGGTCCCATGACATCGTGGATGGAAACCACCGGCTGACCCTTGGCCTCATCTGGACCATCATCCTGCGCTTCCAGATCCAGGATATCAGTGTGGAAACTGAAGACAACAAAGAGAAGAAATCTGCCAAGGATGCATTGCTGTTGTGGTGCCAGATGAAGACAGCTGGGTACCCCAATGTCAACATTCACAATTTCACCACTAGCTGGAGGGACGGCATGGCCTTCAATGCACTGATACACAAACACCGGCCTGACCTGATAGATTTTGACAAACTAAAGAA

ATCTAACGCACACTACAACCTGCAGAATGCATTTAATCTGGCA

GAACAGCACCTCGGCCTCACTAAACTGTTGGACCCCGAAGACA

TCAGCGTGGACCATCCTGATGAGAAGTCCATAATCACTTATGT

GGTGACTTATTACCACTACTTCTCTAAGATGAAGGCCTTAGCTG

TTGAAGGAAAACGAATTGGAAAGGTGCTTGACAATGCTATTGA

AACAGAAAAAATGATTGAAAAGTATGAATCACTTGCCTCTGAC

CTTCTGGAATGGATTGAACAAACCATCATCATTCTGAACAATC

GCAAATTTGCCAATTCACTGGTCGGGGTTCAACAGCAGCTTCA

GGCATTCAACACTTACCGCACTGTGGAGAAACCACCCAAATTT

ACTGAGAAGGGGAACTTGGAAGTGCTGCTCTTCACCATTCAGA

GCAAGATGAGGGCCAACAACCAGAAGGTCTACATGCCCCGGG

AGGGGAAGCTCATCTCTGACATCAACAAGGCCTGGGAAAGAC

TGGAAAAAGCGGAACACGAAAGAGAACTGGCTTTGCGGAATG

AGCTCATAAGACAGGAGAAACTGGAACAGCTCGCCCGCAGAT

TTGATCGCAAGGCAGCTATGAGGGAGACTTGGCTGAGCGAAA

ACCAGCGTCTGGTGTCTCAGGACAACTTTGGGTTTGACCTTCCT

GCAGTTGAGGCCGCCACAAAAAAGCACGAGGCCATTGAGACA

GACATTGCCGCATACGAGGAGCGTGTGCAGGCTGTGGTAGCCG

TGGCCAGGGAGCTCGAGGCCGAGAATTACCACGACATCAAGC

GCATCACAGCGAGGAAGGACAATGTCATCCGGCTCTGGGAAT

ACCTACTGGAACTGCTCAGGGCCCGGAGACAGCGGCTCGAGAT

GAACCTGGGGCTGCAGAAGATATTCCAGGAAATGCTCTACATT

ATGGACTGGATGGATGAAATGAAGGTGCTAGTATTGTCTCAAG

ACTATGGCAAACACTTACTTGGTGTGGAAGACCTGTTACAGAA

GCACACCCTGGTTGAAGCAGACATTGGCATCCAGGCAGAGCG

GGTGAGAGGTGTCAATGCCTCCGCCCAGAAGTTCGCAACAGAC

GGGGAAGGTTACAAGCCCTGTGACCCCCAGGTGATCCGAGACC

GCGTGGCCCACATGGAGTTCTGTTATCAAGAGCTTTGCCAGCT

GGCGGCTGAGCGCAGGGCCCGTCTGGAAGAGTCCCGCCGCCTC

TGGAAGTTCTTCTGGGAGATGGCAGAAGAGGAAGGCTGGATA

CGGGAGAAGGAGAAGATCCTGTCCTCGGACGATTACGGGAAA

GACCTGACCAGCGTCATGCGCCTGCTCAGCAAGCACCGGGCGT

TCGAGGACGAGATGAGCGGCCGCAGTGGCCACTTTGAGCAGG

CCATCAAGGAAGGCGAAGACATGATCGCGGAGGAGCACTTCG

GGTCGGAGAAGATCCGTGAGAGGATCATTTACATCCGGGAGC

AGTGGGCCAACCTAGAGCAGCTCTCGGCCATTCGGAAGAAGC

GCCTGGAGGAGGCCTCCCTGCTGCACCAGTTCCAGGCAGATGC

TGATGACATTGATGCCTGGATGCTGGACATCCTCAAGATTGTC

TCCAGCAGCGACGTGGGCCACGATGAGTATTCCACACAGTCTC

TGGTCAAGAAACACAAGGACGTGGCGGAAGAGATCGCCAATT

ACAGGCCCACCCTTGACACGCTGCACGAACAAGCCAGCGCCCT

CCCCCAGGAGCATGCCGAGTCTCCAGACGTGAGGGGCAGGCT

GTCGGGCATCGAGGAGCGGTATAAGGAGGTGGCAGAGCTGAC

GCGGCTGCGGAAGCAGGCACTCCAGGACACTCTGGCCCTGTAC

AAGATGTTCAGCGAGGCTGATGCCTGTGAGCTCTGGATCGACG

AGAAGGAGCAGTGGCTCAACAACATGCAGATCCCAGAGAAGC

TGGAGGATCTGGAGGTCATCCAGCACAGATTTGAGAGCCTAGA

ACCAGAAATGAACAACCAGGCTTCCCGGGTTGCAGTGGTGAAC

CAGATTGCACGCCAGCTGATGCACAGCGGCCACCCAAGTGAG

AAGGAAATCAAAGCCCAGCAGGACAAACTCAACACAAGGTGG

AGCCAGTTCAGAGAACTGGTTGACAGGAAGAAGGATGCCCTC

CTGTCTGCCCTGAGCATCCAGAACTACCACCTCGAGTGCAATG

AAACCAAATCCTGGATTCGGGAAAAGACCAAGGTCATCGAGT

CCACCCAGGACCTGGGCAATGACCTGGCTGGCGTCATGGCCCT

GCAGCGCAAGCTGACCGGCATGGAGCGGGACTTGGTGGCCATT

GAGGCAAAGCTGAGTGACCTGCAGAAGGAGGCGGAGAAGCTG

GAGTCCGAGCACCCCGACCAGGCCCAGGCCATCCTGTCTCGGC

TGGCCGAGATCAGCGACGTGTGGGAGGAGATGAAGACCACCC

TGAAAAACCGAGAGGCCTCCCTGGGAGAGGCCAGCAAGCTGC

AGCAGTTCCTACGGGACTTGGACGACTTCCAGTCCTGGCTCTCT

AGGACCCAGACAGCGATCGCCTCGGAGGACATGCCAAACACC

CTGACCGAGGCTGAGAAGCTGCTCACGCAGCACGAGAACATC

AAGAACGAGATCGACAACTACGAGGAGGACTACCAGAAGATG

AGGGACATGGGCGAGATGGTCACCCAGGGGCAGACCGATGCC

CAGTACATGTTTCTGCGGCAGCGGCTGCAGGCCCTGGACACTG

GATGGAACGAGCTCCACAAGATGTGGGAGAACAGACAAAATC

TCCTATCCCAGTCACATGCCTACCAGCAGTTCCTCAGAGACAC

GAAGCAAGCCGAAGCCTTTCTTAACAACCAGGAGTATGTTCTG

GCTCACACTGAAATGCCTACCACCTTGGAAGGAGCTGAAGCAG

CAATTAAAAAGCAAGAGGACTTCATGACCACCATGGACGCCA

ATGAGGAGAAGATCAATGCTGTGGTGGAGACTGGCCGGAGGC

TGGTGAGCGATGGGAACATCAACTCAGATCGCATCCAGGAGA

AGGTGGACTCTATTGATGACAGACATAGGAAGAATCGTGAGA

CAGCCAGTGAACTTTTGATGAGGTTGAAGGACAACAGGGATCT

ACAGAAATTCCTGCAAGATTGTCAAGAGCTGTCTCTCTGGATC

AATGAGAAGATGCTCACAGCCCAGGACATGTCTTACGATGAAG

CCAGAAATCTGCACAGTAAATGGTTGAAGCATCAAGCATTTAT

GGCAGAACTTGCATCCAACAAAGAATGGCTTGACAAAATCGA

GAAGGAAGGAATGCAGCTCATTTCAGAAAAGCCTGAGACGGA

AGCTGTGGTGAAGGAGAAACTCACTGGTTTACATAAAATGTGG

GAAGTCCTTGAATCCACTACCCAGACAAAGGCCCAGCGGCTCT

TTGATGCAAACAAGGCCGAACTTTTCACCCAGAGCTGTGCAGA

TCTAGACAAATGGCTGCACGGCCTGGAGAGTCAGATTCAGTCT

GATGACTATGGCAAAGACCTGACCAGTGTCAATATCCTGCTGA

AAAAGCAACAGATGCTGGAGAATCAGATGGAAGTGCGGAAGA

AGGAGATCGAAGAGCTCCAAAGCCAAGCCCAGGCCCTGAGTC

AGGAAGGGAAGAGCACCGACGAGGTAGACAGCAAGCGCCTCA

CCGTGCAGACCAAGTTCATGGAGTTGCTGGAGCCCTTGAACGA

GAGGAAGCATAACCTGCTGGCCTCCAAAGAGATCCATCAGTTC

AACAGGGATGTGGAGGACGAGATCTTGTGGGTTGGAGAGAGG

ATGCCTTTGGCAACTTCCACGGATCATGGCCACAACCTCCAGA

CTGTGCAGCTGTTAATAAAGAAAAATCAGACCCTCCAGAAAGA

AATCCAGGGGCACCAGCCTCGCATTGACGACATCTTTGAGAGG

AGCCAAAACATCGTCACTGACAGCAGCAGCCTCAGCGCTGAG

GCCATCAGACAGAGGCTTGCCGACCTGAAGCAGCTGTGGGGTC

TCCTCATTGAGGAGACAGAGAAACGCCACAGGCGGCTGGAGG

AGGCGCACAGGGCCCAGCAGTACTACTTTGACGCTGCTGAGGC

CGAAGCCTGGATGAGCGAGCAGGAGCTGTACATGATGTCAGA

GGAGAAGGCCAAGGATGAGCAGAGTGCTGTCTCCATGTTGAA

GAAGCACCAGATCTTAGAACAAGCTGTGGAGGACTATGCAGA

GACCGTGCATCAGCTCTCCAAGACCAGCCGGGCCCTGGTGGCC

GACAGCCATCCTGAAAGTGAGCGCATTAGCATGCGGCAGTCCA

AAGTGGATAAACTGTACGCTGGTCTGAAAGACCTTGCTGAAGA

GAGAAGAGGCAAGCTGGATGAGAGACACAGGTTATTCCAGCT

CAACCGGGAGGTGGACGACCTGGAGCAGTGGATCGCTGAGAG

GGAGGTGGTCGCAGGGTCCCATGAACTGGGACAGGACTATGA

GCATGTCACGATGTTACAAGAACGATTCCGGGAGTTTGCCCGA

GACACCGGGAACATTGGGCAGGAGCGCGTGGACACGGTCAAT

CACCTGGCAGATGAGCTCATCAACTCTGGACATTCAGATGCCG

CCACCATCGCTGAATGGAAGGATGGCCTCAATGAAGCCTGGGC

CGACCTCCTGGAGCTCATTGACACAAGAACACAGATTCTTGCC

GCTTCCTATGAACTGCACAAGTTTTACCACGATGCCAAGGAGA

TCTTTGGGCGTATACAGGACAAACACAAGAAACTCCCTGAGGA

GCTTGGGAGAGATCAGAACACAGTGGAGACCTTACAGAGAAT

GCACACTACATTTGAGCATGACATCCAGGCTCTGGGCACACAG

GTGAGGCAGCTGCAGGAGGATGCAGCCCGCCTCCAGGCGGCC

TATGCGGGTGACAAGGCCGACGATATCCAGAAGCGCGAGAAC

GAGGTCCTGGAAGCCTGGAAGTCCCTCCTGGACGCCTGTGAGA

GCCGCAGGGTGCGGCTGGTGGACACAGGGGACAAGTTCCGCTT

CTTCAGCATGGTGCGCGACCTCATGCTCTGGATGGAGGATGTC

ATCCGGCAGATCGAGGCCCAGGAGAAGCCAAGGGATGTATCA

TCTGTTGAACTCTTAATGAATAATCATCAAGGCATCAAAGCTG

AAATTGATGCACGTAATGACAGTTTCACAACCTGCATTGAACT

TGGGAAATCCCTGTTGGCGAGAAAACACTATGCATCTGAGGAG

ATCAAGGAAAAATTACTGCAGTTGACGGAAAAGAGGAAAGAA

ATGATCGACAAGTGGGAAGACCGATGGGAATGGTTAAGACTG

ATTCTGGAGGTCCATCAGTTCTCAAGAGACGCCAGTGTGGCCG

AGGCCTGGCTGCTTGGACAGGAGCCGTACCTATCCAGCCGAGA

GATAGGCCAGAGCGTGGACGAGGTGGAGAAGCTCATCAAGCG

CCACGAGGCATTTGAAAAGTCTGCAGCAACCTGGGATGAGAG

GTTCTCTGCCCTGGAAAGGCTGACTACATTGGAGTTACTGGAA

GTGCGCAGACAGCAAGAGGAAGAGGAGAGGAAGAGGCGGCC

GCCTTCTCCCGAGCCGAGCACGAAGGTTTCAGAGGAAGCCGAG

TCCCAGCAGCAGTGGGATACTTCAAAAGGAGAACAAGTTTCCC

AAAACGGTTTGCCAGCTGAACAGGGATCTCCACGGGTTAGTTA

CCGCTCTCAAACCTACCAAAACTACAAAAACTTTAATAGCAGACGGACAGCCAGTGACCAGCCATGGTCTGGACTG(SEQ ID No.2)。

Mouse ghosting protein β, non-erythrocyte 1 (Sptbn 1), transcriptional variant 1, mrrnancbi reference sequence: NM_175836.2

atgacgaccacggtagccacagactatgacaacattgagatccagcagcagtacagtgatgtgaacaaccgctgggatgtggatgactgggacaatgagaacagctctgcaaggctctttgagcgctcccgcatcaaggccctggcagatgagcgtgaagctgtacagaagaagaccttcaccaagtgggtcaattcccaccttgcgagagtgtcctgccgaatcacagacctgtacacggaccttcgagatggacggatgctcatcaagctactggaggtcctctctggagagaggctgcctaaacccactaagggacggatgcggatccactgtctggagaatgtcgacaaggctcttcaattcctgaaagagcagagagtccatcttgagaacatgggctcccatgacattgtggatggaaaccaccggctgaccctcggcctcatctggacaattattctgcgcttccagatccaggatattagtgtggagactgaagataacaaagagaaaaagtctgctaaggatgcattgctgctgtggtgccagatgaagacagctgggtaccccaatgtcaacattcacaatttcaccactagctggagggatggcatggc

cttcaatgcactgatacataaacatcggcctgacctgatagattttgataaactgaagaaatctaatgcaca

ctacaatctgcagaatgcatttaacctggcagagcagcaccttggcctcactaaactgttagaccctgaag

atatcagtgtggaccaccctgatgagaagtctatcatcacatacgtggtgacttactaccactacttctcca

agatgaaggccttggctgtcgaaggaaagcgcattggaaaggtgcttgataatgctatagaaacagaga

aaatgattgagaagtacgagtcacttgcttctgaccttctggagtggattgaacaaaccatcatcatcctaa

acaaccgcaaatttgctaattcactggttggggtccagcagcagctccaggcattcaacacgtaccgcac

agtggagaaaccacctaagtttactgagaaggggaatttggaggtgctccttttcacaattcagagcaag

atgcgagcgaataatcagaaggtctacatgccccgcgaggggaagctcatctctgacatcaacaaggc

ctgggaaagactggaaaaagcagaacatgagagagaactggctctgcggaatgagctcatacggcag

gaaaaactggaacaactcgcccgaagatttgatcgcaaggcagctatgagggagacatggctgagtga

aaaccagcgtcttgtgtctcaggacaactttggatttgaccttcccgctgttgaggctgctaccaaaaaaca

cgaggccattgagacagacatcgctgcatatgaagaacgagttcaggccgtggtggctgtggccaggg

aacttgaagccgagaactaccatgacatcaagcgcatcacagcgaggaaggacaatgtcatccggctc

tgggaatacttgctggaactgctcagggccaggaggcagcgtcttgagatgaacctgggattgcaaaag

atattccaggaaatgctttatattatggactggatggatgaaatgaaggtgctattgctgtctcaagactatg

gcaaacacttacttggtgttgaagacctgttacagaagcatgccctggttgaagcagacattgcaatccaa

gcagagcgtgtaagaggtgtgaatgcctctgcccagaagtttgcaacagatggggaaggctacaagcc

atgtgacccccaggtaattcgagaccgtgttgcccacatggagttctgctatcaagagctttgtcagctgg

ctgccgagcgtagggctcgcctggaagagtcccgtcgcctctggaagttcttctgggagatggcagaa

gaggaaggctggatacgagagaaggagaagatcctgtcctctgatgattacgggaaagacttgaccag

tgtcatgcgcctgctgagcaagcaccgggcatttgaggatgagatgagtggccgtagtggccattttgag

caggccattaaagaaggtgaagacatgattgcagaggaacactttggatcggaaaagatccgtgagag

aatcatttatatccgggagcagtgggccaacctggaacagctctcagccattaggaagaagcgcctaga

ggaagcctcattactgcaccagttccaggctgatgctgatgatattgatgcttggatgttagatatactcaa

gattgtctccagcaatgatgtgggccatgatgagtactccacgcagtctctggtcaagaagcataaagat

gtagcagaagagatcaccaactacaggcccactattgacacactgcatgagcaagccagtgcccttcca

caagcacatgcagagtctccagatgtgaagggccggctggcaggaattgaggagcgctgcaaggaga

tggcagagttaacacggctaaggaagcaggctctgcaggacaccctggccctgtacaagatgttcagtg

aggctgatgcctgtgagctctggattgacgagaaggagcagtggctcaacaacatgcagatcccagag

aagctggaggacctggaagtcatccagcacagatttgagagcctagaaccagaaatgaacaaccagg

cttcccgggttgctgtggtgaaccagattgcacggcagctgatgcacaatggccaccccagtgaaaagg

aaatcagagctcagcaagacaaactcaacacgaggtggagtcagttcagagaactggtggacaggaa

aaaggatgctcttctgtctgccctgagcatccagaactaccacctcgagtgcaatgaaaccaaatcctgg

atccgggagaagaccaaggtcatcgagtctacccaagaccttggcaatgacctggcaggtgtcatggc

cctgcagcgcaagctgactggcatggaacgagacttggtagccattgaggcgaagctgagtgacctgc

agaaagaagctgagaagctggagtccgagcaccctgaccaggctcaagctatcctgtctcggctggcc

gagatcagtgatgtgtgggaggaaatgaagacaaccctgaagaaccgagaggcctccctgggagagg

ccagcaagctgcagcagtttctgcgggacttggacgacttccagtcttggctctccaggacccagactgc

tatcgcctcagaggacatgcccaataccctcactgaggcagagaagcttctcacacagcacgagaatat

caaaaatgagatcgacaattatgaggaagactaccagaagatgcgggacatgggcgagatggtcaccc

aggggcagactgatgcccagtatatgtttctgcggcagcggctgcaggccttagacactggctggaatg

agctccacaaaatgtgggagaacaggcaaaacctcctctcccagtcccatgcctaccagcagttccttag

ggacaccaaacaagctgaagcttttcttaataaccaggagtatgttttggctcatactgaaatgcccacca

ccctggaaggagctgaagcagccattaaaaagcaggaggacttcatgaccaccatggatgccaacga

ggagaagatcaatgctgttgtggagactggccgaagactggtgagcgatgggaacatcaactccgacc

gcatccaggagaaggtggactctattgacgacagacacaggaagaatcgagaagcagccagtgaactt

ctgatgaggttaaaggacaaccgtgatctacagaagttcctgcaagattgtcaagagctgtccctctggat

caatgaaaagatgcttacagctcaagacatgtcttatgatgaagccagaaatctgcacagtaaatggttaa

agcatcaagcatttatggcggaacttgcatccaacaaagaatggcttgacaaaattgagaaggaaggaa

tgcagcttatttcagaaaagccagaaacagaagctgtggtaaaggaaaaactcactggtttacataaaat

gtgggaagtccttgaatccacaacccagaccaaggcccagcggctctttgatgcaaataaggctgagct

tttcacacaaagctgcgcagatcttgacaaatggctacatggcctggagagccagattcaatctgacgac

tatggcaaagaccttaccagtgtcaatattcttctgaaaaagcaacagatgctggagaatcagatggaagt

tcggaagaaagagatcgaggaactgcagagccaagcccaggcgctgagtcaggaggggaagagca

cagatgaggtggacagcaaacgccttactgtgcagaccaagttcatggagcttctggagcccttgagtg

agaggaagcataacctgttagcttccaaggagatccatcagttcaacagggatgtggaggacgaaatcc

tatgggttggcgagaggatgcctttggcaacttccacagatcatggccataaccttcaaactgtgcagctg

ttaataaagaaaaaccagaccctccagaaagaaatccagggacaccagcctcgtattgatgacatctttg

agaggagtcaaaacatcatcacagatagcagcagcctcaatgccgaggctatcaggcagaggctcgct

gacctgaagcagctgtgggggctcctcattgaggaaactgagaaacgccatagacggctggaggagg

cacacaaggcgcagcagtactactttgatgcagctgaagccgaggcatggatgagtgaacaggagttg

tacatgatgtctgaggaaaaggccaaggatgagcagagtgctgtctctatgttgaaaaagcaccagatttt

agagcaagctgttgaggactatgcagagacagtacaccagctctccaagactagccgggcgctggtgg

ctgacagccatcccgaaagtgagcgtattagcatgcggcagtcaaaggtcgacaagctgtatgctggcc

tgaaggaccttgctgaggagaggagaggaaaacttgatgagaggcacaggctgttccagctcaacaga

gaggtggatgacctggaacagtggatcgctgagagggaagtggtcgcaggctcccatgagttgggac

aggactatgagcatgtcacgatgttacaagaacggttccgagaatttgctcgagacacaggaaacattgg

gcaggagcgtgtggatacagttaataacatggcagatgaactcatcaactctggacattcagatgctgcc

accattgctgagtggaaagatggtctcaatgaagcctgggctgacctcctggagctcattgacacaagaa

cacagattcttgctgcctcatatgaacttcataagttttaccatgatgccaaggagatctttggccgaatcca

ggacaaacacaagaaactccctgaggagcttggaagagatcaaaacactgtggaaactttacagagaa

tgcacaccacctttgagcacgacatccaagctctgggcactcaggtgaggcagctgcaggaggatgca

gctcgcctccaggcagcctatgcaggggacaaggctgatgacatccagaagcgtgagaatgaggtcct

ggaagcctggaagtccctgctggatgcttgtgagggtcgcagggtgcggctggtagacacaggagac

aagttccgcttcttcagcatggtgcgtgacctcatgctctggatggaagatgtcatccggcagatcgagg

cccaggagaaaccacgggatgtgtcatctgttgaactgttaatgaataatcatcaaggtatcaaagctgaa

attgatgctcgtaatgacagctttacagcctgcattgagcttgggaaatccctgctggcacggaaacacta

tgcttctgaggagatcaaggaaaagttactgcagctgacagagaaaagaaaagaaatgattgacaagtg

ggaagaccggtgggagtggttaagactgattttggaggtccatcagttctcaagggatgccagtgtggc

agaggcttggctgcttggacaggaaccatacctatccagccgtgaaattggccagagtgtagacgaagt

ggagaagcttattaagcgccatgaggcgtttgaaaagtctgcagcgacctgggatgagagattctctgct

ctggaaaggctgacaacgttggagctactggaagtgcgcagacagcaagaggaagaagaaagaaag

aggcggccaccttctccggacccaaacacgaaggtttcagaggaggctgagtcccagcaatgggatac

ttcaaaaggagaccaagtttcccagaatggtttgccggctgagcagggatctccacggatggcaggaac

catggaaacgagtgaaatggtcaacggtgctgctgagcagaggacaagctccaaagagtccagtcctg

ttccctctcccaccttggaccgaaaggccaaatctgcacttccagcccagagtgctgccaccctgccagc

caggaccctggagacacccgctgcccagatggaaggcttcctcaatcggaagcatgagtgggaggcc

cacaataagaaagcctcgagcaggtcctggcacaatgtatattgtgtcataaataaccaagaaatgggct

tctataaagatgccaagagtgctgcttctggcatcccctaccacagtgaggtccctgtgagtttgaaagag

gccatctgcgaagtggcccttgattacaaaaagaagaagcacgtgttcaagctaagactaagtgatgga

aacgagtacctcttccaagccaaagatgatgaggaaatgaacacatggatccaggctatctcctctgcca

tctcctctgacaaacacgacacatctgccagcacccagagtacgccagcatccagtcgggcgcagacc

ttacccaccagcgtcgtcaccatcaccagcgagtccagtcctggcaagagggagaaggataaagagaaagacaaagagaagaggttcagccttttcggcaagaagaagtga(SEQ ID No.3)。

Mouse ghosting protein β, non-erythrocyte 1 (Sptbn 1), transcriptional variant 2, mrrnancbi reference sequence: NM_009260.2

ATGGAGTTGCAGAGGACATCCAGCATTTCAGGGCCGCTGTCGCCGGCCTACACCGGGCAGGTGCCTTACAACTACAACCAACTGGAAGGAAGATTCAAACAGCTCCAAGATGAGCGTGAAGCTGTACAGAAGAAGACCTTCACCAAGTGGGTCAATTCCCACCTTGCGAGAGTGTCCTGCCGAATCACAGACCTGTACACGGACCTTCGAGATGGACGGATGCTCATCAAGCTACTGGAGGTCCTCTCTGGAGAGAGGCTGCCTAAACCCACTAAGGGACGGATGCGGATCCACTGTCTGGAGAATGTCGACAAGGCTCTTCAATTCCTGAAAGAGCAGAGAGTCCATCTTGAGAACATGGGCTCCCATGACATTGTGGATGGAAACCACCGGCTGACCCTCGGCCTCATCTGGACAATTATTCTGCGCTTCCAGATCCAGGATATTAGTGTGGAGACTGAAGATAACAAAGAGAAAAAGTCTGCTAAGGATGCATTGCTGCTGTGGTGCCAGATGAAGACAGCTGGGTACCCCAATGTCAACATTCACAATTTCACCACTAGCTGGAGGGATGGCATGGCCTTCAATGCACTGATACATAAACATCGGCCTGACCTGATAGATTTTGATAAACTGAAGAAATCTAATGCACACTACAATCTGCAGAATGCATTTAACCTGGCAGAGCAGCACCTTGGCCTCACTAAACTGTTAGACCCTGAAGATATCAGTGTGGACCACCCTGATGAGAAGTCTATCATCACATACGTGGTGACTTACTACCACTACTTCTCCAAGATGAAGGCCTTGGCTGTCGAAGGAAAGCGCATTGGAAAGGTGCTTGATAATGCTATAGAAACAGAGAAAATGATTGAGAAGTACGAGTCACTTGCTTCTGACCTTCTGGAGTGGATTGAACAAACCATCATCATCCTAAACAAC

CGCAAATTTGCTAATTCACTGGTTGGGGTCCAGCAGCAGCTCC

AGGCATTCAACACGTACCGCACAGTGGAGAAACCACCTAAGTT

TACTGAGAAGGGGAATTTGGAGGTGCTCCTTTTCACAATTCAG

AGCAAGATGCGAGCGAATAATCAGAAGGTCTACATGCCCCGC

GAGGGGAAGCTCATCTCTGACATCAACAAGGCCTGGGAAAGA

CTGGAAAAAGCAGAACATGAGAGAGAACTGGCTCTGCGGAAT

GAGCTCATACGGCAGGAAAAACTGGAACAACTCGCCCGAAGA

TTTGATCGCAAGGCAGCTATGAGGGAGACATGGCTGAGTGAA

AACCAGCGTCTTGTGTCTCAGGACAACTTTGGATTTGACCTTCC

CGCTGTTGAGGCTGCTACCAAAAAACACGAGGCCATTGAGACA

GACATCGCTGCATATGAAGAACGAGTTCAGGCCGTGGTGGCTG

TGGCCAGGGAACTTGAAGCCGAGAACTACCATGACATCAAGC

GCATCACAGCGAGGAAGGACAATGTCATCCGGCTCTGGGAAT

ACTTGCTGGAACTGCTCAGGGCCAGGAGGCAGCGTCTTGAGAT

GAACCTGGGATTGCAAAAGATATTCCAGGAAATGCTTTATATT

ATGGACTGGATGGATGAAATGAAGGTGCTATTGCTGTCTCAAG

ACTATGGCAAACACTTACTTGGTGTTGAAGACCTGTTACAGAA

GCATGCCCTGGTTGAAGCAGACATTGCAATCCAAGCAGAGCGT

GTAAGAGGTGTGAATGCCTCTGCCCAGAAGTTTGCAACAGATG

GGGAAGGCTACAAGCCATGTGACCCCCAGGTAATTCGAGACC

GTGTTGCCCACATGGAGTTCTGCTATCAAGAGCTTTGTCAGCTG

GCTGCCGAGCGTAGGGCTCGCCTGGAAGAGTCCCGTCGCCTCT

GGAAGTTCTTCTGGGAGATGGCAGAAGAGGAAGGCTGGATAC

GAGAGAAGGAGAAGATCCTGTCCTCTGATGATTACGGGAAAG

ACTTGACCAGTGTCATGCGCCTGCTGAGCAAGCACCGGGCATT

TGAGGATGAGATGAGTGGCCGTAGTGGCCATTTTGAGCAGGCC

ATTAAAGAAGGTGAAGACATGATTGCAGAGGAACACTTTGGA

TCGGAAAAGATCCGTGAGAGAATCATTTATATCCGGGAGCAGT

GGGCCAACCTGGAACAGCTCTCAGCCATTAGGAAGAAGCGCCT

AGAGGAAGCCTCATTACTGCACCAGTTCCAGGCTGATGCTGAT

GATATTGATGCTTGGATGTTAGATATACTCAAGATTGTCTCCAG

CAATGATGTGGGCCATGATGAGTACTCCACGCAGTCTCTGGTC

AAGAAGCATAAAGATGTAGCAGAAGAGATCACCAACTACAGG

CCCACTATTGACACACTGCATGAGCAAGCCAGTGCCCTTCCAC

AAGCACATGCAGAGTCTCCAGATGTGAAGGGCCGGCTGGCAG

GAATTGAGGAGCGCTGCAAGGAGATGGCAGAGTTAACACGGC

TAAGGAAGCAGGCTCTGCAGGACACCCTGGCCCTGTACAAGAT

GTTCAGTGAGGCTGATGCCTGTGAGCTCTGGATTGACGAGAAG

GAGCAGTGGCTCAACAACATGCAGATCCCAGAGAAGCTGGAG

GACCTGGAAGTCATCCAGCACAGATTTGAGAGCCTAGAACCAG

AAATGAACAACCAGGCTTCCCGGGTTGCTGTGGTGAACCAGAT

TGCACGGCAGCTGATGCACAATGGCCACCCCAGTGAAAAGGA

AATCAGAGCTCAGCAAGACAAACTCAACACGAGGTGGAGTCA

GTTCAGAGAACTGGTGGACAGGAAAAAGGATGCTCTTCTGTCT

GCCCTGAGCATCCAGAACTACCACCTCGAGTGCAATGAAACCA

AATCCTGGATCCGGGAGAAGACCAAGGTCATCGAGTCTACCCA

AGACCTTGGCAATGACCTGGCAGGTGTCATGGCCCTGCAGCGC

AAGCTGACTGGCATGGAACGAGACTTGGTAGCCATTGAGGCG

AAGCTGAGTGACCTGCAGAAAGAAGCTGAGAAGCTGGAGTCC

GAGCACCCTGACCAGGCTCAAGCTATCCTGTCTCGGCTGGCCG

AGATCAGTGATGTGTGGGAGGAAATGAAGACAACCCTGAAGA

ACCGAGAGGCCTCCCTGGGAGAGGCCAGCAAGCTGCAGCAGT

TTCTGCGGGACTTGGACGACTTCCAGTCTTGGCTCTCCAGGACC

CAGACTGCTATCGCCTCAGAGGACATGCCCAATACCCTCACTG

AGGCAGAGAAGCTTCTCACACAGCACGAGAATATCAAAAATG

AGATCGACAATTATGAGGAAGACTACCAGAAGATGCGGGACA

TGGGCGAGATGGTCACCCAGGGGCAGACTGATGCCCAGTATAT

GTTTCTGCGGCAGCGGCTGCAGGCCTTAGACACTGGCTGGAAT

GAGCTCCACAAAATGTGGGAGAACAGGCAAAACCTCCTCTCCC

AGTCCCATGCCTACCAGCAGTTCCTTAGGGACACCAAACAAGC

TGAAGCTTTTCTTAATAACCAGGAGTATGTTTTGGCTCATACTG

AAATGCCCACCACCCTGGAAGGAGCTGAAGCAGCCATTAAAA

AGCAGGAGGACTTCATGACCACCATGGATGCCAACGAGGAGA

AGATCAATGCTGTTGTGGAGACTGGCCGAAGACTGGTGAGCGA

TGGGAACATCAACTCCGACCGCATCCAGGAGAAGGTGGACTCT

ATTGACGACAGACACAGGAAGAATCGAGAAGCAGCCAGTGAA

CTTCTGATGAGGTTAAAGGACAACCGTGATCTACAGAAGTTCC

TGCAAGATTGTCAAGAGCTGTCCCTCTGGATCAATGAAAAGAT

GCTTACAGCTCAAGACATGTCTTATGATGAAGCCAGAAATCTG

CACAGTAAATGGTTAAAGCATCAAGCATTTATGGCGGAACTTG

CATCCAACAAAGAATGGCTTGACAAAATTGAGAAGGAAGGAA

TGCAGCTTATTTCAGAAAAGCCAGAAACAGAAGCTGTGGTAAA

GGAAAAACTCACTGGTTTACATAAAATGTGGGAAGTCCTTGAA

TCCACAACCCAGACCAAGGCCCAGCGGCTCTTTGATGCAAATA

AGGCTGAGCTTTTCACACAAAGCTGCGCAGATCTTGACAAATG

GCTACATGGCCTGGAGAGCCAGATTCAATCTGACGACTATGGC

AAAGACCTTACCAGTGTCAATATTCTTCTGAAAAAGCAACAGA

TGCTGGAGAATCAGATGGAAGTTCGGAAGAAAGAGATCGAGG

AACTGCAGAGCCAAGCCCAGGCGCTGAGTCAGGAGGGGAAGA

GCACAGATGAGGTGGACAGCAAACGCCTTACTGTGCAGACCA

AGTTCATGGAGCTTCTGGAGCCCTTGAGTGAGAGGAAGCATAA

CCTGTTAGCTTCCAAGGAGATCCATCAGTTCAACAGGGATGTG

GAGGACGAAATCCTATGGGTTGGCGAGAGGATGCCTTTGGCAA

CTTCCACAGATCATGGCCATAACCTTCAAACTGTGCAGCTGTT

AATAAAGAAAAACCAGACCCTCCAGAAAGAAATCCAGGGACA

CCAGCCTCGTATTGATGACATCTTTGAGAGGAGTCAAAACATC

ATCACAGATAGCAGCAGCCTCAATGCCGAGGCTATCAGGCAG

AGGCTCGCTGACCTGAAGCAGCTGTGGGGGCTCCTCATTGAGG

AAACTGAGAAACGCCATAGACGGCTGGAGGAGGCACACAAGG

CGCAGCAGTACTACTTTGATGCAGCTGAAGCCGAGGCATGGAT

GAGTGAACAGGAGTTGTACATGATGTCTGAGGAAAAGGCCAA

GGATGAGCAGAGTGCTGTCTCTATGTTGAAAAAGCACCAGATT

TTAGAGCAAGCTGTTGAGGACTATGCAGAGACAGTACACCAGC

TCTCCAAGACTAGCCGGGCGCTGGTGGCTGACAGCCATCCCGA

AAGTGAGCGTATTAGCATGCGGCAGTCAAAGGTCGACAAGCT

GTATGCTGGCCTGAAGGACCTTGCTGAGGAGAGGAGAGGAAA

ACTTGATGAGAGGCACAGGCTGTTCCAGCTCAACAGAGAGGTG

GATGACCTGGAACAGTGGATCGCTGAGAGGGAAGTGGTCGCA

GGCTCCCATGAGTTGGGACAGGACTATGAGCATGTCACGATGT

TACAAGAACGGTTCCGAGAATTTGCTCGAGACACAGGAAACAT

TGGGCAGGAGCGTGTGGATACAGTTAATAACATGGCAGATGA

ACTCATCAACTCTGGACATTCAGATGCTGCCACCATTGCTGAG

TGGAAAGATGGTCTCAATGAAGCCTGGGCTGACCTCCTGGAGC

TCATTGACACAAGAACACAGATTCTTGCTGCCTCATATGAACT

TCATAAGTTTTACCATGATGCCAAGGAGATCTTTGGCCGAATC

CAGGACAAACACAAGAAACTCCCTGAGGAGCTTGGAAGAGAT

CAAAACACTGTGGAAACTTTACAGAGAATGCACACCACCTTTG

AGCACGACATCCAAGCTCTGGGCACTCAGGTGAGGCAGCTGCA

GGAGGATGCAGCTCGCCTCCAGGCAGCCTATGCAGGGGACAA

GGCTGATGACATCCAGAAGCGTGAGAATGAGGTCCTGGAAGC

CTGGAAGTCCCTGCTGGATGCTTGTGAGGGTCGCAGGGTGCGG

CTGGTAGACACAGGAGACAAGTTCCGCTTCTTCAGCATGGTGC

GTGACCTCATGCTCTGGATGGAAGATGTCATCCGGCAGATCGA

GGCCCAGGAGAAACCACGGGATGTGTCATCTGTTGAACTGTTA

ATGAATAATCATCAAGGTATCAAAGCTGAAATTGATGCTCGTA

ATGACAGCTTTACAGCCTGCATTGAGCTTGGGAAATCCCTGCT

GGCACGGAAACACTATGCTTCTGAGGAGATCAAGGAAAAGTT

ACTGCAGCTGACAGAGAAAAGAAAAGAAATGATTGACAAGTG

GGAAGACCGGTGGGAGTGGTTAAGACTGATTTTGGAGGTCCAT

CAGTTCTCAAGGGATGCCAGTGTGGCAGAGGCTTGGCTGCTTG

GACAGGAACCATACCTATCCAGCCGTGAAATTGGCCAGAGTGT

AGACGAAGTGGAGAAGCTTATTAAGCGCCATGAGGCGTTTGA

AAAGTCTGCAGCGACCTGGGATGAGAGATTCTCTGCTCTGGAA

AGGCTGACAACGTTGGAGCTACTGGAAGTGCGCAGACAGCAA

GAGGAAGAAGAAAGAAAGAGGCGGCCACCTTCTCCGGACCCA

AACACGAAGGTTTCAGAGGAGGCTGAGTCCCAGCAATGGGAT

ACTTCAAAAGGAGACCAAGTTTCCCAGAATGGTTTGCCGGCTG

AGCAGGGATCTCCACGGGTTAGTTACCGCTCTCAAACGTACCA

AAACTACAAAAACTTTAATAGCAGACGGACAGCCAGTGACCATTCATGGTCTGGAATG(SEQ ID No.4)。

Sptbn 1-targeted mouse SiRNA

Target sequence:

sense: CGAUGUUACAAGAACGGUUTT (SEQ ID No. 5).

Antisense: AACCGUUCUUGUAACAUCGTG (SEQ ID No. 6).

Human siRNA targeting

Target sequence: CCUGAAAGUGAGCGCAUUA (SEQ ID No. 7).

Target sequence: CCGCAUACGAGGAGCGUGU (SEQ ID No. 8).

Target sequence: GGACAUGUCUUACGAUGAA (SEQ ID No. 9).

Target sequence: GUGACAAGGCCGACGAUAU (SEQ ID No. 10).

Example 1

Liver-specific SPTBN1 knockout protects mice from HFD-induced NASH

Liver-specific conditional SPTBN1 (SPTBN 1-flox) knockout mice (LSKO) were generated without hepatocytes SPTBN1 (supplementary fig. 1A, B). LSKO mice are alive and capable of reproduction. The hepatocyte-specific SPTBN1 deletion was confirmed by the absence of detectable proteins by immunoblotting or immunohistochemical staining (supplementary fig. 1B, C). Liver histology and metabolic status of LSKO mice fed a normal food diet were characterized (supplementary fig. 1D to H). Under normal diet, LSKO mice were similar in body weight to Flox control mice (supplement fig. 1E), but LSKO showed a significant decrease in serum Triglyceride (TG) (supplement fig. 1F) and blood glucose (supplement fig. 1G) concentrations, with a slight increase in insulin sensitivity in the insulin resistance test (supplement fig. 1H). Histologically, the liver of LSKO mice had reduced lipid accumulation compared to Flox mice (supplementary fig. 1D). In addition, LSKO mice and Flox control mice had similar food and water intake and urine output (supplementary fig. 2A).

LSKO mice were used to evaluate the effect of HFD. Male and female Flox controls of 10-12 weeks of age and LSKO mice were placed in HFD for 12 to 20 weeks (FIG. 1A). HFD has 60% calories from fat (29-31). Food and water intake and urine output between Flox control and LSKO mice were similar after 12 weeks of HFD (supplemental fig. 2A). However, LSKO mice gained less weight, had less visceral fat, and were protected from HFD-induced obesity after 12 weeks of HFD (fig. 1B). Metabolic profile showed that LSKO mice fed HFD had lower concentrations of serum Triglycerides (TG), but serum glucose and total cholesterol concentrations were similar to the Flox control mice fed HFD (fig. 1C). The liver of LSKO mice fed HFD was smaller than the Flox control mice fed HFD (fig. 1D), although both mice genotypes had a Ki67 signature of comparable proliferating cells in their livers (supplementary fig. 2B). Analysis of liver function by measuring serum aspartate Aminotransferase (AST) and alanine Aminotransferase (ALT) concentrations showed a decrease in concentration in LSKO mice, indicating that HFD-fed LSKO mice had better liver function and less liver damage than HFD-fed Flox control mice (fig. 1D).

Consistent with less liver damage in HFD-fed LSKO mice, liver histology of these mice showed normal liver structure, minimal lipid accumulation, and no possible balloon-like or inflammatory signs in the liver (fig. 1E). In livers of HFD fed Flox mice, electron microscopy showed fibrosis (indicated by collagen deposition at extracellular matrix) and steatosis (indicated by accumulation of lipid droplets); these changes were not present in the liver of HFD fed LSKO mice (fig. 1F). Liver from LSKO mice had reduced expression of TGF- β/SMAD3 regulated genes associated with liver fibrosis, altered expression of genes associated with inflammation, and reduced expression of genes encoding proteins involved in fatty acid metabolism compared to liver from Flox mice fed HFD for 16 weeks (fig. 1G).

Changes in Flox control mice indicate that these mice develop NAFLD after 16 weeks of HFD, progressing to NASH. Furthermore, LSKO mice are protected from this diet-induced liver condition. LSKO mice fed HFD were found to be protected from developing obesity and NAFLD and progressing to NAFLD, as well as HCC.

Example 2

SPTBN1 regulates SREBP pathway and fatty acid metabolism

To understand how liver-specific SPTBN1 loss protected mice from liver disease, targeting studies were performed on specific key regulatory factors in Flox and LSKO mice fed HFD for 16 weeks, and overall liver transcript analysis of RNA sequencing (RNA-seq) data was performed to explore differences in gene expression in livers of Flox and LSKO mice after HFD for 16 weeks. Transcriptional regulator C/ebpα (32) regulating adipogenesis and the transcription and protein abundance of uncoupling protein 2 (UCP 2) (33) reducing mitochondrial ATP production and associated with NASH were examined. These were not different in transcript or protein abundance levels in livers of HFD fed Flox and LSKO mice (supplementary fig. 2C). Bioinformatic analysis by bioreaction pathway analysis (IPA) showed that several pathways associated with differentially expressed genes were associated with stress or infection (fig. 2A). Biological response to differential regulatory genes in LSKO mice "upstream regulator" analysis indicated a reduced or low activity associated with the transcription factors SREBP, pparγ (peroxisome proliferator-activated receptor γ) and pparα -and XBP1 (transcription factor activated by ER stress) controlling lipid and cholesterol metabolism (fig. 2A). Considering the correlation between loss of SPTBN1 and reduction of SREBP and PPARG lipid pathways in liver, limited mass spectral data was examined to determine proteins co-immunoprecipitated with V5-labeled SPTBN1 from stressed HEK293T cells, and which involved the production of or modulation of from head fat (table 3). Unexpectedly, SREBP1 is a potential binding partner for SPTBN1 based on those data. Therefore, SREBP1 is attracting attention.

Table 3: mass spectrum Sptbn1 was pulled down in HEK293T cells.

OST48_HUMAN
	HNRH1_HUMAN
IF4A1_HUMAN
	TBB5_HUMAN
AZI2_HUMAN
	IMPG1_HUMAN
G3P_HUMAN
	GLIS1_HUMAN
SHRM3_HUMAN
	ALMS1_HUMAN
PHB_HUMAN
	DNJC2_HUMAN
KPYM_HUMAN
	SREBP1_HUMAN
CM035_HUMAN
	ACTA_HUMAN
RSSA_HUMAN
	ECHB_HUMAN
NONO_HUMAN

Because SPTBN1 has a scaffolding function in both cytoplasm and nucleus, an evaluation was made to see if SREBP1 distribution or abundance was altered in liver of LSKO mice fed normal diet or HFD. In livers of Flox mice fed normal diet, SREBP1 had a dense punctate distribution, with few cells showing nuclear staining (fig. 2B, bottom panel). In mice fed HFD for 12-16 weeks, most hepatocytes in the liver from Flox control mice had nuclear localized SREBP1, consistent with SREBP1 activation. SREBP1 staining was less dense in the liver from LSKO mice fed normal diet or HFD, and fewer cells had nuclear SREBP1 in the liver from LSKO mice fed HFD, indicating that fewer SREBPs 1 were active (fig. 2B). In normal diet fed mice, no difference in SREBP1 transcript abundance was detected in livers from the Flox control and LSKO mice (supplementary fig. 2D), indicating that the decrease in SREBP1 abundance was not mediated at the gene expression level.

There are 2 genes encoding SREBP1 and SREBP2, thus the abundance of precursor SREBP (ER localized, full length SREBP) and n-SREBP (lysed, nuclear SREBP) of these two proteins, as well as their abundance of ER localized modulators SCAP and INSIG in the livers of Flox and LSKO mice fed normal diet or HFD for 12-16 weeks, were assessed. SCAP and INSIG abundances were similar between Flox and LSKO mice in normal diet or HFD groups, with SCAP showing a sustained decrease in abundance in HFD fed mice (fig. 2C). Furthermore, the spibn 1 knock down by siRNA in THLE2 human hepatocytes did not affect the INSIG1 abundance (supplementary fig. 2E). Although variable in individual mice, the abundance of precursor SREBP1 and n-SREBP1 in the livers of LSKO mice fed normal diet or HFD appeared to be reduced compared to the abundance in livers of Flox control mice fed normal diet (fig. 2C). In HFD fed mice, the abundance of precursor SREBP2 was similar or slightly less in the livers of Flox control mice, but the amount of n-SREBP2 appeared similar or slightly less in LSKO mice livers (fig. 2C). Thus, the decrease in SREBP1 abundance detected by immunohistochemistry and immunoblotting in LSKO mouse livers is not achieved by altering the abundance of regulatory factors for SREBP ER localization or compromising SREBP1 gene expression.

To determine if a decrease in SREBP1 in LSKO mouse liver corresponds to a decrease in SREBP1 target gene expression, transcript and protein abundance from the head lipogenic gene product or luciferase reporter assays using SRE-containing promoters were analyzed. In livers of mice fed normal food or HFD for 12-16 weeks, ACC1 (encoding acetyl CoA carboxylase 1), SCD1 (encoding stearoyl CoA desaturase 1) and FASN (encoding fatty acid synthase) were less in LSKO tissues, and these changes were also reflected in less protein (fig. 2D, E). Thus, reduced expression of the SREBP1 target gene was detected in the absence of SPTBN 1. Consistent with the minimal differences in SREBP2 abundance observed in livers of Flox and LSKO mice, transcripts of LDLR (primary targets of SREBP2 in cholesterol metabolism) were found (34) to be similar to livers of mice, and also the amounts of LDLR protein were found to be similar (fig. 2D, E). The data indicate that SPTBN1 primarily regulates SREBP1 and not SREBP2.

SREBP responsive luciferase assay Using a luciferase reporter containing wild type SRE (LDLR-luc) from the LDLR promoter region, SREBP non-responsive mutant SRE (mut-LDLR-luc) or SRE (SCD-luc) from the SCD1 promoter, and in the case of a mutant strain from wild type mice and systemic Sptbn1 ^-/- Isolated Mouse Embryonic Fibroblasts (MEF) cells. Serum starvation (35) of SREBP activation in cultured cells was found to increase SRE-dependent LDL-luc and SCD-luc activity in wild-type MEF, and was found to be found in Sptbn1 ^-/- No or minimal SRE-dependent luciferase activity was detected in the cells (fig. 2F), indicating impaired SREBP 1-dependent target gene expression in the absence of SPTBN 1. At Sptbn1 ^-/- Re-expression of SPTBN1 in MEF cells restored SRE-dependent luciferase activity (fig. 2G). An evaluation was performed to see if TGF- β stimulated SRE-dependent gene expression and found that TGF- β stimulated SRE-dependent luciferase activity in a SPTBN 1-dependent manner (fig. 2F), indicating that TGF- β signaling involving SPTBN1 may also lead to de novo adipogenesis.

Use in WT or SMAD3 ^-/- Luciferase reporter expressed in MEF was examined to see if TGF- β signaling through SMAD3 affected SRE-dependent gene expression. SRE-driven gene expression SMAD3 was observed ^-/- Trend of MEF increase (fig. 2H, left panel). TGF-beta stimulated luciferase expression was from WT MEF instead of SMAD3 as a positive control ^-/- SMAD-dependent promoters in MEFs (fig. 2H, right panel). These data indicate that TGF- β signaling through SMAD3 is not responsible for TGF- β mediated enhancement of SRE-dependent gene expression.

Example 3

SPTBN1 binding to SREBP1

To verify mass spectral data (table 3) indicating that SPTBN1 and SREBP1 are part of the same complex, SPTBN1 was immunoprecipitated from 3 HCC cell lines. Precursor SREBP1 and n-SREBP1 were detected in immunoprecipitates from all 3 cell lines (FIG. 3A, supplementary FIG. 3A), and interactions between SPTBN1 and precursor SREBP1 occurred in the cytoplasm (supplementary FIG. 3B).

To explore the structural basis of SPTBN1 and SREBP1 binding and map their potential interaction sites, the three-dimensional structure of SPTBN1 and SREBP1c was modeled, followed by structure-based molecular docking simulations. There are 2 splice variants of SREBP 1: SREBP1a and SREBP1c (36). SREBP1c was chosen for molecular docking simulation as this is a form that specifically stimulates fatty acid synthesis and is associated with liver steatosis (37).

SPTBN1 comprises 2,364 amino acid residues and is characterized by a plurality of homologous tandem ghost protein repeats, each comprising three antiparallel helices flanked on the N-terminal side by a pair of Calmodulin Homology (CH) domains and on the C-terminal side by a Pleckstrin Homology (PH) domain (fig. 3B). SPTBN1 has a caspase-3 cleavage site in the 11 th ghost repeat (1454 DEVD 1457). SREBP1C comprises 1,047 amino acid residues that form an N-terminal DNA binding domain (bH LH), two transmembrane domains (each with a cleavage site in the middle), and a regulatory domain located at the C-terminus. SREBP1c has a caspase-3 cleavage site (433 SEPDSP 438) prior to the transmembrane domain (12) (FIG. 3B).

For modeling, SPTBN1 was examined in three fragments covering D50-T975 and Q1132-T2155 (FIG. 3C) and A2198-K2364 (supplementary FIG. 3C); SREBP1C is modeled in two fragments covering Q295-K374 (FIG. 3C) and P546-S705. SREBP1c P546-S705 cannot dock onto SPTBN 1. However, the interactions between the SREBP1C Q295-K374 fragments and SPTBN1 were successfully simulated (FIG. 3C, D; supplementary FIG. 3C; table 4).

The model predicts that SREBP1c Q295-K374 has a high affinity conformational fit within the binding cavity of SPTBN1 and that interactions are stabilized by multiple hydrogen bonds and van der waals interactions (table 4). Based on the lowest interaction energy values (38, 39), the predictive models were ranked as having the following affinities (table 4): SREBP1C Q295-K374/SPTBN 1Q 1132-T2155 (FIG. 3D) > SREBP1C Q295-K374/SPTBN 1D 50-T975 (FIG. 3C) > > SREBP1cQ295-K374/SPTBN 1A 2198-K2364 (supplementary FIG. 3C). In summary, docking analysis predicts that the SPTBN1 fragments D50-T975 and Q1132-T2155 are the preferred SREBP1c Q295-K374 binding sites.

Table 4: predicted interaction residues of SPTBN1 and SREBP1_C fragments

BY23IM14688FGPC-CN

To test the predictive model, SREBP1 fragments and SPTBN1 fragments were generated to identify the regions required for their interaction. N-SREBP1 (amino acids M1-L466) was started and four fragments were generated (FIG. 3D). Fragment 2 of SREBP1 corresponds to the modeling moiety (Q295-K374) and was most efficiently co-immunoprecipitated with full-length V5-tagged SPTBN1 (FIG. 3D). In practice, this region is required for interaction. Caspase-3 cleaves SPTBN1 into two products, N-SPTBN1 (amino acids M1-D1454) and C-SPTBN1 (E1455-K2364), which are detected in acetaminophen-damaged liver (27). N-SPT BN1 and C-SPTBN1 were generated and labeled with V5, and only N-SPTBN1 was found to co-immunoprecipitate with Flag-labeled N-SREBP1 (FIG. 3E). These data indicate that SPTBN1 and SREBP1 can interact directly. For modeling and fragment interaction analysis, it is assumed that conditions that cause caspase-3 activation in cells result in cleavage of SPTBN1, which promotes the interaction between N-SPTBN1 and N-SREBP 1.

Example 4

Cell stress induces caspase-3 dependent cleavage of SREBP1 and SPTBN1 in human hepatocytes and HCC cells

Stress-induced caspase activation is associated with the NASH phenotype (8, 9). The RNA-seq data revealed alterations in ER stress and UPR pathway in livers of LSKO mice fed HFD (fig. 2A). Because both SREBP1 and SPTBN1 are caspase-3 substrates (12, 27) and the interaction data indicate their cleavage product interactions (fig. 3e, f), the relationship between caspase-3, SPTBN1 and SREBP1 was explored in immortalized human hepatocellular cell lines THLE2 and HCC cell line Huh 7. TNFα and cycloheximide or Palmitoyl Acid (PA) are used to induce caspase-3 activation. Tnfα and PA induce caspase-3 activation in hepatocytes (40, 41) and are associated with NASH development (42, 43). THLE2 cells exposed to tnfα and cycloheximide exhibited caspase-3 activation (cleaved caspase-3), SREBP1 activation (N-SREBP 1) and SPTBN1 cleavage to produce N-SPTBN1 and C-SPTBN1 (fig. 4A). Analysis of cytoplasmic and nuclear distributions of N-SPTBN1 and C-SPTBN1 expressed as V5 marker proteins in THLE2 cells showed that N-SPTBN1 was present in the cytoplasm and nucleus, whereas C-SPTBN1 was detected only in the cytoplasm (FIG. 4B). The knockdown of SPTBN1 in Huh7 cells did not impair tnfα and cycloheximide induced caspase-3 activation or cleavage of SREBP1 under these conditions (fig. 4C). However, the expression of SCD1 (SREBP 1 target gene) was reduced (fig. 4C). In this HCC cell line exposed to tnfα and cycloheximide, impaired expression of SREBP2 target gene LDLR was observed (fig. 4D), in contrast to findings in the liver of normal food-fed LSKO mice (fig. 2E), and may be associated with a lack of stress in vivo conditions.

Huh7 cells were exposed to PA-induced caspase-3 activation, which was reduced by caspase-3 inhibitors (Z-DEVD-FMK) (FIG. 4E). PA also triggered cleavage of SPTBN1, which was also reduced by caspase-3 inhibitors, indicating that STPBN1 cleavage was dependent on caspase-3 activity (fig. 4E). The precursors SREBP1 and SPTBN1 and N-SPTBN1 were found to co-immunoprecipitate from PA-exposed Huh7 cells, consistent with the interaction between SREBP1 and SPTBN1 with caspase-3 cleavage product N-SPTBN1 (FIG. 4F). N-SREBP was found to be reduced in PA-treated cells, where SPTBN1 was knocked down, even though caspase-3 activation was not affected, indicating that interactions with SPTBN1 could stabilize N-SREBP1 (FIG. 4G).

In stressed hepatocytes or hepatocytes cultured with large amounts of PA, caspase-3 cleaves SREBP1 and SPTBN1, and the cleavage products interact to stabilize the nuclear form of SREBP1, thereby promoting de novo adipogenesis.

The biochemical data provides a mechanistic link between non-apoptotic caspase-3 activity and de novo adipogenesis of nsrebasp 1 through formation of nsrebasp and stabilization of nsrebasp 1 through interaction with caspase-cleaved N-SPTNB 1. In addition to ER stress induced SREBP activation, this provides a second pathway for aberrant activation of de novo adipogenesis leading to steatosis and NAFLD development. The data indicate that caspase-mediated activation of SREBP1 is independent of changes in SCAP and INSIG (ER localization regulator of SREBP activation) (6, 52); thereby bypassing the normal control of limiting de novo adipogenesis under conditions of sufficient or excess lipid.

Example 5

Human NASH is associated with increased SPTBN1 and CASPASE3 expression and increased TGF-beta pathway and SREBP1 activity

To understand the correlation of findings involving SPTBN1 with pathways involving caspase-3 mediated interactions between cleavage products of SPTBN1 and SREBP1 in steatosis, data from four publicly available databases with information on healthy obese subjects and patients with NAFLD, NASH or HCC were analyzed. Biological response "upstream regulator" assays were used to evaluate proteins associated with differences in gene expression between NASH early (NASH 1 and 2) and NAFLD and NASH late (NASH 3 and 4) and NAFLD. Consistent with involvement of TGF- β signaling in fibrosis, which is a key indicator of NASH progression from NAFLD (14, 44, 45), upstream mediators with increased activity include several proteins in the TGF- β pathway, and the only down-regulated protein is SMAD7, an inhibitor of TGF- β signaling (fig. 5A).

Liver tissue data from healthy obesity was compared to liver tissue data from NASH patients to obtain transcripts of SPTBN1, CASPASE-3, SREBP1 and SMAD3, as well as SREBP1 target genes involved in adipogenesis. SPTBN1 and CASPASE-3 transcripts were both increased in NASH patients, whereas no difference was observed for SREBP1 and SMAD3 (FIG. 5B). The expression of FASN, SCD and AACS was found to be significantly increased, indicating an increase in SREBP1 activity (fig. 5C).

Because NASH represents a high risk of progression to HCC (1), single cell RNA-seq was performed in liver tissue from patients with NASH and HCC but not with cirrhosis to obtain SPTBN1 expression. Cell subsets with high SPTBN1 expression were identified (fig. 5D, table 1): 5 hepatocyte subtypes (Hep-1, hep-4, hep-5, hep-6 and Hep-7), two types of cholangiocytes (Chol-1 and Chol-2) and portal hepatic sinus endothelial cells (LSEC-PP). Analysis of single cell RNA-seq data showed that hepatocytes with high SPTBN1 expression aggregated together when plotted on a phenotype map (fig. 5E). It was confirmed that the abundance of SPTBN1 in liver tissue from NASH patients was greater than that of SPTBN1 in liver tissue from healthy controls (fig. 5F).

In summary, this assessment of human NASH liver data is consistent with findings from HFD fed mice that indicate that SPTBN1 is involved in the progression of this disorder. Furthermore, these data demonstrate the activity of increased SPTBN1 and caspase-3, as well as increased TGF- β/SMAD signaling and SREBP 1-dependent gene expression in NASH.

Example 6

Attenuation of HFD-induced NAFLD and NASH by in vivo siRNA targeting SPTBN1

Liver disease is one of the minority of FDA approved siRNA-based therapies (46). Thus, a check was made to see if siRNA mediated SPTBN1 knockdown protected them from HFD-induced NAFLD and NASH in Flox mice. Flox mice (10-12 weeks old) were fed HFD for 12 weeks. One week after the start of HFD, SPTBN 1-targeted siRNA (siswtbn 1) or an equal volume of siRNA negative control (siCtrl) was hydrodynamically injected every two weeks for 3 total injections (fig. 6A). Mice were monitored weekly for weight gain and survival. At the end of the experiment, the knockdown of SPTBN1 was confirmed by sisbtn 1 in the liver of Flox mice (fig. 6A, right). For each parameter, the response of the siSptbn1 treated mice to HFD was similar to LSKO mice. The siSptbn1 treated mice increased significantly less body weight (fig. 6B) and accumulated less visceral body fat (fig. 6C), with lower blood TG concentration and similar blood glucose concentration (fig. 6D) compared to the siCtrl treated mice. The histological, lipid accumulation and expression of pro-fibrotic and inflammatory genes in the liver of the sisbtn 1 treated mice were also similar to those of LSKO mice, with expression of pro-fibrotic and inflammatory genes significantly lower than those from the sirtrl treated mice (fig. 6E) and with normal liver structure and low lipid accumulation, without any signs of NAFLD or NASH (fig. 6F).

The same benefits of sistbn 1 were observed in liver-specific SPTBN1 heterozygous mice (LHET) (supplementary fig. 4, A, B) and female Flox mice (supplementary fig. 4C). Thus, sistbn 1 treatment prevented NAFLD from developing and progressing to NASH in mice when started early in the eating HFD period.

The absence of SPTBN1 specific for hepatocytes clearly has no detrimental effect on liver morphology or function, and SPTBN 1-targeted siRNA is an effective treatment in reducing HCC development in preclinical mouse NASH models and in chemically induced mouse models. In addition, acetaminophen is a commonly used over-the-counter drug of hepatotoxicity (51). Low doses of acetaminophen induce phosphorylation of TGFBR2 and SMAD signaling, higher toxic doses promote caspase activation and result in caspase-cleaved SPTBN1 production and severe hepatotoxicity (27). The data indicate that targeting SPTBN1 can be a useful therapy for preventing acetaminophen hepatotoxicity.

The results indicate that SPTBN1 plays an important role in HFD-induced steatosis and fibrosis: SPTBN1 promotes fibrosis as a participant in TGF-beta/SMAD 3 signaling, and SPTBN1 promotes de novo adipogenesis and steatosis as a participant in stress-activated SREBP1 signaling.

Example 7

SPTBN1 knockdown in human 3D culture NASH model reduces NASH-related transcriptional changes

Mouse results show that SPTBN1 knockdown prevents HFD-induced NAFLD and progression to NASH. This potential therapy was also tested in a newly developed 3D perfusion microphysical system that was able to co-culture primary human hepatocytes, liver Kupffer and astrocytes in a medium rich in fatty acids, sugars and insulin for 2 weeks as a culture model for human NASH (47, 48). The 3D cultures were exposed to different concentrations of siswtbn 1 and equivalent concentrations of siCtrl and siRNA was applied on days 4 and 6 (fig. 6G). A more than 90% reduction in SPTBN1 transcripts was observed after 96H treatment with 25nM siRNA (FIG. 6H, left panel). No significant differences in lipid accumulation were found on day 8 or day 14 (2 or 7 days after siRNA addition); however, in the siSptbn1 treated cultures, the amount was in a decreasing trend (fig. 6H, right panel).

Samples collected 96h after siRNA treatment were subjected to RNA-seq analysis of cultures exposed to either siSptbn1 (25 nM or 50 nM) or to SiCtrl for several days. Pathway analysis showed significant reduction of transcripts encoding proteins involved in fatty acid metabolism in the sirptbn 1-treated cultures, including those involved in lipid transport, triglyceride and glycogen metabolism, and lipoprotein catabolism (fig. 6I). Transcripts encoding proteins involved in fibrosis and altered inflammatory gene expression reduced transcripts were found in the sirbtbn 1-treated cultures (fig. 6I). These changes indicate that si SPTBN1 treatment reduces de novo adipogenesis, inflammation and fibrosis. As expected, the gene expression profile associated with TGF- β signaling was significantly reduced in the sisbtn 1-treated cultures (supplementary fig. 4E), consistent with the mouse model showing that this profile was reduced in LSKO and activated in mice (HFD-induced NASH) and human NASH (supplementary fig. 4E).

Analysis of "upstream regulatory factor" with IPA showed that a regulatory factor with higher activity in human NASH compared to NAFLD correlated consistently with lower activity in siswtbn 1-treated cultures than in siCtrl-treated cultures (fig. 5J). Furthermore, upstream regulatory factors with lower activity in NASH relative to NAFLD had higher activity in sistbn 1 treated cultures relative to siCtrl treated cultures (fig. 5J). Thus, siSptbn1 appears to reverse or combat NASH-related regulatory changes, further supporting the concept of siSptbn1 as a potential therapy.

Example 8

LSKO mice are mice protected from HFD-induced HCC

The data indicate that complete liver-specific loss of SPTBN1 protects mice from HFD-induced NASH, a well-recognized risk factor for HCC (1). Here, the effect of loss of liver SPTBN1 homozygosity on HCC was evaluated. First, the incidence of HCC was studied in LSKO mice and LHET mice fed HFD for 20 weeks. Although 2 tumor nodules were found in one of 4 HFD fed LHET mice, no liver tumors were found in any age-matched HFD fed LSKO mice (fig. S7A). Because the frequency of HCC occurrence is not high enough under such experimental conditions, a switch is made to the chemically induced HCC model.

Diethylnitrosamine (DEN) was used to induce HCC. Liver tumor development was assessed 24 weeks or 40 weeks after DEN injection. While Flox control mice, LHET mice and LSKO mice all had tumor in this model, LSKO mice were relatively protected (FIG. 7B, C; FIG. 7B). Nodules were found in the liver 24 weeks after DEN injection (fig. 7B), and tumors were found to develop at 40 weeks (fig. 7B, C; fig. S7B). Most LSKO mice had lower tumor burden compared to Flox control mice, manifested by lower tumor numbers, smaller tumor sizes, and improved liver pathology (fig. 7B, 7C). Furthermore, fewer proliferating cells were observed in LSKO mouse livers compared to livers of Flox control mice, as indicated by Ki67 markers (fig. 7D). However, no significant difference was observed in the apoptosis-labeled caspase-3 labeling, indicating that the reduced tumor burden in LSKO mice was not due to increased apoptosis (fig. 7E). Consistent with the LSKO HCC protective phenotype, STAT4, an inhibitor of HCC (49, 50), was identified as an upstream regulator of activation of differential regulator genes in livers of LSKO mice fed HFD (fig. 2A).

To verify whether complete loss of SPTBN1 has protective effects in human HCC, the frequency of loss of SPTBN1 homozygosity (deep deletions) was analyzed in human HCC. Of the data from TCGA, only one HCC patient (0.2%) had loss of homozygosity of SPTBN1 (1/440); whereas heterozygous deletions occurred in 7.8% (30/440) of HCC patients (30/440). Evaluation of SPTBN1 copy number changes in 33 cancer types in TCGA data also showed little loss of homozygosity for SPTBN1, with a total frequency of 0.1% in 33 cancer types, representing 33,039 cancer patients (fig. 7F). Thus, human cancer results indicate that LSKO mouse findings are translationally relevant: loss of SPTBN1 prevents NASH progression and HCC progression.

All of the features described herein (including any accompanying claims, abstract and drawings), and/or all of the steps of any method so disclosed, may be combined with any of the aspects described above, in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.

It should be understood that the foregoing aspects and examples are not intended to limit the scope of the present disclosure in any way, and that the claims presented herein are intended to cover all aspects, embodiments, and examples, whether or not explicitly presented herein.

All patents, patent applications, and publications cited herein are incorporated by reference in their entirety.

Reference to the literature

1.Q.M.Anstee，H.L.Reeves，E.Kotsiliti，O.Govaere，M.Heikenwalder，From NASH to HCC：current concepts and future challenges.Nat Rev Gastroenterol Hepatol 16，411-428(2019).

2.Z.Liu et al.，Global incidence trends in primary liver cancer by age at diagnosis，sex，region，and etiology，1990-2017.Cancer 126，2267-2278(2020).

3.N.Chalasani et al.，The diagnosis and management of nonalcoholic fatty liver disease：Practice guidance from the American Association for the Study of Liver Diseases.Hepatology 67，328-357(2018).

4.M.Yarchoan et al.，Recent Developments and Therapeutic Strategies against Hepatocellular Carcinoma.Cancer Res 79，4326-4330(2019).

5.S.L.Friedman，B.A.Neuschwander-Tetri，M.Rinella，A.J.Sanyal，Mechanisms of NAFLD development and therapeutic strategies.Nat Med 24，908-922(2018).

6.B.A.Neuschwander-Tetri，Non-alcoholic fatty liver disease.BMC Med 15，45(2017).

7.D.Kumar，G.C.Farrell，C.Fung，J.George，Hepatitis C virus genotype 3 is cytopathic to hepatocytes：Reversal of hepatic steatosis after sustained therapeutic response.Hepatology 36，1266-1272(2002).

8.J.Y.Kim et al.，ER Stress Drives Lipogenesis and Steatohepatitis via Caspase-2 Activation of S1P.Cell 175，133-145 e115(2018).

9.P.Zhao et al.，An AMPK-caspase-6 axis controls liver damage in nonalcoholic steatohepatitis.Science 367，652-660(2020).

10.H.Shimano，R.Sato，SREBP-regulated lipid metabolism：convergent physiology-divergent pathophysiology.Nat Rev Endocrinol 13，710-730(2017).

11.R.A.DeBose-Boyd et al.，Transport-dependent proteolysis of SREBP：relocation of site-1 protease from Golgi to ER obviates the need for SREBP transport to Golgi.Cell 99，703-712(1999).

12.X.Wang et al.，Cleavage of sterol regulatory element binding proteins (SREBPs)by CPP32 during apoptosis.EMBO J 15，1012-1020(1996).

13.M.Ekstedt et al.，Fibrosis stage is the strongest predictor for disease-specific mortality in NAFLD after up to 33 years of follow-up.Hepatology 61，1547-1554(2015).

14.A.Wree，L.Broderick，A.Canbay，H.M.Hoffman，AE.Feldstein，From NAFLD to NASH to cirrhosis-new insights into disease mechanisms.Nat Rev Gastroenterol Hepatol 10，627-636(2013).

15.N.Sanderson et al.，Hepatic expression of mature transforming growth factor beta 1 in transgenic mice results in multiple tissue lesions.Proc Natl Acad Sci U S A 92，2572-2576(1995).

16.K.C.Flanders，Smad3 as a mediator of the fibrotic responseInt J Exp Pathol 85，47-64(2004).

17.H.Yadav et al.，Protection from obesity and diabetes by blockade of TGF-beta/Smad3 signaling.Cell Metab 14，67-79(2011).

18.A.Majumdar et al.，Hepatic stem cells and transforming growth factor beta in hepatocellular carcinoma.Nat Rev astroenterol Hepatol 9，530-538(2012).

19.V.Bennett，Spectrin-based membrane skeleton：a multipotential adaptor between plasma membrane and cytoplasm.Physiol Rev 70，1029-1065(1990).

20.V.Bennett，D.N.Lorenzo，An Adaptable Spectrin/Anky rin-Based Mechanism for Long-Range Organization of Plasma Membranes in Vertebrate Tissues.Curr Top Membr 77，143-184(2016).

21.A.Viel，D.Branton，Spectrin：on the path from structure to function.Curr Opin Cell Biol 8，49-55(1996).

22.Y.Tang et al.，Disruption of transforming growth factor-beta signaling in ELF beta-spectrin-deficient mice.Science 299，574-577(2003).

23.J.Chen et al.，TGF-beta/beta2-spectrin/CTCF-regulated tumor suppression in human stem cell disorder Beckwith-Wiedemann syndrome.J Clin Invest 126，527-542(2016).

24.J.Chen et al.，Analysis of Genomes and Transcriptomes of Hepatocellular Carcinomas Identifies Mutations and Gene Expression Changes in the Transforming Growth Factor-beta Pathway.Gastroenterology 154，195-210(2018).

25.M.A.De Matteis，J.S.Morrow，Spectrin tethers and mesh in the biosynthetic pathway.J Cell Sci 113(Pt 13)，2331-2343(2000).

26.V.Bennett，D.N.Lorenzo，Spectrin-and ankyrin-based membrane domains and the evolution of vertebrates.Curr Top Membr 72，1-37(2013).

27.H.J.Baek et al.，Caspase-3/7-mediated Cleavage of beta2-spectrin is Required for Acetaminophen-induced Liver Damage.Int J Biol Sci 12，172-183(2016).

28.A.Korkut et al.，A Pan-Cancer Analysis Reveals High-Frequency Genetic Alterations in Mediators of Signaling by the TGF-beta Superfamily.Cell Syst 7，422-437e427(2018).

29.J.Gutierrez-Cuevas et al.，Prolonged-release pirfenidone prevents obesity-induced cardiac steatosis and fibrosis in a mouse NASH model.Cardiovasc Drugs Ther，(2020).

30.A.Sandoval-Rodriguez et al.，Pirfenidone Is an Agonistic Ligand for PPARalpha and Improves NASH by Activation of SIRT1/LKB 1/pAMPK.Hepatol Commun 4，434-449(2020).

31.M.P.Valdecantos et al.，A novel glucagon-like peptide 1/glucagon receptor dual agonist improves steatohepatitis and liver regeneration in mice.Hepatology 65，950-968(2017).

32.M.I.Lefterova etal.，PPARgamma and C/EBP factors orchestrate adipocyte biology via adjacent binding on a genome-wide scale.Genes Dev 22，2941-2952(2008).

33.G.Serviddio et al.，Uncoupling protein-2(UCP2)induces mitochondrial proton leak and increases susceptibility of non-alcoholic steatohepatitis(NASH)liver to ischaemoia-reperfusion injury.Gut 57，957-965(2008).

34.A.Nohturfft，R.A.DeBose-Boyd，S.Schee k，J.L.Goldstein，M.S.Brown，Sterols regulate cycling of SREBP cleavage-activating protein(SCAP)between endoplasmic reticulum and Golgi.Proc Natl Acad Sci U S A 96，11235-11240(1999).

35.R.Bertolio et al.，Sterol regulatory element binding protein 1 couples mechanical cues and lipid metabolism.Nat Commun 10，1326(2019).

36.M.S.Brown，J.L.Goldstein，A proteolytic pathway that controls the cholesterol content of membranes，cells，and blood.Proc Natl Acad Sci U S A 96，11041-11048(1999).

37.B.Knebel et al.，Liver-specific expression of transcriptionally active SREBP-1c is associated with fatty liver and increased visceral fat mass.PLoS One 7，e31812(2012).

38.D.Kozakov et al.，The ClusPro web server for protein-protein docking.Nature protocols 12，255(2017).

39.D.Kozakov，R.Brenke，S.R.Comeau，S.Vajda，PIPER：an FFT-based protein docking program with pairwise potentials.Proteins：Structure，Function，and Bioinformatics 65，392-406(2006).

40.M.Ricchi et al.，Differential effect of oleic and palmitic acid onlipid accumulation and apoptosis in cultured hepatocytes.J Gastroenterol Hepatol 24，830-840(2009).

41.T.Urbanik et al.，Down-regulation of CYLD as a trigger for NF-kappaB activation and a mechanism of apoptotic resistance in hepatocellular carcinoma cells.Int J Oncol 38，121-131(2011).

42.K.Tomita et al.，Tumour necrosis factor alpha signalling through activation of Kupffer cells plays an essential role in liver fibrosis of non-alcoholic steatohepatitis in mice.Gut 55，415-424(2006).

43.F.Wandrer et al.，TNF-Receptor-1 inhibition reduces liver steatosis，hepatocellular injury and fibrosis in NAFLD mice.Cell Death Dis 11，212(2020).

44.L.Calzadilla Bertot，L.A.Adams，The Natural Course Of Non-Alcoholic Fatty Liver Disease.Int J Mol Sci 17，(2016).

45.S.Singh et al.，Fibrosis progression in nonalcoholic fatty liver vs nonalcoholic steatohepatitis：a systematic review and meta-analysis of paired-biopsy studies.Clin Gastroenterol Hepatol 13，643-654e641-649：quiz e639-640(2015).

46.B.Hu et al.，Therapeutic siRNA：state of the art.Signal Transduct Target Ther 5，101(2020).

47.T.Kostrzewski et al.，Three-dimensional perfused human in vitro model of non-alcoholic fatty liver disease.World J Gastroenterol 23，204-215(2017).

48.T.Kostrzewski et al.，A Microphysiological System for Studying Nonalcoholic Steatohepatitis.Hepatol Commun 4，77-91(2020).

49.D.K.Jiang et al.，Genetic variants in STAT4 and HLA-DQ genes confer risk of hepatitis B virus-related hepatocellular carcinoma.Nat Genet 45，72-75(2013).

50.J.Li et al.，Clinicopathological significance of STAT4 in hepatocellular carcinoma and its effect on cell growth and apoptosis.Onco Targets Ther 9，1721-1734(2016).

51.A.M.Larson et al.，Acetaminophen-induced acute liver failure：results of a United States multicenter，prospective study.Hepatology 42，1364-1372(2005).

52.T.Yang et al.，Crucial step in cholesterol homeostasis：sterols promote binding of SCAP to INSIG-1，a membrane protein that facilitates retention of SREBPs in ER.Cell 110，489-500(2002).

53.L.A.Kelley et al.，The Phyre2 web portal for protein modeling，prediction and analysis.Nat Protoc 10(6)，845-858(2015).

54.A.Fiser and A.Sali，ModLoop：automated modeling of loops in protein structures.Bioinformatics 19(18)，2500-2501(2003).

55.N.Guex and M.C.Peitsch，SWISS-MODEL and the Swiss-PdbViewer：an environment for comparative protein modeling.Electrophoresis 18(15)，2714-2723(1997).

Sequence listing

<110> university of George Washington (THE GEORGE WASHINGTON UNIVERSITY)

<120> beta-ghost protein (SPTBN 1) deficiency protects mice from high fat diet-induced liver disease and cancer progression

<130> 3973.018PC02

<150> US 63/147,141

<151> 2021-02-08

<150> US 63/113,745

<151> 2020-11-13

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 7095

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> wisdom human ghosting protein beta, non-erythrocyte 1 (SPTBN 1), transcriptional variant 1

<400> 1

atgacgacca cagtagccac agactatgac aacattgaga tccagcagca gtacagtgat 60

gtcaacaacc gctgggatgt cgacgactgg gacaatgaga acagctctgc gcggcttttt 120

gagcggtccc gcatcaaggc tctggcagat gagcgtgaag ccgtgcagaa gaagaccttc 180

accaagtggg tcaattccca ccttgcccgt gtgtcctgcc ggatcacaga cctgtacact 240

gaccttcgag atggacggat gctcatcaag ctgctggagg tcctctctgg agagaggctg 300

cctaaaccca ccaagggacg aatgcgcatc cactgcttag agaatgtgga caaggccctt 360

cagttcctga aggagcagag agtccatctt gagaacatgg ggtcccatga catcgtggat 420

ggaaaccacc ggctgaccct tggcctcatc tggaccatca tcctgcgctt ccagatccag 480

gatatcagtg tggaaactga agacaacaaa gagaagaaat ctgccaagga tgcattgctg 540

ttgtggtgcc agatgaagac agctgggtac cccaatgtca acattcacaa tttcaccact 600

agctggaggg acggcatggc cttcaatgca ctgatacaca aacaccggcc tgacctgata 660

gattttgaca aactaaagaa atctaacgca cactacaacc tgcagaatgc atttaatctg 720

gcagaacagc acctcggcct cactaaactg ttggaccccg aagacatcag cgtggaccat 780

cctgatgaga agtccataat cacttatgtg gtgacttatt accactactt ctctaagatg 840

aaggccttag ctgttgaagg aaaacgaatt ggaaaggtgc ttgacaatgc tattgaaaca 900

gaaaaaatga ttgaaaagta tgaatcactt gcctctgacc ttctggaatg gattgaacaa 960

accatcatca ttctgaacaa tcgcaaattt gccaattcac tggtcggggt tcaacagcag 1020

cttcaggcat tcaacactta ccgcactgtg gagaaaccac ccaaatttac tgagaagggg 1080

aacttggaag tgctgctctt caccattcag agcaagatga gggccaacaa ccagaaggtc 1140

tacatgcccc gggaggggaa gctcatctct gacatcaaca aggcctggga aagactggaa 1200

aaagcggaac acgaaagaga actggctttg cggaatgagc tcataagaca ggagaaactg 1260

gaacagctcg cccgcagatt tgatcgcaag gcagctatga gggagacttg gctgagcgaa 1320

aaccagcgtc tggtgtctca ggacaacttt gggtttgacc ttcctgcagt tgaggccgcc 1380

acaaaaaagc acgaggccat tgagacagac attgccgcat acgaggagcg tgtgcaggct 1440

gtggtagccg tggccaggga gctcgaggcc gagaattacc acgacatcaa gcgcatcaca 1500

gcgaggaagg acaatgtcat ccggctctgg gaatacctac tggaactgct cagggcccgg 1560

agacagcggc tcgagatgaa cctggggctg cagaagatat tccaggaaat gctctacatt 1620

atggactgga tggatgaaat gaaggtgcta gtattgtctc aagactatgg caaacactta 1680

cttggtgtgg aagacctgtt acagaagcac accctggttg aagcagacat tggcatccag 1740

gcagagcggg tgagaggtgt caatgcctcc gcccagaagt tcgcaacaga cggggaaggt 1800

tacaagccct gtgaccccca ggtgatccga gaccgcgtgg cccacatgga gttctgttat 1860

caagagcttt gccagctggc ggctgagcgc agggcccgtc tggaagagtc ccgccgcctc 1920

tggaagttct tctgggagat ggcagaagag gaaggctgga tacgggagaa ggagaagatc 1980

ctgtcctcgg acgattacgg gaaagacctg accagcgtca tgcgcctgct cagcaagcac 2040

cgggcgttcg aggacgagat gagcggccgc agtggccact ttgagcaggc catcaaggaa 2100

ggcgaagaca tgatcgcgga ggagcacttc gggtcggaga agatccgtga gaggatcatt 2160

tacatccggg agcagtgggc caacctagag cagctctcgg ccattcggaa gaagcgcctg 2220

gaggaggcct ccctgctgca ccagttccag gcagatgctg atgacattga tgcctggatg 2280

ctggacatcc tcaagattgt ctccagcagc gacgtgggcc acgatgagta ttccacacag 2340

tctctggtca agaaacacaa ggacgtggcg gaagagatcg ccaattacag gcccaccctt 2400

gacacgctgc acgaacaagc cagcgccctc ccccaggagc atgccgagtc tccagacgtg 2460

aggggcaggc tgtcgggcat cgaggagcgg tataaggagg tggcagagct gacgcggctg 2520

cggaagcagg cactccagga cactctggcc ctgtacaaga tgttcagcga ggctgatgcc 2580

tgtgagctct ggatcgacga gaaggagcag tggctcaaca acatgcagat cccagagaag 2640

ctggaggatc tggaggtcat ccagcacaga tttgagagcc tagaaccaga aatgaacaac 2700

caggcttccc gggttgcagt ggtgaaccag attgcacgcc agctgatgca cagcggccac 2760

ccaagtgaga aggaaatcaa agcccagcag gacaaactca acacaaggtg gagccagttc 2820

agagaactgg ttgacaggaa gaaggatgcc ctcctgtctg ccctgagcat ccagaactac 2880

cacctcgagt gcaatgaaac caaatcctgg attcgggaaa agaccaaggt catcgagtcc 2940

acccaggacc tgggcaatga cctggctggc gtcatggccc tgcagcgcaa gctgaccggc 3000

atggagcggg acttggtggc cattgaggca aagctgagtg acctgcagaa ggaggcggag 3060

aagctggagt ccgagcaccc cgaccaggcc caggccatcc tgtctcggct ggccgagatc 3120

agcgacgtgt gggaggagat gaagaccacc ctgaaaaacc gagaggcctc cctgggagag 3180

gccagcaagc tgcagcagtt cctacgggac ttggacgact tccagtcctg gctctctagg 3240

acccagacag cgatcgcctc ggaggacatg ccaaacaccc tgaccgaggc tgagaagctg 3300

ctcacgcagc acgagaacat caagaacgag atcgacaact acgaggagga ctaccagaag 3360

atgagggaca tgggcgagat ggtcacccag gggcagaccg atgcccagta catgtttctg 3420

cggcagcggc tgcaggccct ggacactgga tggaacgagc tccacaagat gtgggagaac 3480

agacaaaatc tcctatccca gtcacatgcc taccagcagt tcctcagaga cacgaagcaa 3540

gccgaagcct ttcttaacaa ccaggagtat gttctggctc acactgaaat gcctaccacc 3600

ttggaaggag ctgaagcagc aattaaaaag caagaggact tcatgaccac catggacgcc 3660

aatgaggaga agatcaatgc tgtggtggag actggccgga ggctggtgag cgatgggaac 3720

atcaactcag atcgcatcca ggagaaggtg gactctattg atgacagaca taggaagaat 3780

cgtgagacag ccagtgaact tttgatgagg ttgaaggaca acagggatct acagaaattc 3840

ctgcaagatt gtcaagagct gtctctctgg atcaatgaga agatgctcac agcccaggac 3900

atgtcttacg atgaagccag aaatctgcac agtaaatggt tgaagcatca agcatttatg 3960

gcagaacttg catccaacaa agaatggctt gacaaaatcg agaaggaagg aatgcagctc 4020

atttcagaaa agcctgagac ggaagctgtg gtgaaggaga aactcactgg tttacataaa 4080

atgtgggaag tccttgaatc cactacccag acaaaggccc agcggctctt tgatgcaaac 4140

aaggccgaac ttttcaccca gagctgtgca gatctagaca aatggctgca cggcctggag 4200

agtcagattc agtctgatga ctatggcaaa gacctgacca gtgtcaatat cctgctgaaa 4260

aagcaacaga tgctggagaa tcagatggaa gtgcggaaga aggagatcga agagctccaa 4320

agccaagccc aggccctgag tcaggaaggg aagagcaccg acgaggtaga cagcaagcgc 4380

ctcaccgtgc agaccaagtt catggagttg ctggagccct tgaacgagag gaagcataac 4440

ctgctggcct ccaaagagat ccatcagttc aacagggatg tggaggacga gatcttgtgg 4500

gttggagaga ggatgccttt ggcaacttcc acggatcatg gccacaacct ccagactgtg 4560

cagctgttaa taaagaaaaa tcagaccctc cagaaagaaa tccaggggca ccagcctcgc 4620

attgacgaca tctttgagag gagccaaaac atcgtcactg acagcagcag cctcagcgct 4680

gaggccatca gacagaggct tgccgacctg aagcagctgt ggggtctcct cattgaggag 4740

acagagaaac gccacaggcg gctggaggag gcgcacaggg cccagcagta ctactttgac 4800

gctgctgagg ccgaagcctg gatgagcgag caggagctgt acatgatgtc agaggagaag 4860

gccaaggatg agcagagtgc tgtctccatg ttgaagaagc accagatctt agaacaagct 4920

gtggaggact atgcagagac cgtgcatcag ctctccaaga ccagccgggc cctggtggcc 4980

gacagccatc ctgaaagtga gcgcattagc atgcggcagt ccaaagtgga taaactgtac 5040

gctggtctga aagaccttgc tgaagagaga agaggcaagc tggatgagag acacaggtta 5100

ttccagctca accgggaggt ggacgacctg gagcagtgga tcgctgagag ggaggtggtc 5160

gcagggtccc atgaactggg acaggactat gagcatgtca cgatgttaca agaacgattc 5220

cgggagtttg cccgagacac cgggaacatt gggcaggagc gcgtggacac ggtcaatcac 5280

ctggcagatg agctcatcaa ctctggacat tcagatgccg ccaccatcgc tgaatggaag 5340

gatggcctca atgaagcctg ggccgacctc ctggagctca ttgacacaag aacacagatt 5400

cttgccgctt cctatgaact gcacaagttt taccacgatg ccaaggagat ctttgggcgt 5460

atacaggaca aacacaagaa actccctgag gagcttggga gagatcagaa cacagtggag 5520

accttacaga gaatgcacac tacatttgag catgacatcc aggctctggg cacacaggtg 5580

aggcagctgc aggaggatgc agcccgcctc caggcggcct atgcgggtga caaggccgac 5640

gatatccaga agcgcgagaa cgaggtcctg gaagcctgga agtccctcct ggacgcctgt 5700

gagagccgca gggtgcggct ggtggacaca ggggacaagt tccgcttctt cagcatggtg 5760

cgcgacctca tgctctggat ggaggatgtc atccggcaga tcgaggccca ggagaagcca 5820

agggatgtat catctgttga actcttaatg aataatcatc aaggcatcaa agctgaaatt 5880

gatgcacgta atgacagttt cacaacctgc attgaacttg ggaaatccct gttggcgaga 5940

aaacactatg catctgagga gatcaaggaa aaattactgc agttgacgga aaagaggaaa 6000

gaaatgatcg acaagtggga agaccgatgg gaatggttaa gactgattct ggaggtccat 6060

cagttctcaa gagacgccag tgtggccgag gcctggctgc ttggacagga gccgtaccta 6120

tccagccgag agataggcca gagcgtggac gaggtggaga agctcatcaa gcgccacgag 6180

gcatttgaaa agtctgcagc aacctgggat gagaggttct ctgccctgga aaggctgact 6240

acattggagt tactggaagt gcgcagacag caagaggaag aggagaggaa gaggcggccg 6300

ccttctcccg agccgagcac gaaggtttca gaggaagccg agtcccagca gcagtgggat 6360

acttcaaaag gagaacaagt ttcccaaaac ggtttgccag ctgaacaggg atctccacgg 6420

atggcagaaa cggtggacac aagcgaaatg gtcaacggcg ctacagaaca aaggacgagc 6480

tctaaagagt ccagccccat cccctccccg acctctgatc gtaaagccaa gactgccctc 6540

ccagcccaga gtgccgccac cttaccagcc agaacccagg agacaccttc ggcccagatg 6600

gaaggcttcc tcaatcggaa acacgagtgg gaggcccaca ataagaaagc ctcaagcagg 6660

tcctggcaca atgtttattg tgtcataaat aaccaagaaa tgggtttcta caaagatgca 6720

aagactgctg cttctggaat tccctaccac agcgaggtcc ctgtgagttt gaaagaagct 6780

gtctgcgaag tggcccttga ttacaaaaag aagaaacacg tattcaagct aagactaaat 6840

gatggcaatg agtacctctt ccaagccaaa gacgatgagg aaatgaacac atggatccag 6900

gctatctctt ccgccatctc ctctgataaa cacgaggtgt ctgccagcac ccagagcacg 6960

ccagcatcca gccgcgcgca gaccctcccc accagcgtcg tcaccatcac cagcgagtcc 7020

agtcccggca agcgggaaaa ggacaaagag aaagacaaag agaagcggtt cagccttttt 7080

ggcaaaaaga aatga 7095

<210> 2

<211> 6465

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> wisdom human ghosting protein beta, non-erythrocyte 1 (SPTBN 1), transcriptional variant 2

<400> 2

atggaattgc agaggacgtc tagtatctcc gggccgctgt cgccggcgta cacggggcag 60

gtgccttaca actacaacca gctggaaggc agattcaagc agctgcaaga tgagcgtgaa 120

gccgtgcaga agaagacctt caccaagtgg gtcaattccc accttgcccg tgtgtcctgc 180

cggatcacag acctgtacac tgaccttcga gatggacgga tgctcatcaa gctgctggag 240

gtcctctctg gagagaggct gcctaaaccc accaagggac gaatgcgcat ccactgctta 300

gagaatgtgg acaaggccct tcagttcctg aaggagcaga gagtccatct tgagaacatg 360

gggtcccatg acatcgtgga tggaaaccac cggctgaccc ttggcctcat ctggaccatc 420

atcctgcgct tccagatcca ggatatcagt gtggaaactg aagacaacaa agagaagaaa 480

tctgccaagg atgcattgct gttgtggtgc cagatgaaga cagctgggta ccccaatgtc 540

aacattcaca atttcaccac tagctggagg gacggcatgg ccttcaatgc actgatacac 600

aaacaccggc ctgacctgat agattttgac aaactaaaga aatctaacgc acactacaac 660

ctgcagaatg catttaatct ggcagaacag cacctcggcc tcactaaact gttggacccc 720

gaagacatca gcgtggacca tcctgatgag aagtccataa tcacttatgt ggtgacttat 780

taccactact tctctaagat gaaggcctta gctgttgaag gaaaacgaat tggaaaggtg 840

cttgacaatg ctattgaaac agaaaaaatg attgaaaagt atgaatcact tgcctctgac 900

cttctggaat ggattgaaca aaccatcatc attctgaaca atcgcaaatt tgccaattca 960

ctggtcgggg ttcaacagca gcttcaggca ttcaacactt accgcactgt ggagaaacca 1020

cccaaattta ctgagaaggg gaacttggaa gtgctgctct tcaccattca gagcaagatg 1080

agggccaaca accagaaggt ctacatgccc cgggagggga agctcatctc tgacatcaac 1140

aaggcctggg aaagactgga aaaagcggaa cacgaaagag aactggcttt gcggaatgag 1200

ctcataagac aggagaaact ggaacagctc gcccgcagat ttgatcgcaa ggcagctatg 1260

agggagactt ggctgagcga aaaccagcgt ctggtgtctc aggacaactt tgggtttgac 1320

cttcctgcag ttgaggccgc cacaaaaaag cacgaggcca ttgagacaga cattgccgca 1380

tacgaggagc gtgtgcaggc tgtggtagcc gtggccaggg agctcgaggc cgagaattac 1440

cacgacatca agcgcatcac agcgaggaag gacaatgtca tccggctctg ggaataccta 1500

ctggaactgc tcagggcccg gagacagcgg ctcgagatga acctggggct gcagaagata 1560

ttccaggaaa tgctctacat tatggactgg atggatgaaa tgaaggtgct agtattgtct 1620

caagactatg gcaaacactt acttggtgtg gaagacctgt tacagaagca caccctggtt 1680

gaagcagaca ttggcatcca ggcagagcgg gtgagaggtg tcaatgcctc cgcccagaag 1740

ttcgcaacag acggggaagg ttacaagccc tgtgaccccc aggtgatccg agaccgcgtg 1800

gcccacatgg agttctgtta tcaagagctt tgccagctgg cggctgagcg cagggcccgt 1860

ctggaagagt cccgccgcct ctggaagttc ttctgggaga tggcagaaga ggaaggctgg 1920

atacgggaga aggagaagat cctgtcctcg gacgattacg ggaaagacct gaccagcgtc 1980

atgcgcctgc tcagcaagca ccgggcgttc gaggacgaga tgagcggccg cagtggccac 2040

tttgagcagg ccatcaagga aggcgaagac atgatcgcgg aggagcactt cgggtcggag 2100

aagatccgtg agaggatcat ttacatccgg gagcagtggg ccaacctaga gcagctctcg 2160

gccattcgga agaagcgcct ggaggaggcc tccctgctgc accagttcca ggcagatgct 2220

gatgacattg atgcctggat gctggacatc ctcaagattg tctccagcag cgacgtgggc 2280

cacgatgagt attccacaca gtctctggtc aagaaacaca aggacgtggc ggaagagatc 2340

gccaattaca ggcccaccct tgacacgctg cacgaacaag ccagcgccct cccccaggag 2400

catgccgagt ctccagacgt gaggggcagg ctgtcgggca tcgaggagcg gtataaggag 2460

gtggcagagc tgacgcggct gcggaagcag gcactccagg acactctggc cctgtacaag 2520

atgttcagcg aggctgatgc ctgtgagctc tggatcgacg agaaggagca gtggctcaac 2580

aacatgcaga tcccagagaa gctggaggat ctggaggtca tccagcacag atttgagagc 2640

ctagaaccag aaatgaacaa ccaggcttcc cgggttgcag tggtgaacca gattgcacgc 2700

cagctgatgc acagcggcca cccaagtgag aaggaaatca aagcccagca ggacaaactc 2760

aacacaaggt ggagccagtt cagagaactg gttgacagga agaaggatgc cctcctgtct 2820

gccctgagca tccagaacta ccacctcgag tgcaatgaaa ccaaatcctg gattcgggaa 2880

aagaccaagg tcatcgagtc cacccaggac ctgggcaatg acctggctgg cgtcatggcc 2940

ctgcagcgca agctgaccgg catggagcgg gacttggtgg ccattgaggc aaagctgagt 3000

gacctgcaga aggaggcgga gaagctggag tccgagcacc ccgaccaggc ccaggccatc 3060

ctgtctcggc tggccgagat cagcgacgtg tgggaggaga tgaagaccac cctgaaaaac 3120

cgagaggcct ccctgggaga ggccagcaag ctgcagcagt tcctacggga cttggacgac 3180

ttccagtcct ggctctctag gacccagaca gcgatcgcct cggaggacat gccaaacacc 3240

ctgaccgagg ctgagaagct gctcacgcag cacgagaaca tcaagaacga gatcgacaac 3300

tacgaggagg actaccagaa gatgagggac atgggcgaga tggtcaccca ggggcagacc 3360

gatgcccagt acatgtttct gcggcagcgg ctgcaggccc tggacactgg atggaacgag 3420

ctccacaaga tgtgggagaa cagacaaaat ctcctatccc agtcacatgc ctaccagcag 3480

ttcctcagag acacgaagca agccgaagcc tttcttaaca accaggagta tgttctggct 3540

cacactgaaa tgcctaccac cttggaagga gctgaagcag caattaaaaa gcaagaggac 3600

ttcatgacca ccatggacgc caatgaggag aagatcaatg ctgtggtgga gactggccgg 3660

aggctggtga gcgatgggaa catcaactca gatcgcatcc aggagaaggt ggactctatt 3720

gatgacagac ataggaagaa tcgtgagaca gccagtgaac ttttgatgag gttgaaggac 3780

aacagggatc tacagaaatt cctgcaagat tgtcaagagc tgtctctctg gatcaatgag 3840

aagatgctca cagcccagga catgtcttac gatgaagcca gaaatctgca cagtaaatgg 3900

ttgaagcatc aagcatttat ggcagaactt gcatccaaca aagaatggct tgacaaaatc 3960

gagaaggaag gaatgcagct catttcagaa aagcctgaga cggaagctgt ggtgaaggag 4020

aaactcactg gtttacataa aatgtgggaa gtccttgaat ccactaccca gacaaaggcc 4080

cagcggctct ttgatgcaaa caaggccgaa cttttcaccc agagctgtgc agatctagac 4140

aaatggctgc acggcctgga gagtcagatt cagtctgatg actatggcaa agacctgacc 4200

agtgtcaata tcctgctgaa aaagcaacag atgctggaga atcagatgga agtgcggaag 4260

aaggagatcg aagagctcca aagccaagcc caggccctga gtcaggaagg gaagagcacc 4320

gacgaggtag acagcaagcg cctcaccgtg cagaccaagt tcatggagtt gctggagccc 4380

ttgaacgaga ggaagcataa cctgctggcc tccaaagaga tccatcagtt caacagggat 4440

gtggaggacg agatcttgtg ggttggagag aggatgcctt tggcaacttc cacggatcat 4500

ggccacaacc tccagactgt gcagctgtta ataaagaaaa atcagaccct ccagaaagaa 4560

atccaggggc accagcctcg cattgacgac atctttgaga ggagccaaaa catcgtcact 4620

gacagcagca gcctcagcgc tgaggccatc agacagaggc ttgccgacct gaagcagctg 4680

tggggtctcc tcattgagga gacagagaaa cgccacaggc ggctggagga ggcgcacagg 4740

gcccagcagt actactttga cgctgctgag gccgaagcct ggatgagcga gcaggagctg 4800

tacatgatgt cagaggagaa ggccaaggat gagcagagtg ctgtctccat gttgaagaag 4860

caccagatct tagaacaagc tgtggaggac tatgcagaga ccgtgcatca gctctccaag 4920

accagccggg ccctggtggc cgacagccat cctgaaagtg agcgcattag catgcggcag 4980

tccaaagtgg ataaactgta cgctggtctg aaagaccttg ctgaagagag aagaggcaag 5040

ctggatgaga gacacaggtt attccagctc aaccgggagg tggacgacct ggagcagtgg 5100

atcgctgaga gggaggtggt cgcagggtcc catgaactgg gacaggacta tgagcatgtc 5160

acgatgttac aagaacgatt ccgggagttt gcccgagaca ccgggaacat tgggcaggag 5220

cgcgtggaca cggtcaatca cctggcagat gagctcatca actctggaca ttcagatgcc 5280

gccaccatcg ctgaatggaa ggatggcctc aatgaagcct gggccgacct cctggagctc 5340

attgacacaa gaacacagat tcttgccgct tcctatgaac tgcacaagtt ttaccacgat 5400

gccaaggaga tctttgggcg tatacaggac aaacacaaga aactccctga ggagcttggg 5460

agagatcaga acacagtgga gaccttacag agaatgcaca ctacatttga gcatgacatc 5520

caggctctgg gcacacaggt gaggcagctg caggaggatg cagcccgcct ccaggcggcc 5580

tatgcgggtg acaaggccga cgatatccag aagcgcgaga acgaggtcct ggaagcctgg 5640

aagtccctcc tggacgcctg tgagagccgc agggtgcggc tggtggacac aggggacaag 5700

ttccgcttct tcagcatggt gcgcgacctc atgctctgga tggaggatgt catccggcag 5760

atcgaggccc aggagaagcc aagggatgta tcatctgttg aactcttaat gaataatcat 5820

caaggcatca aagctgaaat tgatgcacgt aatgacagtt tcacaacctg cattgaactt 5880

gggaaatccc tgttggcgag aaaacactat gcatctgagg agatcaagga aaaattactg 5940

cagttgacgg aaaagaggaa agaaatgatc gacaagtggg aagaccgatg ggaatggtta 6000

agactgattc tggaggtcca tcagttctca agagacgcca gtgtggccga ggcctggctg 6060

cttggacagg agccgtacct atccagccga gagataggcc agagcgtgga cgaggtggag 6120

aagctcatca agcgccacga ggcatttgaa aagtctgcag caacctggga tgagaggttc 6180

tctgccctgg aaaggctgac tacattggag ttactggaag tgcgcagaca gcaagaggaa 6240

gaggagagga agaggcggcc gccttctccc gagccgagca cgaaggtttc agaggaagcc 6300

gagtcccagc agcagtggga tacttcaaaa ggagaacaag tttcccaaaa cggtttgcca 6360

gctgaacagg gatctccacg ggttagttac cgctctcaaa cctaccaaaa ctacaaaaac 6420

tttaatagca gacggacagc cagtgaccag ccatggtctg gactg 6465

<210> 3

<211> 7092

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mouse ghosting beta, non-erythrocyte 1 (Sptbn 1), transcriptional variant 1

<400> 3

atgacgacca cggtagccac agactatgac aacattgaga tccagcagca gtacagtgat 60

gtgaacaacc gctgggatgt ggatgactgg gacaatgaga acagctctgc aaggctcttt 120

gagcgctccc gcatcaaggc cctggcagat gagcgtgaag ctgtacagaa gaagaccttc 180

accaagtggg tcaattccca ccttgcgaga gtgtcctgcc gaatcacaga cctgtacacg 240

gaccttcgag atggacggat gctcatcaag ctactggagg tcctctctgg agagaggctg 300

cctaaaccca ctaagggacg gatgcggatc cactgtctgg agaatgtcga caaggctctt 360

caattcctga aagagcagag agtccatctt gagaacatgg gctcccatga cattgtggat 420

ggaaaccacc ggctgaccct cggcctcatc tggacaatta ttctgcgctt ccagatccag 480

gatattagtg tggagactga agataacaaa gagaaaaagt ctgctaagga tgcattgctg 540

ctgtggtgcc agatgaagac agctgggtac cccaatgtca acattcacaa tttcaccact 600

agctggaggg atggcatggc cttcaatgca ctgatacata aacatcggcc tgacctgata 660

gattttgata aactgaagaa atctaatgca cactacaatc tgcagaatgc atttaacctg 720

gcagagcagc accttggcct cactaaactg ttagaccctg aagatatcag tgtggaccac 780

cctgatgaga agtctatcat cacatacgtg gtgacttact accactactt ctccaagatg 840

aaggccttgg ctgtcgaagg aaagcgcatt ggaaaggtgc ttgataatgc tatagaaaca 900

gagaaaatga ttgagaagta cgagtcactt gcttctgacc ttctggagtg gattgaacaa 960

accatcatca tcctaaacaa ccgcaaattt gctaattcac tggttggggt ccagcagcag 1020

ctccaggcat tcaacacgta ccgcacagtg gagaaaccac ctaagtttac tgagaagggg 1080

aatttggagg tgctcctttt cacaattcag agcaagatgc gagcgaataa tcagaaggtc 1140

tacatgcccc gcgaggggaa gctcatctct gacatcaaca aggcctggga aagactggaa 1200

aaagcagaac atgagagaga actggctctg cggaatgagc tcatacggca ggaaaaactg 1260

gaacaactcg cccgaagatt tgatcgcaag gcagctatga gggagacatg gctgagtgaa 1320

aaccagcgtc ttgtgtctca ggacaacttt ggatttgacc ttcccgctgt tgaggctgct 1380

accaaaaaac acgaggccat tgagacagac atcgctgcat atgaagaacg agttcaggcc 1440

gtggtggctg tggccaggga acttgaagcc gagaactacc atgacatcaa gcgcatcaca 1500

gcgaggaagg acaatgtcat ccggctctgg gaatacttgc tggaactgct cagggccagg 1560

aggcagcgtc ttgagatgaa cctgggattg caaaagatat tccaggaaat gctttatatt 1620

atggactgga tggatgaaat gaaggtgcta ttgctgtctc aagactatgg caaacactta 1680

cttggtgttg aagacctgtt acagaagcat gccctggttg aagcagacat tgcaatccaa 1740

gcagagcgtg taagaggtgt gaatgcctct gcccagaagt ttgcaacaga tggggaaggc 1800

tacaagccat gtgaccccca ggtaattcga gaccgtgttg cccacatgga gttctgctat 1860

caagagcttt gtcagctggc tgccgagcgt agggctcgcc tggaagagtc ccgtcgcctc 1920

tggaagttct tctgggagat ggcagaagag gaaggctgga tacgagagaa ggagaagatc 1980

ctgtcctctg atgattacgg gaaagacttg accagtgtca tgcgcctgct gagcaagcac 2040

cgggcatttg aggatgagat gagtggccgt agtggccatt ttgagcaggc cattaaagaa 2100

ggtgaagaca tgattgcaga ggaacacttt ggatcggaaa agatccgtga gagaatcatt 2160

tatatccggg agcagtgggc caacctggaa cagctctcag ccattaggaa gaagcgccta 2220

gaggaagcct cattactgca ccagttccag gctgatgctg atgatattga tgcttggatg 2280

ttagatatac tcaagattgt ctccagcaat gatgtgggcc atgatgagta ctccacgcag 2340

tctctggtca agaagcataa agatgtagca gaagagatca ccaactacag gcccactatt 2400

gacacactgc atgagcaagc cagtgccctt ccacaagcac atgcagagtc tccagatgtg 2460

aagggccggc tggcaggaat tgaggagcgc tgcaaggaga tggcagagtt aacacggcta 2520

aggaagcagg ctctgcagga caccctggcc ctgtacaaga tgttcagtga ggctgatgcc 2580

tgtgagctct ggattgacga gaaggagcag tggctcaaca acatgcagat cccagagaag 2640

ctggaggacc tggaagtcat ccagcacaga tttgagagcc tagaaccaga aatgaacaac 2700

caggcttccc gggttgctgt ggtgaaccag attgcacggc agctgatgca caatggccac 2760

cccagtgaaa aggaaatcag agctcagcaa gacaaactca acacgaggtg gagtcagttc 2820

agagaactgg tggacaggaa aaaggatgct cttctgtctg ccctgagcat ccagaactac 2880

cacctcgagt gcaatgaaac caaatcctgg atccgggaga agaccaaggt catcgagtct 2940

acccaagacc ttggcaatga cctggcaggt gtcatggccc tgcagcgcaa gctgactggc 3000

atggaacgag acttggtagc cattgaggcg aagctgagtg acctgcagaa agaagctgag 3060

aagctggagt ccgagcaccc tgaccaggct caagctatcc tgtctcggct ggccgagatc 3120

agtgatgtgt gggaggaaat gaagacaacc ctgaagaacc gagaggcctc cctgggagag 3180

gccagcaagc tgcagcagtt tctgcgggac ttggacgact tccagtcttg gctctccagg 3240

acccagactg ctatcgcctc agaggacatg cccaataccc tcactgaggc agagaagctt 3300

ctcacacagc acgagaatat caaaaatgag atcgacaatt atgaggaaga ctaccagaag 3360

atgcgggaca tgggcgagat ggtcacccag gggcagactg atgcccagta tatgtttctg 3420

cggcagcggc tgcaggcctt agacactggc tggaatgagc tccacaaaat gtgggagaac 3480

aggcaaaacc tcctctccca gtcccatgcc taccagcagt tccttaggga caccaaacaa 3540

gctgaagctt ttcttaataa ccaggagtat gttttggctc atactgaaat gcccaccacc 3600

ctggaaggag ctgaagcagc cattaaaaag caggaggact tcatgaccac catggatgcc 3660

aacgaggaga agatcaatgc tgttgtggag actggccgaa gactggtgag cgatgggaac 3720

atcaactccg accgcatcca ggagaaggtg gactctattg acgacagaca caggaagaat 3780

cgagaagcag ccagtgaact tctgatgagg ttaaaggaca accgtgatct acagaagttc 3840

ctgcaagatt gtcaagagct gtccctctgg atcaatgaaa agatgcttac agctcaagac 3900

atgtcttatg atgaagccag aaatctgcac agtaaatggt taaagcatca agcatttatg 3960

gcggaacttg catccaacaa agaatggctt gacaaaattg agaaggaagg aatgcagctt 4020

atttcagaaa agccagaaac agaagctgtg gtaaaggaaa aactcactgg tttacataaa 4080

atgtgggaag tccttgaatc cacaacccag accaaggccc agcggctctt tgatgcaaat 4140

aaggctgagc ttttcacaca aagctgcgca gatcttgaca aatggctaca tggcctggag 4200

agccagattc aatctgacga ctatggcaaa gaccttacca gtgtcaatat tcttctgaaa 4260

aagcaacaga tgctggagaa tcagatggaa gttcggaaga aagagatcga ggaactgcag 4320

agccaagccc aggcgctgag tcaggagggg aagagcacag atgaggtgga cagcaaacgc 4380

cttactgtgc agaccaagtt catggagctt ctggagccct tgagtgagag gaagcataac 4440

ctgttagctt ccaaggagat ccatcagttc aacagggatg tggaggacga aatcctatgg 4500

gttggcgaga ggatgccttt ggcaacttcc acagatcatg gccataacct tcaaactgtg 4560

cagctgttaa taaagaaaaa ccagaccctc cagaaagaaa tccagggaca ccagcctcgt 4620

attgatgaca tctttgagag gagtcaaaac atcatcacag atagcagcag cctcaatgcc 4680

gaggctatca ggcagaggct cgctgacctg aagcagctgt gggggctcct cattgaggaa 4740

actgagaaac gccatagacg gctggaggag gcacacaagg cgcagcagta ctactttgat 4800

gcagctgaag ccgaggcatg gatgagtgaa caggagttgt acatgatgtc tgaggaaaag 4860

gccaaggatg agcagagtgc tgtctctatg ttgaaaaagc accagatttt agagcaagct 4920

gttgaggact atgcagagac agtacaccag ctctccaaga ctagccgggc gctggtggct 4980

gacagccatc ccgaaagtga gcgtattagc atgcggcagt caaaggtcga caagctgtat 5040

gctggcctga aggaccttgc tgaggagagg agaggaaaac ttgatgagag gcacaggctg 5100

ttccagctca acagagaggt ggatgacctg gaacagtgga tcgctgagag ggaagtggtc 5160

gcaggctccc atgagttggg acaggactat gagcatgtca cgatgttaca agaacggttc 5220

cgagaatttg ctcgagacac aggaaacatt gggcaggagc gtgtggatac agttaataac 5280

atggcagatg aactcatcaa ctctggacat tcagatgctg ccaccattgc tgagtggaaa 5340

gatggtctca atgaagcctg ggctgacctc ctggagctca ttgacacaag aacacagatt 5400

cttgctgcct catatgaact tcataagttt taccatgatg ccaaggagat ctttggccga 5460

atccaggaca aacacaagaa actccctgag gagcttggaa gagatcaaaa cactgtggaa 5520

actttacaga gaatgcacac cacctttgag cacgacatcc aagctctggg cactcaggtg 5580

aggcagctgc aggaggatgc agctcgcctc caggcagcct atgcagggga caaggctgat 5640

gacatccaga agcgtgagaa tgaggtcctg gaagcctgga agtccctgct ggatgcttgt 5700

gagggtcgca gggtgcggct ggtagacaca ggagacaagt tccgcttctt cagcatggtg 5760

cgtgacctca tgctctggat ggaagatgtc atccggcaga tcgaggccca ggagaaacca 5820

cgggatgtgt catctgttga actgttaatg aataatcatc aaggtatcaa agctgaaatt 5880

gatgctcgta atgacagctt tacagcctgc attgagcttg ggaaatccct gctggcacgg 5940

aaacactatg cttctgagga gatcaaggaa aagttactgc agctgacaga gaaaagaaaa 6000

gaaatgattg acaagtggga agaccggtgg gagtggttaa gactgatttt ggaggtccat 6060

cagttctcaa gggatgccag tgtggcagag gcttggctgc ttggacagga accataccta 6120

tccagccgtg aaattggcca gagtgtagac gaagtggaga agcttattaa gcgccatgag 6180

gcgtttgaaa agtctgcagc gacctgggat gagagattct ctgctctgga aaggctgaca 6240

acgttggagc tactggaagt gcgcagacag caagaggaag aagaaagaaa gaggcggcca 6300

ccttctccgg acccaaacac gaaggtttca gaggaggctg agtcccagca atgggatact 6360

tcaaaaggag accaagtttc ccagaatggt ttgccggctg agcagggatc tccacggatg 6420

gcaggaacca tggaaacgag tgaaatggtc aacggtgctg ctgagcagag gacaagctcc 6480

aaagagtcca gtcctgttcc ctctcccacc ttggaccgaa aggccaaatc tgcacttcca 6540

gcccagagtg ctgccaccct gccagccagg accctggaga cacccgctgc ccagatggaa 6600

ggcttcctca atcggaagca tgagtgggag gcccacaata agaaagcctc gagcaggtcc 6660

tggcacaatg tatattgtgt cataaataac caagaaatgg gcttctataa agatgccaag 6720

agtgctgctt ctggcatccc ctaccacagt gaggtccctg tgagtttgaa agaggccatc 6780

tgcgaagtgg cccttgatta caaaaagaag aagcacgtgt tcaagctaag actaagtgat 6840

ggaaacgagt acctcttcca agccaaagat gatgaggaaa tgaacacatg gatccaggct 6900

atctcctctg ccatctcctc tgacaaacac gacacatctg ccagcaccca gagtacgcca 6960

gcatccagtc gggcgcagac cttacccacc agcgtcgtca ccatcaccag cgagtccagt 7020

cctggcaaga gggagaagga taaagagaaa gacaaagaga agaggttcag ccttttcggc 7080

aagaagaagt ga 7092

<210> 4

<211> 6462

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mouse ghosting beta, non-erythrocyte 1 (Sptbn 1), transcriptional variant 2

<400> 4

atggagttgc agaggacatc cagcatttca gggccgctgt cgccggccta caccgggcag 60

gtgccttaca actacaacca actggaagga agattcaaac agctccaaga tgagcgtgaa 120

gctgtacaga agaagacctt caccaagtgg gtcaattccc accttgcgag agtgtcctgc 180

cgaatcacag acctgtacac ggaccttcga gatggacgga tgctcatcaa gctactggag 240

gtcctctctg gagagaggct gcctaaaccc actaagggac ggatgcggat ccactgtctg 300

gagaatgtcg acaaggctct tcaattcctg aaagagcaga gagtccatct tgagaacatg 360

ggctcccatg acattgtgga tggaaaccac cggctgaccc tcggcctcat ctggacaatt 420

attctgcgct tccagatcca ggatattagt gtggagactg aagataacaa agagaaaaag 480

tctgctaagg atgcattgct gctgtggtgc cagatgaaga cagctgggta ccccaatgtc 540

aacattcaca atttcaccac tagctggagg gatggcatgg ccttcaatgc actgatacat 600

aaacatcggc ctgacctgat agattttgat aaactgaaga aatctaatgc acactacaat 660

ctgcagaatg catttaacct ggcagagcag caccttggcc tcactaaact gttagaccct 720

gaagatatca gtgtggacca ccctgatgag aagtctatca tcacatacgt ggtgacttac 780

taccactact tctccaagat gaaggccttg gctgtcgaag gaaagcgcat tggaaaggtg 840

cttgataatg ctatagaaac agagaaaatg attgagaagt acgagtcact tgcttctgac 900

cttctggagt ggattgaaca aaccatcatc atcctaaaca accgcaaatt tgctaattca 960

ctggttgggg tccagcagca gctccaggca ttcaacacgt accgcacagt ggagaaacca 1020

cctaagttta ctgagaaggg gaatttggag gtgctccttt tcacaattca gagcaagatg 1080

cgagcgaata atcagaaggt ctacatgccc cgcgagggga agctcatctc tgacatcaac 1140

aaggcctggg aaagactgga aaaagcagaa catgagagag aactggctct gcggaatgag 1200

ctcatacggc aggaaaaact ggaacaactc gcccgaagat ttgatcgcaa ggcagctatg 1260

agggagacat ggctgagtga aaaccagcgt cttgtgtctc aggacaactt tggatttgac 1320

cttcccgctg ttgaggctgc taccaaaaaa cacgaggcca ttgagacaga catcgctgca 1380

tatgaagaac gagttcaggc cgtggtggct gtggccaggg aacttgaagc cgagaactac 1440

catgacatca agcgcatcac agcgaggaag gacaatgtca tccggctctg ggaatacttg 1500

ctggaactgc tcagggccag gaggcagcgt cttgagatga acctgggatt gcaaaagata 1560

ttccaggaaa tgctttatat tatggactgg atggatgaaa tgaaggtgct attgctgtct 1620

caagactatg gcaaacactt acttggtgtt gaagacctgt tacagaagca tgccctggtt 1680

gaagcagaca ttgcaatcca agcagagcgt gtaagaggtg tgaatgcctc tgcccagaag 1740

tttgcaacag atggggaagg ctacaagcca tgtgaccccc aggtaattcg agaccgtgtt 1800

gcccacatgg agttctgcta tcaagagctt tgtcagctgg ctgccgagcg tagggctcgc 1860

ctggaagagt cccgtcgcct ctggaagttc ttctgggaga tggcagaaga ggaaggctgg 1920

atacgagaga aggagaagat cctgtcctct gatgattacg ggaaagactt gaccagtgtc 1980

atgcgcctgc tgagcaagca ccgggcattt gaggatgaga tgagtggccg tagtggccat 2040

tttgagcagg ccattaaaga aggtgaagac atgattgcag aggaacactt tggatcggaa 2100

aagatccgtg agagaatcat ttatatccgg gagcagtggg ccaacctgga acagctctca 2160

gccattagga agaagcgcct agaggaagcc tcattactgc accagttcca ggctgatgct 2220

gatgatattg atgcttggat gttagatata ctcaagattg tctccagcaa tgatgtgggc 2280

catgatgagt actccacgca gtctctggtc aagaagcata aagatgtagc agaagagatc 2340

accaactaca ggcccactat tgacacactg catgagcaag ccagtgccct tccacaagca 2400

catgcagagt ctccagatgt gaagggccgg ctggcaggaa ttgaggagcg ctgcaaggag 2460

atggcagagt taacacggct aaggaagcag gctctgcagg acaccctggc cctgtacaag 2520

atgttcagtg aggctgatgc ctgtgagctc tggattgacg agaaggagca gtggctcaac 2580

aacatgcaga tcccagagaa gctggaggac ctggaagtca tccagcacag atttgagagc 2640

ctagaaccag aaatgaacaa ccaggcttcc cgggttgctg tggtgaacca gattgcacgg 2700

cagctgatgc acaatggcca ccccagtgaa aaggaaatca gagctcagca agacaaactc 2760

aacacgaggt ggagtcagtt cagagaactg gtggacagga aaaaggatgc tcttctgtct 2820

gccctgagca tccagaacta ccacctcgag tgcaatgaaa ccaaatcctg gatccgggag 2880

aagaccaagg tcatcgagtc tacccaagac cttggcaatg acctggcagg tgtcatggcc 2940

ctgcagcgca agctgactgg catggaacga gacttggtag ccattgaggc gaagctgagt 3000

gacctgcaga aagaagctga gaagctggag tccgagcacc ctgaccaggc tcaagctatc 3060

ctgtctcggc tggccgagat cagtgatgtg tgggaggaaa tgaagacaac cctgaagaac 3120

cgagaggcct ccctgggaga ggccagcaag ctgcagcagt ttctgcggga cttggacgac 3180

ttccagtctt ggctctccag gacccagact gctatcgcct cagaggacat gcccaatacc 3240

ctcactgagg cagagaagct tctcacacag cacgagaata tcaaaaatga gatcgacaat 3300

tatgaggaag actaccagaa gatgcgggac atgggcgaga tggtcaccca ggggcagact 3360

gatgcccagt atatgtttct gcggcagcgg ctgcaggcct tagacactgg ctggaatgag 3420

ctccacaaaa tgtgggagaa caggcaaaac ctcctctccc agtcccatgc ctaccagcag 3480

ttccttaggg acaccaaaca agctgaagct tttcttaata accaggagta tgttttggct 3540

catactgaaa tgcccaccac cctggaagga gctgaagcag ccattaaaaa gcaggaggac 3600

ttcatgacca ccatggatgc caacgaggag aagatcaatg ctgttgtgga gactggccga 3660

agactggtga gcgatgggaa catcaactcc gaccgcatcc aggagaaggt ggactctatt 3720

gacgacagac acaggaagaa tcgagaagca gccagtgaac ttctgatgag gttaaaggac 3780

aaccgtgatc tacagaagtt cctgcaagat tgtcaagagc tgtccctctg gatcaatgaa 3840

aagatgctta cagctcaaga catgtcttat gatgaagcca gaaatctgca cagtaaatgg 3900

ttaaagcatc aagcatttat ggcggaactt gcatccaaca aagaatggct tgacaaaatt 3960

gagaaggaag gaatgcagct tatttcagaa aagccagaaa cagaagctgt ggtaaaggaa 4020

aaactcactg gtttacataa aatgtgggaa gtccttgaat ccacaaccca gaccaaggcc 4080

cagcggctct ttgatgcaaa taaggctgag cttttcacac aaagctgcgc agatcttgac 4140

aaatggctac atggcctgga gagccagatt caatctgacg actatggcaa agaccttacc 4200

agtgtcaata ttcttctgaa aaagcaacag atgctggaga atcagatgga agttcggaag 4260

aaagagatcg aggaactgca gagccaagcc caggcgctga gtcaggaggg gaagagcaca 4320

gatgaggtgg acagcaaacg ccttactgtg cagaccaagt tcatggagct tctggagccc 4380

ttgagtgaga ggaagcataa cctgttagct tccaaggaga tccatcagtt caacagggat 4440

gtggaggacg aaatcctatg ggttggcgag aggatgcctt tggcaacttc cacagatcat 4500

ggccataacc ttcaaactgt gcagctgtta ataaagaaaa accagaccct ccagaaagaa 4560

atccagggac accagcctcg tattgatgac atctttgaga ggagtcaaaa catcatcaca 4620

gatagcagca gcctcaatgc cgaggctatc aggcagaggc tcgctgacct gaagcagctg 4680

tgggggctcc tcattgagga aactgagaaa cgccatagac ggctggagga ggcacacaag 4740

gcgcagcagt actactttga tgcagctgaa gccgaggcat ggatgagtga acaggagttg 4800

tacatgatgt ctgaggaaaa ggccaaggat gagcagagtg ctgtctctat gttgaaaaag 4860

caccagattt tagagcaagc tgttgaggac tatgcagaga cagtacacca gctctccaag 4920

actagccggg cgctggtggc tgacagccat cccgaaagtg agcgtattag catgcggcag 4980

tcaaaggtcg acaagctgta tgctggcctg aaggaccttg ctgaggagag gagaggaaaa 5040

cttgatgaga ggcacaggct gttccagctc aacagagagg tggatgacct ggaacagtgg 5100

atcgctgaga gggaagtggt cgcaggctcc catgagttgg gacaggacta tgagcatgtc 5160

acgatgttac aagaacggtt ccgagaattt gctcgagaca caggaaacat tgggcaggag 5220

cgtgtggata cagttaataa catggcagat gaactcatca actctggaca ttcagatgct 5280

gccaccattg ctgagtggaa agatggtctc aatgaagcct gggctgacct cctggagctc 5340

attgacacaa gaacacagat tcttgctgcc tcatatgaac ttcataagtt ttaccatgat 5400

gccaaggaga tctttggccg aatccaggac aaacacaaga aactccctga ggagcttgga 5460

agagatcaaa acactgtgga aactttacag agaatgcaca ccacctttga gcacgacatc 5520

caagctctgg gcactcaggt gaggcagctg caggaggatg cagctcgcct ccaggcagcc 5580

tatgcagggg acaaggctga tgacatccag aagcgtgaga atgaggtcct ggaagcctgg 5640

aagtccctgc tggatgcttg tgagggtcgc agggtgcggc tggtagacac aggagacaag 5700

ttccgcttct tcagcatggt gcgtgacctc atgctctgga tggaagatgt catccggcag 5760

atcgaggccc aggagaaacc acgggatgtg tcatctgttg aactgttaat gaataatcat 5820

caaggtatca aagctgaaat tgatgctcgt aatgacagct ttacagcctg cattgagctt 5880

gggaaatccc tgctggcacg gaaacactat gcttctgagg agatcaagga aaagttactg 5940

cagctgacag agaaaagaaa agaaatgatt gacaagtggg aagaccggtg ggagtggtta 6000

agactgattt tggaggtcca tcagttctca agggatgcca gtgtggcaga ggcttggctg 6060

cttggacagg aaccatacct atccagccgt gaaattggcc agagtgtaga cgaagtggag 6120

aagcttatta agcgccatga ggcgtttgaa aagtctgcag cgacctggga tgagagattc 6180

tctgctctgg aaaggctgac aacgttggag ctactggaag tgcgcagaca gcaagaggaa 6240

gaagaaagaa agaggcggcc accttctccg gacccaaaca cgaaggtttc agaggaggct 6300

gagtcccagc aatgggatac ttcaaaagga gaccaagttt cccagaatgg tttgccggct 6360

gagcagggat ctccacgggt tagttaccgc tctcaaacgt accaaaacta caaaaacttt 6420

aatagcagac ggacagccag tgaccattca tggtctggaa tg 6462

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mouse siRNA targeting Sptbn1 sense sequence

<400> 5

cgauguuaca agaacgguut t 21

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mouse siRNA targeting Sptbn1 antisense sequence

<400> 6

aaccguucuu guaacaucgt g 21

<210> 7

<211> 19

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> human siRNA target sequence

<400> 7

ccugaaagug agcgcauua 19

<210> 8

<211> 19

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> human siRNA target sequence

<400> 8

ccgcauacga ggagcgugu 19

<210> 9

<211> 19

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> human siRNA target sequence

<400> 9

ggacaugucu uacgaugaa 19

<210> 10

<211> 19

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> human siRNA target sequence

<400> 10

gugacaaggc cgacgauau 19

Claims (20)

1. A method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits SPTBN1 expression.

2. The method of claim 1, wherein at least one of the siRNA molecules that inhibits SPTBN1 expression comprises 15 to 30 nucleotides.

3. The method of claim 2, wherein at least one of the siRNA molecules that inhibits SPTBN1 expression comprises 15 to 20 nucleotides.

4. The method of any one of claims 1-3, wherein at least one of the siRNA molecules that inhibits SPTBN1 expression comprises an overhang region of 1 to 6 nucleotides.

5. The method of any one of claims 1-3, wherein at least one of the siRNA molecules that inhibits SPTBN1 expression does not comprise an overhang region.

6. The method of claim 1, wherein at least one of the siRNA molecules that inhibits SPTBN1 expression is shown as SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, or SEQ ID No. 10.

7. A method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits expression of SPTBN1, wherein at least one of the siRNA molecules that inhibits expression of SPTBN1 is homologous to at least 10 nucleotides of SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, or SEQ ID No. 10.

8. A method of treating obesity, non-alcohol related fatty liver disease, non-alcohol steatohepatitis, or hepatocellular carcinoma in a subject in need thereof, the method comprising administering a therapeutically effective amount of at least one siRNA molecule that inhibits the expression of SPTBN1, wherein at least one of the siRNA molecules that inhibits the expression of SPTBN1 has at least 90% sequence identity to SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, or SEQ ID No. 10.

9. The method of any one of claims 1-8, for treating obesity in a subject in need thereof.

10. The method of claim 9, wherein treating obesity comprises reducing the amount of body fat and/or reducing the weight of the subject.

11. The method of any one of claims 1-8, for treating non-alcohol-related fatty liver disease in a subject in need thereof.

12. The method of claim 11, wherein treating a non-alcohol-related fatty liver disease comprises reducing blood triglycerides in the subject.

13. The method of any one of claims 1-8, for treating non-alcoholic steatohepatitis in a subject in need thereof.

14. The method of claim 13, wherein treating non-alcoholic steatohepatitis comprises reducing blood triglycerides in the subject.

15. The method of any one of claims 1-8, for treating hepatocellular carcinoma in a subject in need thereof.

16. The method of claim 15, wherein treating hepatocellular carcinoma comprises reducing tumor mass in the subject.

17. The method of any one of claims 1-16, comprising administering to the subject an siRNA molecule that inhibits SPTBN1 expression.

18. The method of any one of claims 1-16, comprising administering to the subject two siRNA molecules that inhibit SPTBN1 expression.

19. The method of any one of claims 1-16, comprising administering to the subject three siRNA molecules that inhibit SPTBN1 expression.

20. The method of any one of claims 1-16, comprising administering four to ten siRNA molecules that inhibit SPTBN1 expression to the subject.