CN116590423A - Molecular marker for identifying egg laying performance of geese and detection method - Google Patents

Abstract

The invention discloses a molecular marker for identifying the egg laying performance of geese and a detection method, and relates to the technical field of molecular biology. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.3, the invention also provides a primer for amplifying the molecular marker, the nucleotide sequences of the primer are shown as SEQ ID NO.1 and SEQ ID NO.2, and the molecular marker primer is used for amplifying the genome DNA of the goose, when the sequence shown as SEQ ID NO.3 can be obtained by amplification, the primer shows that the goose has high egg laying performance; when the sequence can not be amplified, the goose is not provided with high egg laying performance. The molecular marker and the molecular marker primer provided by the invention can be used for efficiently and accurately identifying the geese with high egg-laying performance, have remarkable application value in the breeding of the geese, can be particularly used for identifying and screening the geese with high egg-laying performance, and provide reliable references for the breeding of the geese.

Description

Molecular marker for identifying egg laying performance of geese and detection method

Technical Field

The invention relates to the technical field of molecular biology, in particular to a molecular marker for identifying the egg laying performance of geese and a detection method.

Background

As with most economic characters, the breeding mode of the goose egg yield is mainly conventional breeding, namely, a breeding measure mainly based on phenotype selection. At present, individual cage raising of geese is not fully raised, the whole family of the goose which is bred in a confining mode is mainly selected as a selection unit, and individual stay is determined only according to the average value of the egg yield of the family. This results in a slower progress in the improvement of the egg yield of the conventionally bred geese.

In recent years, with the change of feeding modes and the development of artificial insemination technologies, the egg production and pedigree recording of goose individuals are realized, and the development enables breeding workers to estimate breeding values by using the regression of phenotype values of individuals, siblings, parents and descendants to the breeding values, and conventional breeding is carried out according to the breeding values. However, since the egg laying characteristics are also complicated by random environmental factors such as nutrition, environment, diseases and the like, the factors are barriers that the egg yield of the geese cannot be further improved based on phenotype breeding.

The twenty-first century has seen that whole genome sequencing technology has enhanced understanding of various economic traits in livestock and poultry, and whole genome selection technology has found some applications and effects in the selection of egg yield in poultry. The breeder usually integrates significant sites of functional genes for important economic traits on the basis of whole genome resequencing of different poultry, and develops a commercial breeding chip for poultry for genome selective breeding. In general, genomic selection requires calculating the effect of a marker in a reference population by known phenotypes and genotypes of candidate marker loci; then, the candidate population with known phenotype and genotype is subjected to genome breeding value estimation according to the estimated effect, so that a molecular marker for identifying and screening the egg laying performance of the geese needs to be developed, and the efficient and accurate identification of the high-egg-yield geese is realized by means of molecular biology, so that reliable reference is provided for goose breeding.

Disclosure of Invention

The invention aims to provide a molecular marker for identifying the egg laying performance of geese and a detection method, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO.3, and the invention also provides a primer for amplifying the molecular marker, the nucleotide sequence of which is shown as SEQ ID NO.1 and SEQ ID NO.2, and the molecular marker primer is used for amplifying the genome DNA of the geese, so that whether the geese have the high egg laying performance can be identified according to the sequence of an amplified product. The molecular marker and the molecular marker primer provided by the invention can be used for efficiently and accurately identifying the geese with high egg-laying performance, have remarkable application value in the breeding of the geese, can be particularly used for identifying and screening the geese with high egg-laying performance, and provide reliable references for the breeding of the geese.

In order to achieve the aim, the invention provides a molecular marker for identifying the egg laying performance of geese, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 3; the molecular marker is located on chromosome 3 of goose, wherein the reference genome of goose is PRJNA813978.

The invention also provides a primer for amplifying the molecular marker, and the nucleotide sequence of the primer is shown as SEQ ID NO.1 and SEQ ID NO. 2.

The molecular marker for identifying the egg laying performance of the geese can be used in goose breeding, and particularly can be used for identifying and screening geese with high egg laying performance.

The invention also provides a detection method for the egg laying performance of the geese, which comprises the following steps:

s1: extracting genome DNA of the goose to be detected;

s2: performing PCR amplification by using the goose genome DNA extracted in the step S1 as a template and using primers with nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO. 2;

s3: sequencing and identifying the amplified product in the step S2, and when the nucleotide sequence of the amplified product is shown as SEQ ID NO.3, indicating that the identified goose has high egg laying performance; when the nucleotide sequence of the amplified product is different from SEQ ID NO.3, the identified goose is not provided with high egg laying performance.

Further, the detection method of the above-mentioned S2 PCR amplification is specifically as follows:

the PCR amplification reaction system was 25. Mu.L: 10. Mu.M of each primer 1. Mu.L, DNA template 1. Mu.L, 2X Rapid Taq Master Mix 12.5.5. Mu.L, ddH2O 9.5. Mu.L;

PCR amplification reaction procedure: 3min at 95 ℃;95℃15sec,60℃15sec,72℃27sec,35cycles; and at 72℃for 5min.

The detection method provided by the invention can be used in goose breeding, and particularly can be used for identifying and screening geese with high egg-laying performance.

The molecular marker and the detection method for identifying the egg laying performance of the geese fill the gap of molecular biological identification and screening of the egg laying performance of the geese, and have the following advantages:

the primer provided by the invention is used for carrying out PCR amplification on the genome DNA of the goose to be detected, whether the goose to be detected has high egg laying performance or not can be judged according to the amplification result, and the result can be judged through the presence or absence of the amplification product or the specific sequence.

Drawings

FIG. 1 is a schematic diagram showing the results of screening candidate genes by taking intersections by two different methods according to the invention.

FIG. 2 shows the present invention with different goose varieties in indels _{chr3:54429172} And (5) counting the proportion of mutation at the sites.

FIG. 3 shows statistics of the expression level of ESR1 gene in goose ovary matrix in different genotypes according to the present invention.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Description: not specifically described in this embodiment are conventional test methods and conventional test materials.

Examples

Wild species, wild geese, 4 high-yield species and 9 low-yield species of parent geese (91 individuals in total) are collected at the origin of a plurality of local species, specifically shown in table 1 below, and the blood or tissue of each parent geese is collected and placed in liquid nitrogen, and then transferred to a-80 ℃ refrigerator for preservation.

TABLE 1 Source and basic information for collecting blood or tissue samples in the present invention

Genomic DNA was extracted from blood or tissue of each variety using dnasy blood and tissue kit. DNA quality was assessed using an Agilent 2200TapeStation, qubit 2.0 fluorometer and agarose gel electrophoresis. Double-ended libraries of insert size 350bp were constructed using a TruSeq library construction kit and sequenced on an IlluminaNovaSeq 6000 platform according to the manufacturer's instructions. And (3) detecting the original reads obtained by sequencing by using FastQC software. According to the quality of the original data, the quality control is carried out on the original sequencing data by using an NGS QC tool, the residual primer and the linker sequence are removed, and meanwhile, the base sequencing quality with the sequencing read length of less than 70% of each strip is also removed by more than 20. And (5) detecting the data after quality control by using FastQC software. The quality-controlled data were then aligned to the Sichuan white goose reference genome (version number: PRJNA 813978) using the 'BWA-k 40-M-R' parameters of BWA-MEM software. The resulting SAM file is converted into BAM format using SAMtools software and the unmapped and non-uniquely mapped reads are filtered. The variant information was obtained according to the best practice workflow recommended by the GATK (v4.1.7.0) software. The invention obtains 2,831,184, 200bp of original data, the average sequencing depth of each sample is 21.69×, the average alignment rate is 98.92%, and 98.22% and 95.19% of the data are respectively covered to genome 1× and 4×. Through data analysis, 12,633,596 SNP loci are obtained in total and are located in mutation on exons, wherein 853,494 is synonymous mutation type, 589,820 is non-synonymous mutation type, 7,963 is translation early termination type, 3,660 is unknown type and 797 is termination codon deletion type. Furthermore, 1,288,558 Indels were obtained, containing 543,034 insertions, 745,524 deletions.

To detect genomic regions with significant features of selective scanning, genetic differentiation index (FST) and nucleotide diversity differences (log 2θpi (geese θpi/domestic geese θpi)) were calculated within a 40kb sliding window using VCFtools software and shifted in 20kb steps throughout the genome. Considering that the selected genomic region has a low level of genetic variation, the top5% region where the allele frequency is most differentiated and the top5% region where the nucleotide diversity is most differentiated are taken as candidate selection scan regions, and genes located in or near these regions are taken as candidate genes. The FST values were 5% at TOP and were positively and negatively selected for 1376 and 30, respectively, and 1418 and 17 for the low-yielding goose species, respectively, compared to the wild geese, and 1 of these regions was inversely selected for high and low-yielding eggs, located in unassembled intact fragments, and not annotated to the genes. Of these, 536 and 11 regions were selected in both the forward and reverse directions in high and low yielding geese, respectively, annotated to 219 genes. 881 and 6 regions, respectively, were selected in either the forward or reverse direction only in low yielding goose species, annotated to 317 genes. The 840 and 18 regions, respectively, were selected in either the forward or reverse direction only in the high yielding goose species, annotated to 416 genes.

Whole genome association studies (GWAS) were performed using a mixed linear model (mixed linearmodel, MLM) program implemented in genome-wide efficient mixed model association (genome-wide efficient mixed-model association, GEMMA) software. Sequencing by using the SNPs (MAF is more than or equal to 0.05, deletion rate is less than or equal to 0.1) identified in all detected wild geese and goose clustersGWAS analysis was performed with depth of 4 or more and InDels (MAF of 0.05 or more, deletion rate of 0.3 or less, sequencing depth of 4 or more). The MLM procedure uses a statistical model 'y=xα+sβ+kμ+e', where Y represents phenotype, X represents genotype, S is a structural matrix, K is a relative relatives matrix, α and β represent fixed effects, kμ is a random effect, and e is a normal distribution residual. And (3) establishing an S matrix for population structure correction by using the first 2 principal component analysis feature vectors obtained by the SNPs or the indels, and establishing a K matrix by using a simple matching coefficient matrix. And (3) carrying out visualization processing on the Manhattan diagram and the Q-Q diagram of the GWAS result by using a qqman software package in R software. Setting P<0.05/N+1 and P<1/n+1 is set as a threshold value related to the significance and potential of the trait, and mutation information is annotated to the gene name. Bonferroni correction based on linkage disequilibrium correction was performed using estimated number of independent markers to reach 5% genome-wide level significance (P<5.15 ^e-9 ) 9 SNP sites of (B) are annotated to the relevant region of the BPIFC gene. Bonferroni correction based on linkage disequilibrium correction is carried out by adopting estimated independent marker numbers, so that the level of 5% of whole genome is obvious<6.74 ^e-8 ) The site annotation cases of (2) are shown in Table 2 below, annotated to BPIFC, RTCB, SYNE and ESR1 genes.

TABLE 2 sites with significant correlation of egg yield differences between different varieties and their comments

Indel downstream of ESR1 gene _{chr3:54429172} The genotype of the locus and the egg laying performance of the goose are subjected to correlation analysis, wherein the result schematic diagram of the intersection screening candidate genes is shown in figure 1 by adopting two different methods, and only ESR1 genes are screened by the two methods at the same time. Whereas the most significant marker in the ESR1 gene is the site Indel located downstream of the gene _{chr3:54429172} This site (Indel) _{chr3:54429172} ) Is on chromosome 3A deletion occurred in 2bp after the 54429172 bp. As shown in FIG. 2, the statistics of the ratio of the mutation at the site of the geese of different varieties shows that the mutation at the site is almost not generated in the high-yield egg-laying geese, but the ratio of the mutation at the site is higher in the low-yield egg-laying geese (2 bp deletion is generated). Meanwhile, the expression quantity of ESR1 genes in goose ovary matrixes in different genotypes is further studied, and the statistical result of the expression quantity is shown in figure 3, so that the expression quantity of ESR1 genes in goose ovary matrixes can be obviously changed after the locus is found to be homozygous and mutated.

From the above-mentioned labeled mutation sites, molecular marker primers F and R were developed, which can specifically identify the site information by PCR amplification, and specific sequences are shown below. The primers (F and R) are used for identifying the egg laying performance of the geese, the genome DNA of the geese is used as a template for PCR amplification, and when the nucleotide sequence of an amplified product is shown as SEQ ID NO.3, the identified geese have high egg laying performance; when the nucleotide sequence of the amplified product is different from SEQ ID NO.3, the identified goose is not provided with high egg laying performance. Meanwhile, the fragment with the nucleotide sequence shown as SEQ ID NO.3 can be used as a molecular marker, and can be used for identifying whether the goose to be detected has high egg laying performance or not by identifying whether the molecular marker exists or not, has obvious application value in breeding of the goose, and can be particularly used for identifying and screening the goose with high egg laying performance. In the sequence (SEQ ID NO. 3) of the molecular marker, 2bp which is thickened and marked with an underline is taken as a mutation site, and when 2bp of the site in the gene is deleted, the detected goose is represented to have high egg-laying performance.

The specific primers are (5 '. Fwdarw.3'):

F(SEQ ID NO.1)：AGGAAAAGAAAGATGACCAA；

R(SEQ ID NO.2)：TGAGATGAAAGGACAGCGT；

molecular marker (SEQ ID NO. 3):

AGGAAAAGAAAGATGACCAAGCTGTAAAGCTGTCTAATACCACAGTCTGTAATGCTTGAGGGTACTCTGGGTGTGCTTTTTTCCCCCTACACTTGCCCCATTAACCCTAGTTCATGCTATGATGATTAACACACATGTTGATGCCACACTGAGCTTTGCAACTCAAGGTAGATCTTCAAGCCACTGGTACTCATTGGATGATTTTTGCTTTAATGGGATCCTGTGAAGTTTGGGCATCCTGTGGGTATTTGTTTCAGCTTTCGCTGCTTTGTGCCAGTTCTTAGGATCATGATGTAGTTCTGCAAAAACACATTTGAAGTCATAATGGAATCAGTTCAGGGCTGGGAATTCCTTTTAGAGGAATCTGTTTCTCAAACCACTTTAACTGTTCAGGTGGAAACTTTGTCTAGAGTTGAGATTGAAGACTAGAAAGTAAGAAGCCTGAGCTGGCACTCAAGAGACCCTTAACATACTGTCACAAACTTCCTACGATTCCCTTAAGACAGCTCACAAACTGACCTTCCTATACTTGAGGGTATAGGAGGTTTACAGTTTACAAACAGGTGTTTTCCAGGTCTGTGACATTATGAATTCATTATCAATTAATTATGAAAAGTTCCTATGATCTCACATCAGCTATGCCCTACCTCTTTAATGAGGTTAACCTCCATTCCTTCTGCAGCTCATCACTTTCTTCTCAGTCTTCCTAGACTGAACATTTCATGTTCATGGGAGAGGAAAGAAGAGGGCATGACCATTATGAACAAGATGGAACCATTCTGCGCATCATCCCTCCCAAATTTTAGTGATTACTTCCCCAGACTCCACTGGAAGCTTGAATGAGGTGTAGAAGTTCTGCTTTCCTTTTATAGACAAAAGGCTGTTCTTCCCTAGGTCTTAGGGAAGTGGGTATGGCATTCAGACCATCAAAAGAGAAAGCTGCTCTGGCAGATACAAACTTTGCAGAAGTCCGTAGCTTTCTAAATGCCAAAACAGCAGTACTAGAGACAACCACACCTGGCTACTTTGCTGCAGTCCCACTTTCTTGCATATGTCCCTTCAGTCTCCCCCATCTTTGAAAGTCACCCAGAACACTCATTTTACTGAGTTCAAAAATAAGTCAGTATCATGCAATAGGATGGTTTCAGACCTCTCATACCATTGCAGTCCCTCTGATCTGATTACAACGCTGTCCTTTCATCTCA。

collecting blood or tissue of Sichuan white goose groups with individual egg laying records, extracting DNA, taking the extracted DNA as a template, carrying out PCR amplification by using the developed primers according to a PCR amplification system shown in the table 3 and a PCR amplification program shown in the table 4, and sequencing by a sanger sequencing, and judging the genotype. The genotype is adopted to carry out association analysis on the egg laying condition of Sichuan white goose groups, the locus is identified by combining PCR amplification, the goose species which are not mutated are selected for breeding statistics, the bred goose species can be found to increase the egg laying amount by 3.5 at 365 days old, and the egg laying frequency by 365 days old is obviously increased by 0.08, and the specific table 5 is shown below.

TABLE 3PCR amplification reaction System

TABLE 4PCR amplification reaction procedure

TABLE 5 Effect of Using the markers in Sichuan white geese selection

In conclusion, the molecular marker primer and the detection method provided by the invention can be used for efficiently and accurately identifying whether the identified goose has high egg laying performance or not, have remarkable application value in goose breeding, can be particularly used for identifying and screening the goose with high egg laying performance, and provide reliable reference for goose breeding.

While the present invention has been described in detail through the foregoing description of the preferred embodiment, it should be understood that the foregoing description is not to be considered as limiting the invention. Many modifications and substitutions of the present invention will become apparent to those of ordinary skill in the art upon reading the foregoing. Accordingly, the scope of the invention should be limited only by the attached claims.

Claims (8)

1. A molecular marker for identifying the egg laying performance of geese is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 3; the molecular marker is located on chromosome 3 of goose, wherein the reference genome of goose is PRJNA813978.

2. The molecular tagged amplification primer of claim 1, wherein the primer has a nucleotide sequence shown in SEQ ID No.1 and SEQ ID No. 2.

3. The use of the molecular marker of claim 1 in goose breeding.

4. The use according to claim 3, characterized in that it comprises the identification and screening of geese with high egg-laying properties.

5. The detection method for the egg laying performance of the geese is characterized by comprising the following steps of:

s1: extracting genome DNA of the goose to be detected;

s2: performing PCR amplification by using the goose genome DNA extracted in the step S1 as a template and using primers with nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO. 2;

s3: sequencing and identifying the amplified product in S2 when the nucleotide sequence of the amplified product is as follows

When shown as SEQ ID NO.3, the identified goose has high egg laying performance; when the nucleotide sequence of the amplified product is different from SEQ ID NO.3, the identified goose is not provided with high egg laying performance.

6. The method according to claim 5, wherein the PCR amplification in S2 is performed as follows:

the PCR amplification reaction system was 25. Mu.L: 10. Mu.M of each primer 1. Mu.L, DNA template 1. Mu.L, 2X Rapid TaqMasterMix 12.5.5. Mu.L, ddH2O 9.5. Mu.L;

PCR amplification reaction procedure: 3min at 95 ℃;95℃15sec,60℃15sec,72℃27sec,35cycles; and at 72℃for 5min.

7. Use of the detection method according to any one of claims 5-6 in goose breeding.

8. The use according to claim 7, characterized in that it comprises the identification and screening of geese with high egg-laying properties.