CN116602995A

CN116602995A - Application of Jin Sitan parabacteroides in preparation of weight-losing preparation

Info

Publication number: CN116602995A
Application number: CN202310614330.9A
Authority: CN
Inventors: 陈承志; 邱景富; 赵枫; 邹镇; 张弘扬
Original assignee: Chongqing Medical University
Current assignee: Chongqing Medical University
Priority date: 2023-05-29
Filing date: 2023-05-29
Publication date: 2023-08-18

Abstract

The invention belongs to the technical field of biological weight-losing preparations, and particularly relates to application of Paramycolatopsis aureobasilicum in preparation of weight-losing preparations. Animal experiments prove that the Jin Sitan parabacteroides probiotics can improve the related symptoms of obesity induced by high-fat diet, such as weight reduction, glucose tolerance improvement, insulin resistance level reduction, lipid deposition of liver tissues reduction, expression level of obesity related genes Fto and protein thereof and the like.

Description

Application of Jin Sitan parabacteroides in preparation of weight-losing preparation

Technical Field

The invention belongs to the technical field of biological weight-losing preparations, and particularly relates to application of Paramycolatopsis aureobasilicum in preparation of weight-losing preparations.

Background

The world health organization (WorldHealthOrganization, WHO) reports at 2022, 3, 4 (world obesity day): over 10 million people worldwide are obese-6.5 million adults, 3.4 million teenagers, and 3900 ten thousand children, this figure is increasing; WHO estimated that by 2025, about 1.67 million people would present health problems due to overweight or obesity; the report of nutrition and chronic disease status of Chinese residents (2020) shows that the overweight rate and the obesity rate of children and teenagers aged 6-17 years in China are respectively 11.1% and 7.9%, the overweight rate and the obesity rate of children under 6 years are respectively 6.8% and 3.6%, and the childhood obesity has been a popular trend in China. The Chinese children obesity report predicts that if no effective intervention measures are adopted, the overweight and obesity detection rate of children aged 7 years and older reaches 28.0 percent, and the overweight and obesity number reaches 4948 ten thousand by 2030. Childhood obesity is commonly influenced by genetic, environmental and social culture factors, and the occurrence causes are complex.

Currently, surgery is the most effective method for treating obesity, but its choice is strictly adapted. In addition, among centrally acting drugs for controlling appetite, dexfenfluramine, fenfluramine and sibutramine have been developed and used for decades on weight-loss products, and orlistat is a gastric and pancreatic lipase inhibitor, which was the earliest (1999) single drug approved for the long-term treatment of obesity, showing benefits for weight loss and glycemic control. The semaglutin injection (Noand Tay) is a novel long-acting glucagon-like peptide-1 (GLP-1) analogue of Noand Node company and is used for controlling blood sugar. However, the efficacy of anti-obesity drugs is often inadequate and safety is questionable. The applicability of these drugs has its limitations and the specific mechanism is not yet known.

Intestinal microorganisms (gut microbiota) are a huge microbial system in the human intestinal tract that is closely related to the physiology and nutritional metabolism of the body. The human intestinal tract provides a good habitat for microorganisms, the number of the colonized microorganisms in the intestinal tract is about 10 trillion, the number of the colonized microorganisms is 10 times of the number of human cells, and the genes coded by the colonized microorganisms are 150 times of human genome. As the most huge and complex microecological system of human body, intestinal microorganisms and metabolites thereof not only can regulate the health of human body, but also play an important role in bridging between diet and host, and are very important components in the human health system. It has been found that structural imbalance of intestinal microorganisms may be one of the main causes of metabolic diseases such as insulin resistance, type 2 diabetes, and obesity. Currently, the main strategies for regulating intestinal microorganisms include diet, probiotics and microbial transplantation. Probiotics are a class of active microorganisms beneficial to a host that colonize the human body and can alter the composition of the host's flora at a location. In respect of obesity, animal studies have found that Dysosmobacter welbionis has the potential to ameliorate obesity and that this microorganism is ubiquitous in the human gut. Bifidobacterium longum APC1472 is another promising probiotic, showing potential against obesity and elevated blood glucose. It was found that lactobacillus acidophilus can reduce the weight, fat mass, inflammation and insulin resistance of high fat diet mice, and activate brown adipose tissue and improve energy and glycolipid metabolism, while reversing high fat diet-induced intestinal microbial disorders. mucin-Achroman (Akkermansia muciniphila, A.muciniphila) is a recently discovered strain of Starfish that can alleviate high fat diet-induced metabolic disorders, reduce fat mass increase and improve insulin resistance.

Therefore, the development of a probiotic which can improve obesity has great potential in slimming preparations.

Disclosure of Invention

Aiming at the problems, the invention aims to provide a new application of the parabacteroides aureobasilicum (Parabacteroides goldsteinii) probiotics in preparation of weight-losing preparations.

The beneficial effects of the invention at least comprise: animal experiments prove that the Jin Sitan parabacteroides probiotics can improve the related symptoms of obesity induced by high-fat diet, such as weight reduction, glucose tolerance improvement, insulin resistance level reduction, lipid deposition of liver tissues reduction, expression level of obesity related genes Fto and protein thereof and the like.

Drawings

FIG. 1 is a graph of body weight gain in HFD group and LFD group mice;

FIG. 2 is a histogram of body weight gain for HFD and LFD mice;

FIG. 3 is an area chart under the glucose tolerance test curves of mice in HFD group and LFD group;

FIG. 4 is an area chart under the insulin resistance experimental curves of mice in HFD group and LFD group;

FIG. 5 is a diagram showing the screening of Paramycolatopsis aureofaciens;

FIG. 6 is a graph showing the growth of Paralopecias aureata;

FIG. 7 shows dilution 10 of Jin Sitan Paramycolatopsis solution ^-6 Colony growth after 24h culture on GAM dish;

FIG. 8 shows dilution 10 of Jin Sitan Paramycolatopsis solution ^-7 Colony growth after 24h culture on GAM dish;

FIG. 9 shows dilution of Paramycolatopsis aureofaciens bacterial solution 10 ^-8 Colony growth after 24h culture on GAM dish;

FIG. 10 is a standard curve of bacterial liquid;

FIG. 11 is a graph of Jin Sitan Paralopecuroides-high fat diet induced weight gain in obese mice;

FIG. 12 is a histogram of weight gain in Jin Sitan bacteroides-high fat diet-induced obese mice;

FIG. 13 is an area chart under a glucose tolerance test curve of a Jin Sitan Paralopecuroides-high fat diet-induced obese mouse;

FIG. 14 is an area chart under the Jin Sitan Pelarobactrum sp-high fat diet induced insulin resistance test curve of obese mice;

FIG. 15 is a graph of the impact of P.g bacterial intervention on adipose tissue pathology;

FIG. 16 is a graph of the effect of P.g bacterial intervention on liver tissue pathology;

FIG. 17 is a dilution plot of Fto primer;

FIG. 18 is a graph showing the relative expression values of obesity-related gene Fto mRNA;

FIG. 19 is a bar graph of Fto protein;

FIG. 20 is a graph showing the relative expression values of obesity-related proteins Fto.

Detailed Description

The examples are presented for better illustration of the invention, but the invention is not limited to the examples. Those skilled in the art will appreciate that various modifications and adaptations of the embodiments described above are possible in light of the above teachings and are intended to be within the scope of the invention.

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. Unless the context clearly differs, singular forms of expression include plural forms of expression. As used herein, it is understood that terms such as "comprising," "having," "including," and the like are intended to indicate the presence of a feature, number, operation, component, part, element, material, or combination. The terms of the present invention are disclosed in the specification and are not intended to exclude the possibility that one or more other features, numbers, operations, components, elements, materials or combinations thereof may be present or added. As used herein, "/" may be interpreted as "and" or "as appropriate.

In the present invention, the explanation of the related English terms is shown in Table 1.

TABLE 1 terminology involved in the present invention

P.g	Parabacteroides goldsteinii	Jin Sitan Paramycolatopsis
			LFD	Low-fat diet	Low fat diet
HFD	High-fat diet	High fat diet
			GTT	Glucose tolerance test	Glucose tolerance test
ITT	Insulin resistance test	Insulin resistance test
			Fto	Fat Mass and Obesity Associated	Fat mass and obesity related
SNP	single nucleotide polymorphism	Single nucleotide polymorphism

The embodiment of the invention provides application of bacteroides aureofaciens in preparation of a preparation for reducing fat.

It should be noted that, at present, there is no report on whether Paramycolatopsis aureobasilicum can improve obesity-related symptoms. The probiotic products in the current market are mainly aimed at supplementing probiotics, the functions of the probiotic strains are not deeply studied, the effect of the probiotics is far underestimated, and the probiotic strains which are helpful for reducing the obesity symptoms and are derived from diet are screened, so that the probiotic products have remarkable social significance and huge market application value.

Through screening of multiple rounds of strain functions and verification of health effects in animal body groups, jin Sitan bacteroides strains can obviously improve related symptoms of obesity induced by high-fat diet, such as weight reduction, glucose tolerance improvement, insulin resistance level reduction, adipocyte size reduction, liver tissue lipid deposition reduction, expression level of obesity related genes Fto and proteins thereof and the like.

It should also be noted that Paramycolatopsis is a subtype of Paramycolatopsis (Parabacteroides) and is a probiotic. Paralopecias is an important genus of bacteria, present in the human gut, and they have a symbiotic relationship with humans. They help break down food and produce the nutrition and energy required by the body.

In some embodiments, the Jin Sitan Paralopecias may be deposited with the China center for type culture Collection, with the biological deposit number being Bio-120924, and the original strain number: strain WAL 12034.

In certain embodiments, the formulation comprises a pharmaceutical, nutraceutical, or food product. It should be noted that the auxiliary materials can be added into the above Jin Sitan parabacteroides to prepare medicines, health products or foods, such as Cheng Yi raw fungus tablets.

In certain embodiments, the Jin Sitan parabacteroides is one or more of a live bacterium, an inactivated bacterium, a metabolite, or a ferment. It should be noted that the action may be performed using different forms of the above Jin Sitan parabacteroides, such as live bacteria, inactivated bacteria, metabolites or fermented products, or a mixture thereof.

In certain embodiments, the above-described applications include: jin Sitan Paralopecias A.Paenii is cultured Jin Sitan Paralopecias A.Paenii when preparing the preparation for reducing fat, and the culture comprises: activating Jin Sitan pair of bacteroides freeze-dried powder strain by using a GAM (gamma-ray) culture medium, absorbing all bacterial suspension, inoculating the bacterial suspension on a GAM agar culture medium plate, coating the plate, and performing purification culture by adopting an anaerobic culture method; the individual clustered Paramycolatopsis aureobasidioides was selected, inoculated into GAM liquid medium, centrifuged after the cultivation reached log phase, the supernatant removed and the pellet resuspended in sterile PBS to make a bacterial suspension.

In one placeIn some embodiments, the culturing of the Jin Sitan parabacteroides comprises: inoculating Jin Sitan parabacteroides strain into 15mL of GAM culture medium for overnight culture; then, 0.1mL of the mixture was pipetted into a 10mL tube containing 10mL of medium at a dilution of 10 ^-1 Repeating the above steps for 10 times of dilution to 10 ^-8 Dilution, selection 10 ^-6 ，10 ^-7 ，10 ^-8 Three dilutions, sucking 0.1mL of fungus drop on a GAM culture medium plate, coating the plate, and placing the coated culture dish in a 37 ℃ incubator for overnight culture by adopting an anaerobic culture method (5% CO 2); when Jin Sitan Paralopecias reached the log phase after 24-36h of culture, 1mL of bacterial liquid was taken from the log phase culture by a pipette and placed in a spectrophotometric sample cell, and the OD600 value (Optical Density) was measured by an ultraviolet spectrophotometer and the bacterial liquid concentration was determined. When OD600 is about 1.8, the bacterial liquid concentration is about 10 ⁸ -10 ⁹ cfu/mL. After centrifugation of the bacterial stock at 6000 Xg for 5 minutes, the supernatant was removed and the pellet was resuspended in sterile PBS to about 10 ⁸ -10 ⁹ cfu/mL bacterial suspension.

In certain embodiments, the above-described applications include one or more of the following applications: (a) Use of a Jin Sitan parabacteroides for the preparation of a formulation for inhibiting Fto gene expression; (b) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing the level of insulin resistance; (c) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing lipid deposition in the liver; (d) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing adipocyte size.

As described above, the Jin Sitan bacteroides can improve obesity symptoms by increasing glucose tolerance and decreasing insulin resistance level, decreasing adipocyte size, decreasing lipid deposition of liver tissue, decreasing expression level of the obesity-related gene Fto and its protein, and the like.

It should be further noted that the Fto gene is a gene related to fat metabolism and obesity, and a plurality of single nucleotide polymorphism (single nucleotide polymorphism, SNP) sites exist on Fto gene widely distributed in various tissues of animals, and these SNP sites increase ingestion by affecting the expression levels of orexin ghrelin and leptin, thereby causing obesity. Therefore, research on the molecular regulation mechanism of the Fto gene in animal bodies can provide more reliable theoretical basis for preventing and treating human obesity. In the invention, after the stomach is irrigated by the Bacteroides bacterium liquid for 4 weeks Jin Sitan to an obese mouse, the weight gain, the glucose tolerance, the insulin resistance level and the lipid deposition of the liver are all obviously improved, and Fto gene and protein expression are obviously down-regulated, namely Jin Sitan Bacteroides can reduce obesity-related symptoms by reducing the expression of the Bacteroides bacterium liquid Fto gene of the obese mouse and the insulin resistance level.

For a better understanding of the present invention, the content of the present invention is further elucidated below in connection with the specific examples, but the content of the present invention is not limited to the examples below.

In the examples below, data are expressed as Mean (+ -Standard Deviation (SD) and a one-way anova is used to compare groups to each other, and the independent sample T test evaluates the difference between groups, with a P <0.05 difference statistically significant. All charts were created by GraphPadPrism 7.2.

Example 1 animal experiment

In the embodiment of the invention, the Glucose Tolerance Test (GTT) is carried out according to the following steps: after the model period is over, at night 20: no water is forbidden for 12h after 00 fasts; the next morning 08:00 measuring fasting blood glucose (recorded as blood glucose value of 0 min), then injecting glucose (2 g/kg body weight) into abdominal cavity, detecting blood glucose values of 30min, 60min, 90min and 120min, measuring glucose tolerance of mice, and calculating area under curve, wherein the formula is shown in 1-1.

Wherein G0, G30, G60, G90 and G120 are blood glucose values of 0min, 30min, 60min, 90min and 120min, respectively, in an oral glucose tolerance test; AUC is the area under the blood glucose curve.

In the embodiment of the invention, the insulin resistance test (ITT) is performed according to the following steps: after the model period is over, at night 20: no water is forbidden for 12h after 00 fasts; the next morning 08:00 measuring fasting blood glucose (recorded as blood glucose value of 0 min), then injecting insulin (0.75U/kg body weight) into abdominal cavity, detecting blood glucose values of 30min, 60min, 90min and 120min, measuring insulin resistance level of mice, and calculating area under curve, wherein the formula is shown in the above 1-1.

(1) Construction of obese mouse model

Selecting 20C 57BL/6J male mice with the age of 4 weeks, and feeding experimental animals into standard animal houses strictly according to the environment of the experimental animals: the temperature is 22+/-2 ℃, the humidity is 50% +/-15%, the light and dark period is 12 hours/12 hours, and free ingestion and drinking are ensured. The experimental animals were fed adaptively for 1 week before the start of the experiment. During the period of adaptive feeding, mice were provided with standard feed and purified water. Mice were randomly divided into 2 groups (n=10 mice/group), the specific groupings were as follows:

(a) Control group (LDF): feeding 10% low fat feed (caloric value of 3.8 kcal/g);

(b) High fat group (HFD): feeding 60% high fat feed (caloric value of 5.2 kcal/g);

the model period was 8 weeks, and the model collected mouse faeces the last morning.

The body weight changes of the two groups of mice were recorded weekly, the results are shown in fig. 1, and a body weight gain map of each group was calculated, as shown in fig. 2, and the results show that the body weight of the HFD group was significantly higher than that of the LFD (P < 0.05) after 6 weeks of high fat diet feeding; the body weight gain was higher in the HFD group than in the LFD group (P < 0.05).

After the molding was completed, glucose tolerance test and insulin resistance test were performed on each group of mice according to the above method, and the results are shown in fig. 3 and 4, and the results show that the HFD group was higher than the LFD group (P < 0.05); HFD group is higher than LFD group (P < 0.05); data are expressed as mean±sd, n=8.

(2) Screening of Jin Sitan Paramycolatopsis

Sequencing was performed using the MiseqPE300 platform from Illumina (http:// www.majorbio.com /), and the specific procedure is as follows: (1) one end of the DNA fragment is complementary with the primer base and is fixed on the chip; (2) the other end is complementary to and fixed on the other primer to form a bridge; (3) PCR amplification to generate DNA clusters; (4) linearizing the DNA amplicon into a single strand; (5) adding DNA polymerase and dNTPs with 4 fluorescent labels, and synthesizing only one base in each cycle; (6) scanning the surface of the reaction plate by using laser, and reading the nucleotide types polymerized by the first round of reaction of each template sequence; (7) and counting the collected fluorescent signal results of each round to obtain the sequence of the template DNA fragment. Species classification annotation was performed on each sequence, and the Silva database (SSU 128) was aligned, setting the alignment threshold at 70%. The analysis was compared using the metage biological cloud platform. Species analysis at the species level, as shown in FIG. 5, shows that the differential flora is uncultured_bacterium_g_colorixtacterium,

The species which accords with the trend among groups are Jin Sitan parabacteroides (Parabacteroides goldsteinii, P.g) after screening of the unburnt_bacterium_g_lachnospiraceae_nk 4a136_ group, clostridiales _bacterium_cieaf_020 and the unclassified_g_ Bacteroides, parabacteroides _ goldsteinii, uncultured _bacterium_g_ Adlercreutzia, unclassified _g_odorib. Wherein the Y-axis represents species names at the species taxonomic level, the X-axis represents average relative abundance in different groupings of species, and different colored columns represent different groupings; the rightmost value is P, which represents p.ltoreq.0.05, and p.ltoreq.0.01. Sequencing sample size n=8.

EXAMPLE 2 cultivation of Paramycolatopsis aureofaciens

(1) Activation of Jin Sitan Paramycolatopsis

Activation of Acinetobacter parahaemolyticus Jin Sitan was performed in an anaerobic operation table, and 15mL of GAM broth (10.0 g/L for lunar peptone, 3.0g/L for soybean peptone, 5.0g/L for yeast extract, 2.2g/L for beef extract, 13.5g/L for digested serum extract, 1.2g/L for beef extract, 3.0g/L for glucose, 2.5g/L for monopotassium phosphate, 3.0g/L for sodium chloride, 5.0g/L, L-cysteine and 0.3g/L for sodium thioglycolate, pH 7.3.+ -. 0.1 ℃ for 1mL for every 1000mL of culture medium, and 1mL for chlorhexidine (5 mg/mL) were prepared by adding distilled water to 1mL for 1mol/L of sodium hydroxide solution, and autoclaving at 121 ℃ for 20 min).

Sterilizing the surface of a purchased freeze-dried tube filled with Jin Sitan pair of bacteroides strains, polishing a tube orifice by a polishing rod, gently breaking off, sucking 0.3ml-0.5ml of culture solution by a sterile suction tube, dripping into the freeze-dried tube (the freeze-dried tube filled with the freeze-dried powder strains), and gently shaking until the culture solution is dissolved.

All bacterial suspensions were aspirated and inoculated onto dishes containing GAM agar medium (10.0 g/L for lunar peptone, 3.0g/L for soybean peptone, 5.0g/L for yeast extract, 2.2g/L for beef powder, 13.5g/L for digested serum powder, 1.2g/L for beef liver extract, 3.0g/L for glucose, 2.5g/L for monobasic potassium phosphate, 3.0g/L for sodium chloride, 5.0g/L, L-cysteine, 0.3g/L for sodium thioglycolate, and 15g/L for agar, pH 7.3.+ -. 0.1 ℃ C.) were coated clockwise with a sterile L-type microbial coating bar until all bubbles disappeared, and after the operation, the dishes were inverted and cultured in an anaerobic incubator (65%) at 37 ℃ C.

After 48 hours of culture, a single colony is selected by a disposable sterile inoculating loop, inoculated into a flat plate containing GAM agar culture medium, three-area lineation is carried out, and after the operation is finished, the culture dish is inverted and placed in an anaerobic incubator (humidity is 65%) at 37 ℃ for static culture; after 48h of cultivation, a single colony was selected with a disposable sterile inoculating loop, inoculated into a test tube containing 5ml of gam broth, sealed and cultured in an anaerobic incubator (humidity 65%) at 37 ℃ until the bacterial solution became turbid or a large amount of bacterial cells grew at the bottom.

(2) Determination of Jin Sitan Paramycolatopsis growth curve

For the number of Paramycolatopsis aureofaciens, the growth condition and metabolic condition were known and measured by turbidimetry. And (3) determining the relation between the Jin Sitan parabacteroides suspension and the OD value by utilizing a spectrophotometer, so as to determine the growth rule of the parabacteroides, and corresponding the growth rule to the culture time, and determining the growth curve of the parabacteroides (see figure 6) so as to prepare for realizing the uniformity of the bacterial liquid in vivo and in vitro experiments.

(3) Jin Sitan bacterial liquid concentration calculation of Bacteroides

Draw 0.1mL of the mixture in a tube containing 10mL of GAM broth at a dilution of 10 ^-1 Repeating the above steps for 10 times of dilution to 10 ^-8 Dilution, selection 10 ^-6 、10 ^-7 And 10 ^-8 Three thinReleasing, sucking 0.1mL of fungus drop on GAM agar culture medium plate, coating clockwise with disposable L-type microorganism aseptic coating rod, and anaerobic culturing (5% CO) ₂ ) Placing the coated culture dish in an anaerobic incubator at 37 ℃ for overnight culture; plates were grown overnight until colonies were clearly disconnected (24 h-48 h), and the number of colonies (n) (see FIGS. 7, 8 and 9); the bacterial concentration was calculated by plotting a standard curve (see fig. 10) based on the counting results.

The calculation formula is as follows: n (CFU/mL) =n x d/v,

average colony count, d: dilution concentration, v: volume of plating bacteria liquid.

(4) Subculture and preservation of Jin Sitan parabacteroides

10 test tubes filled with GAM broth culture medium are prepared, 500 mu L of activated Jin Sitan bacteroides liquid is inoculated into one test tube, a negative control group is established, the test tubes are placed in an anaerobic box at 37 ℃ for static culture for 24 hours after sealing, bacterial liquid turbidity in the liquid culture medium of the experimental group is obviously visible, and the test tubes are pushed, subcultured and frozen.

The strain freezing tube and 50% sterile glycerin (volume fraction) are put into an anaerobic incubator after being autoclaved, and then bacterial liquid and glycerin are taken according to the following ratio of 1:1, adding 800ul bacterial suspension into each tube to make the final concentration of glycerin reach 25%, marking the information of strain name, passage times, date and names of people to be cultivated, and storing at-80deg.C.

(5) Jin Sitan Paramycolatopsis liquid preparation

Jin Sitan A. Paratopecurus reaches logarithmic phase 48h-72h after culturing (as shown in FIG. 6, the growth curve of A. Paratopecurus is observed, and the viable count of A. Paratopecurus rises rapidly within 24h to 36 h. Jin Sitan A. Paratopecurus is adapted to the culture medium environment, the flora is vigorous, high-speed growth and propagation are started, and is in the logarithmic phase), 1mL of bacterial liquid is sucked from the logarithmic phase culture by a pipette gun into a sample cell of a spectrophotometer, and the OD600 value (Optical Density) is detected by an ultraviolet spectrophotometer, and the bacterial liquid concentration is determined. When OD600 is about 1.6, the concentration of the bacterial liquid is about 10 ⁸ -10 ⁹ CFU/mL. Centrifuging the bacterial stock solution at 6000 XgAfter 5 minutes, the supernatant was removed and the pellet was resuspended in sterile PBS to about 10 ⁸ -10 ⁹ CFU/mL bacterial suspension. And subpackaging the diluted bacterial liquid sample into a sterilizing centrifuge tube for sealing, and filling the sample into the stomach of the experimental animal according to the sterile transmission requirement.

Example 3 construction of Paramycolatopsis aureofaciens intervention obese mouse model

(1) Experimental animal

Selecting 20C 57BL/6J male mice with the age of 4 weeks, and keeping the environment the same as that of the (1); mice were randomly divided into 2 groups (n=10 mice/group), the specific groupings were as follows:

(a) High fat group (HFD): feeding 60% high fat feed (caloric 5.2kcal/g, lysine content 13.2%);

(b) High fat + Jin Sitan paramecium intervention group (HFD + P.g): 60% high fat diet (caloric 5.2kcal/g, lysine content 13.2%).

After the 8-week period of the basal model was completed, 200. Mu.L (1X 10) of 200. Mu.L of LPBS solution was administered daily by intragastric administration in HFD group and 200. Mu.L (1X 10) was administered daily by intragastric administration in HFD+ P.g group ⁸ CFU/kg) bacterial solution. Daily dosing time was 8 a.m.: 00-9:00, and 14d.

The weight changes of the two groups of mice were recorded weekly, the results are shown in fig. 11, and a weight gain map for each group was calculated, as shown in fig. 12, showing that mice in hfd+ P.g group were lighter than those in hfd+pbs group (P < 0.05) at the third week of P.g intervention; mice in the hfd+ P.g group had lower body weight gain than those in the hfd+pbs group (P < 0.05).

On day 15, mice in each group were fasted without water inhibition for 12 hours, and glucose tolerance test and insulin resistance test were performed according to the above method, and the results are shown in fig. 13 and 14, and the result shows that AUC of hfd+ P.g group was lower than that of hfd+pbs group (P < 0.05); AUC was lower for the hfd+ P.g group than for the hfd+pbs group (P < 0.05); data are expressed as mean±sd, n=8.

The results show that the interference of the Paramycolatopsis aureobasilicum can reduce the weight of the obese mice and improve the glucose tolerance and the insulin resistance level of the obese mice.

After 14d, transferring the mice into a clean cage, and fasting for more than 12 hours, and anaesthesia the mice (0.03 mL/10 g) by using avermectin; collecting eyeball blood, standing at room temperature for 60min, centrifuging at 12000rpm for 5min, collecting upper layer plasma, packaging, and storing in ultralow temperature refrigerator at-80deg.C. Taking liver tissue and adipose tissue, cleaning the obtained tissue with PBS buffer solution, sucking the tissue with water absorbing paper, quick-freezing the tissue with liquid nitrogen, split charging the tissue into 2mL sterile EP tube, and storing the tissue in a refrigerator at-80 ℃. Liver tissue and adipose tissue are taken for later use for detection by a subsequent HE staining method, a Western Blot method, a qPCR method and the like.

(2) HE staining analysis of liver tissue and adipose tissue

Liver tissue and adipose tissue samples collected in (1) were fixed with freshly prepared 4% paraformaldehyde, and then stained with Hematoxylin Eosin (HE). Baking the lung tissue paraffin section in an oven at 65 ℃ for at least 1.5 hours to ensure that the paraffin on the tissue section is sufficiently melted; the sections were then placed in xylene twice to remove the melted paraffin and dehydrated in gradient ethanol. The sections were stained with hematoxylin and eosin in sequence, and then dehydrated with ethanol; after staining, sections were clarified twice in xylene and fixed with neutral resin; the stained sections were observed under an optical microscope at 200 and 400 magnifications, respectively.

Wherein, the fat tissue sample graph is shown in fig. 15, and the result shows that the fat cells of the mice in the HFD+PBS group are obviously larger than those in the HFD+ P.g group; liver tissue sample figures are shown in figure 16, and the results show that hfd+pbs group mice showed significant liver steatosis and lipid deposition, increased lipid accumulation vacuoles, while P.g bacterial intervention effectively reduced liver lipid accumulation and lipid droplet formation in the mice.

(3) Expression analysis of obesity-related genes in liver tissue

The expression level of fat mass and obesity related (Fat Mass and Obesity Associated, fto) genes in liver tissue was determined using the quantitive-PCR method, and the primer sequences are shown in table 2.

TABLE 2 primer sequences

Gene name	Upstream primer (5 '-3')	Downstream primer (5 '-3')
			Fto	GGGAAGCTAAGAAACTGA	ACTGCTGATAGAACTCATC
β-actin	TGTCACCAACTGGGACGATA	GGGGTGTTGAAGGTCTCAAA

The dilution curve of Fto primer is shown in FIG. 17, and the result shows that the primer specificity is good as a single peak, so that the subsequent experiment can be carried out. The relative expression values of the obesity related gene Fto mRNA are shown in FIG. 18, and the result shows that the expression of the HFD+PBS group mouse liver tissue Fto gene is significantly higher than that of the HFD+ P.g group (P < 0.05). Data are expressed as mean ± standard deviation, n=6.

The results show that the interference of the Paramycolatopsis aureobasidioides can improve the abnormal expression of the obesity related genes of the high-fat diet induced obese mice, thereby delaying the occurrence of obesity diseases.

(4) Analysis of obesity-related proteins in liver tissue

The relative expression levels of fat mass and obesity related protein Fto in liver tissue in (1) were determined using Western Blot immunoblotting.

The graph of Fto protein bands is shown in fig. 19, and shows that the expression of the protein Fto in liver tissue of mice in the HFD+PBS group is higher than that in mice in the HFD+ P.g group; the relative expression values of obesity-related protein Fto are shown in FIG. 20, and the results show that the expression of the HFD+PBS group mouse liver tissue Fto protein is higher than that of the HFD+ P.g group (P < 0.05). Data are expressed as mean±sd, n=3.

The results show that the interference of the Paramycolatopsis aureobasidioides can reduce the abnormal expression of the obesity-related proteins of the high-fat diet-induced obese mice, thereby improving the related symptoms of the high-fat diet-induced obesity.

Finally, it is noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalents may be made thereto without departing from the spirit and scope of the technical solution of the present invention, which is intended to be covered by the scope of the claims of the present invention.

Claims

1. Jin Sitan A. Parapsilosis (Parabacteroides goldsteinii) is used for preparing weight-reducing preparation.

2. The use according to claim 1, wherein the bacteroides bestans biological deposit No. Bio-120924 and the strain is WAL 12034.

3. The use according to claim 1 or 2, wherein the formulation comprises a medicament, a nutraceutical or a food product.

4. The use according to claim 1 or 2, wherein the bacteroides bestans is one or more combinations of live bacteria, inactivated bacteria, metabolites or ferments.

5. The use according to claim 3, wherein the bacteroides bestans is one or more combinations of live bacteria, inactivated bacteria, metabolites or ferments.

6. The use according to claim 1, 2 or 5, comprising: jin Sitan Paralopecias A.Paenii is cultured Jin Sitan Paralopecias A.Paenii when preparing the preparation for reducing fat, and the culture comprises: firstly, activating Jin Sitan pair of bacteroides freeze-dried powder strains by using a GAM (gamma-ray) culture medium, then absorbing all bacterial suspension, inoculating the bacterial suspension on a GAM agar culture medium plate, and carrying out purification culture by adopting an anaerobic culture method after the plate is coated; the individual clustered Paramycolatopsis aureobasidioides was selected, inoculated into GAM liquid medium, centrifuged after the cultivation reached log phase, the supernatant removed and the pellet resuspended in sterile PBS to make a bacterial suspension.

7. The application of claim 1, 2 or 5, wherein the application comprises one or more of the following applications:

(a) Use of a Jin Sitan parabacteroides for the preparation of a formulation for inhibiting Fto gene expression; (b) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing the level of insulin resistance; (c) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing lipid deposition in the liver; (d) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing adipocyte size.

8. The application of claim 4, wherein the application comprises one or more of the following applications: (a) Use of a Jin Sitan parabacteroides for the preparation of a formulation for inhibiting Fto gene expression; (b) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing the level of insulin resistance; (c) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing lipid deposition in the liver; (d) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing adipocyte size.

9. The application of claim 6, wherein the application comprises one or more of the following applications: (a) Use of a Jin Sitan parabacteroides for the preparation of a formulation for inhibiting Fto gene expression; (b) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing the level of insulin resistance; (c) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing lipid deposition in the liver; (d) Use of Jin Sitan bacteroides for the preparation of a formulation for reducing adipocyte size.