CN116549630A

CN116549630A - Vascular endothelial growth factor gene resisting medicine mediated and expressed by adeno-associated virus vector, and preparation method and application thereof

Info

Publication number: CN116549630A
Application number: CN202210119989.2A
Authority: CN
Inventors: 张仕卿; 吴小江; 顾莉萍
Original assignee: Shanghai Eyepiece Biomedical Technology Co ltd
Current assignee: Shanghai Eyepiece Biomedical Technology Co ltd
Priority date: 2022-01-29
Filing date: 2022-01-29
Publication date: 2023-08-08

Abstract

The invention discloses an anti-vascular endothelial growth factor (vascular endothelial growth factor, VEGF) gene medicament which is mediated and expressed by a novel adeno-associated virus (AAV) vector and is used for treating ocular neovascular proliferation diseases (Neovascularization disease). The adeno-associated virus vector is an adeno-associated virus AAV expression vector, and comprises a CAG promoter, a heavy chain and a light chain of an anti-VEGF single-chain antibody, an AAV serotype and the like. The invention also discloses a construction method of the expression vector of the medicine, virus package and application. The AAV8-590RGD type shell is used, so that the expression of VEGF can be effectively limited, and the proliferation of new blood vessels can be inhibited.

Description

Vascular endothelial growth factor gene resisting medicine mediated and expressed by adeno-associated virus vector, and preparation method and application thereof

Technical Field

The invention belongs to the field of genetic engineering and gene medicine treatment, in particular relates to a gene medicine, and in particular relates to an anti-vascular endothelial growth factor gene medicine which is expressed by an adeno-associated virus vector in a mediated manner and aims at a neovascular proliferation disease; in addition, the invention also relates to a preparation method and application of the medicine.

Background

It is counted that almost 10 hundred million people worldwide suffer from ocular diseases, and that the number of blinds is about 4000 ten thousand. Among them, ocular fundus neovascularization (choroidal neovascularization, CNV) is a major cause of blindness in people over 60 years of age in developed countries. The number of patients worldwide is nearly 1.5 hundred million at present, and the life quality of the aged is seriously affected. Neovascular proliferation is a major clinical manifestation of a variety of ophthalmic diseases, including age-related macular degeneration (age-related macular degeneration, AMD), diabetic retinopathy (diabetic retinopathy, DR), diabetic macular edema (diabetic macular edema, DME), retinal vein occlusion (retinal vein obstruction, RVO), and pathologically myopic choroidal neovascularization (Pathological myopic choroidal neovascularization, mCNV), among others. The common etiology of these ophthalmic neovascular-induced diseases is a decrease in the phagocytic digestibility of the extracellular ganglion membrane by retinal pigment epithelium (retina pigment epithelium, RPE) cells, the residual small bodies of the membrane remaining in the basal cell plasma to form drusen, which in turn cause the break of the Bruch's membrane, through which the choroidal capillaries pass under the RPE and under the retinal nerve epithelium to form choroidal neovascularization. Due to the structural abnormality of the neovascular wall, vascular Endothelial Growth Factor (VEGF) is expressed in large amounts, causing leakage and bleeding of blood vessels, and further causing a series of secondary pathological changes.

AAV is a DNA-deficient nonpathogenic parvovirus, and a recombinant adeno-associated virus (rAAV) vector is derived from nonpathogenic wild adeno-associated virus, and has the characteristics of weak immunogenicity, good safety, wide host range, high infection efficiency, strong tissue specificity and the like, and is an ideal gene therapy expression vector. Achieving effective gene therapy of ocular diseases also requires overcoming two difficulties: 1) The gene medicine has large molecular mass, strong hydrophilicity and poor in vivo and in vitro stability, and is not beneficial to delivery; 2) The eye has multiple protective barriers that hinder drug absorption, including anterior segment barriers represented by tear film barriers, cornea barriers, and conjunctival barriers, and posterior segment barriers represented by scleral barriers and blood-retinal barriers, and secondary vitreous and aqueous convection, etc., all limit the absorption of gene vectors. Simple gene medicine is difficult to reach focus part in eye or fundus by traditional local eye drop or systemic administration, and also difficult to enter corresponding target cells to exert the efficacy, and effective delivery of the gene medicine is realized by means of proper gene vectors. The virus vectors commonly used mainly include adenovirus vectors, lentiviral vectors, adeno-associated virus vectors, and the like. The use frequency of the adeno-associated virus is highest, and the adeno-associated virus accounts for 50% of all gene vectors, but is easy to generate stronger immune response; the lentiviral vector has the advantages of larger carrying capacity and capability of carrying a large fragment of exogenous gene for expression, but has the disadvantage of easy integration into host chromosomes to cause mutation and potential risk; AAV is an emerging gene therapy vector at present, has good application prospect, type 2 serotypes are serotypes commonly used in the current ophthalmic gene therapy, are also the most thoroughly studied serotypes, epidemiological data show that most people all over the world are infected with wild type AAV, AAV2 antibodies are already existing in infants just born, thus AAV2 is easier to cause autoimmune reaction and acquired immune reaction of human bodies, AAV8 is originally isolated from rhesus monkeys, is unique in serology, has minimal cross reaction with other serotypes, and has much lower immunogenicity than AAV. Related experiments show that the transmission efficiency of wild AAV8 in eyes to the rear eye sections of retina and the like is weak, so that 7 random amino acids are inserted into 590 positions of AAV8 serotype shells by a directed evolution method, the AAV8 serotype shells are administrated by eye drop and vitreous injection, and the serotypes of the AAV8 serotype shells after penetrating into the corresponding rear eye tissues are analyzed in target tissues of retina, retinal pigment epithelium, choroid and the like, screened and aligned, so as to obtain the AAV8 serotype evolution variant shells. Meanwhile, a transgenic mouse with over-expressed retina VEGF is taken as an animal model of the neovascular proliferation diseases, and the expression of an anti-VEGF gene drug is mediated through the intravitreal injection administration of the mouse, so that the effect of gene therapy on neovascular proliferation is observed.

Disclosure of Invention

One of the technical problems to be solved by the invention is to provide a vascular endothelial growth factor gene resistant medicament which is expressed by the mediation of an adeno-associated virus vector.

The second technical problem to be solved by the invention is to provide a method for preparing the gene medicine.

The third application problem to be solved by the invention is to provide the application of the gene medicine in the medicine for treating tissue or organ neovascular proliferation diseases.

In order to solve the technical problems, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided an anti-vascular endothelial growth factor gene drug for expression mediated by an adeno-associated viral vector, which is an adeno-associated viral AAV expression vector comprising a CAG promoter, a signal peptide (sp), a light chain variable region (VL), a Linker (Linker) heavy chain variable region (VH), a Linker region (Hinge), a crystallizable section of human immunoglobulin (fragment crystallizable, fc) and a human growth hormone polyA signal; the light chain variable region (VL) and the heavy chain variable region (VH) are taken from ranibizumab; the specific sequence is as follows:

CAG promoter: as shown in SEQ ID NO. 1;

signal peptide (sp): as shown in SEQ ID NO. 2;

light chain variable region (Light chain variable region, VL): as shown in SEQ ID NO. 3;

connector (Linker): as shown in SEQ ID NO. 4;

heavy chain variable region (Heavy chain variable region, VH): as shown in SEQ ID NO. 5;

hinge region (Hinge): as shown in SEQ ID NO. 6;

crystallizable section of human immunoglobulin (fragment crystallizable, fc): as shown in SEQ ID NO. 7;

human growth hormone polyA signal: as shown in SEQ ID NO. 8.

As a preferred technical scheme of the invention, the sequence of a Linker between the light chain variable region VL and the heavy chain variable region VH is shown in SEQ ID NO. 4.

As a preferable technical scheme of the invention, the AAV expression vector is packaged by AAV-8 modified shell AAV8-590RGD to obtain the AAV mediated expression anti-vascular endothelial growth factor gene drug. The sequence of AAV-8 modified shell AAV8-590RGD is shown in SEQ ID NO. 9.

In a second aspect of the present invention, there is provided a method for preparing an anti-vascular endothelial growth factor gene drug expressed by the vector mediated by the adeno-associated virus, comprising the steps of:

step 1, constructing an AAV expression vector;

step 2, AAV virus packaging.

As a preferable technical scheme of the invention, the step 1 specifically comprises the following steps:

step 11, designing and synthesizing SalI-VEGF-scFv-Fc (1-725 aa) -MulI gene DNA fragment, designing and synthesizing the following primers: an upstream primer: agaattggatcctctagagtcgacg, as shown in SEQ ID NO. 12; a downstream primer: tccagaggttgattacgcgttc, as shown in SEQ ID NO. 13;

step 12, performing PCR reaction on the double-stranded DNA molecules synthesized by the primers synthesized in the step 11;

step 13, cutting out a vector pAAV-CAG-LGI1-P2A-EGFP-polyA by using restriction enzymes SalI and MulI, and recovering a vector skeleton;

step 14, recombining the PCR product of step 12 and the vector skeleton of step 13, transforming into escherichia coli after water bath, screening positive bacteria and extracting plasmids thereof to obtain recombinant plasmids pAAV-CAG-sp-VL-Linker-VH-Fc-polyA, wherein the pAAV-CAG-sp-VL-Linker-VH-Fc-polyA vector sequence is shown as SEQ ID NO.10, and the sequence of the contrast blank AAV vector is shown as SEQ ID NO. 11.

In step 12, the PCR system of the PCR reaction is as follows:

the PCR procedure for the PCR reaction was as follows:

after the PCR is completed, the PCR product is recovered.

As a preferred technical scheme of the invention, in the step 13, the restriction enzyme SalI and MulI are used for cutting the starting vector pAAV-CAG-LGI1-P2A-EGFP-polyA as follows: salI 1. Mu.L, mulI 1. Mu.L, buffer 3. Mu.L, pAAV-CAG-LGI1-P2A-EGFP-polyA plasmid 1. Mu.g, make up water to 30. Mu.L; the enzyme was digested at 37℃for 4 hours.

In step 14, the recombination system for recombining the PCR product of step 12 and the vector backbone of step 13 is as follows: 15 mu L of recombinase, 40ng of recovered PCR product DNA and 20ng of recovered plasmid; the water bath condition is water bath at 42 ℃ for 30min.

As a preferable technical scheme of the invention, the step 2 specifically comprises the following steps:

step 21, cryopreserving AAV-293 cells;

step 22, passage of AAV-293 cells;

step 23, resuscitating AAV-293 cells;

step 24, aav packaging and concentrating.

In a third aspect of the invention, an application of the adenovirus-associated virus vector-mediated expression of the anti-vascular endothelial growth factor gene drug in preparing a drug for treating tissue or organ neovascular proliferation diseases is provided. Preferably, the tissue or organ neovascular proliferation disorder is ocular neovascular proliferation disorder. The ocular neovascular proliferation diseases comprise senile macular degeneration, diabetic retinopathy, diabetic macular edema, retinal vein occlusion, pathologic myopia choroidal neovascular ophthalmic diseases and the like.

Compared with the prior art, the invention has the following beneficial effects:

the vector of the invention comprises the steps of packaging AAV8-590RGD modified serotypes respectively, and comparing with a clinical medicine Abelmoschus transversely, and observing the treatment effect of the AAV8-590RGD modified serotypes on a transgenic mouse model of neovascular proliferation. Also provides the specific application and comparison of the gene medicine. Experiments prove that the AAV8-590RGD type anti-VEGF gene medicine constructed and packaged by the invention has remarkable inhibition effect on retinal vascular proliferation, is superior to the market clinical medicine Abelmosil, and the result of behaviours also shows that the photosensitivity of mice treated by the AAV-anti-VEGF gene medicine is obviously enhanced. The invention is also applicable to other diseases of neovascular proliferation.

Drawings

FIG. 1 is a schematic diagram of the structure of pAAV-CAG-sp-VL-Linker-VH-Fc-polyA vector in example 1 of the present invention. Including the CAG promoter, signal peptide (sp), light chain variable region (VL), linker (Linker), heavy chain variable region (VH), hinge region (Hinge), crystallizable section of human immunoglobulin (fragment crystallizable, fc), human growth hormone polyA signaling elements, and the like.

FIG. 2 is a schematic diagram showing the affinity of Elisa-test plasmid expression products for VEGF after transfection of ARPE-19 and CHO-K1 cells, respectively, with pAAV-CAG-sp-VL-Linker-VH-Fc-polyA vector and control blank AAV vector in example 1 of the present invention.

FIG. 3 is a schematic diagram showing that AAV8-590 RGD-anti-VEGF gene drug can target vascular endothelial growth factor in retinal tissue in example 3 of the present invention. Wherein, (A) represents vascular endothelial growth factor (green fluorescence) in retina, (B) represents anti-VEGF single-chain antibody (red fluorescence) generated by AAV8-590 RGD-anti-VEGF gene drug expression, (C) represents DAPI cell nucleus staining, (D) represents that the anti-VEGF single-chain antibody and vascular endothelial growth factor can be combined together (in circle).

FIG. 4 shows the expression of AAV8-590 RGD-mediated anti-VEGF gene drug in example 3, (A) normal mouse retinal blood vessel, (B) model mouse with neovascular proliferation, and intravitreal injection of AAV blank control group, (C-G) AAV8-590 RGD-mediated expression of the anti-VEGF gene drug, and the viral loads are 10 th order, 9 th order, 8 th order, 7 th order and 6 th order. As can be seen from the graph (C), the therapeutic effect of the 10 th order viral load is most obvious, the blood vessel morphology is clearer and more consistent, the neovascular plaque is less, and the 9 th order viral load (see the graph (D)) still has a remarkable therapeutic effect.

FIG. 5 is a plot of fluorescent pixel statistics of vascular area of retinal tissue from FIG. 4, showing significant differences (P < 0.05) between AAV blank drug groups and AAV8-590 RGD-type coat-mediated anti-VEGF gene drugs of 10-and 9-degree viral loads by Tukey multiple comparison test.

FIG. 6 shows the vascular staining patterns of retinal tissues of the normal mice (A), the vascular proliferation transgenic mice (B), the AAV blank drug group (C), the AAV-8-anti-VEGF gene drug treatment group (D), the AAV8-590 RGD-anti-VEGF gene drug treatment group (E) and the A Bai Xi general administration group (F), wherein the number of new blood vessels in the form of agglomerates is obviously smaller than that of the vascular proliferation transgenic mice (B), the A Bai Xi general administration group (F) and the AAV blank drug group (C) in the AAV-8-anti-VEGF gene drug treatment group (D) and the AAV-8-590 RGD-anti-VEGF gene drug treatment group (E) in the AAV-8-anti-VEGF gene drug treatment group (D) according to the embodiment 3 of the invention.

FIG. 7 shows that the fluorescent pixel point statistics of the vascular area of the retinal tissue in FIG. 6 show that the AAV blank drug group is significantly different from the AAV-8-anti-VEGF gene drug treatment group (D) and the AAV8-590 RGD-anti-VEGF gene drug treatment group (E) (P < 0.001), and the AAV8-590 RGD-anti-VEGF gene drug treatment group (E) is significantly different from the A Bai Xi general administration group (F) (P < 0.05).

Fig. 8 is a schematic diagram of bright-dark field behavior of mice.

FIG. 9 is a statistical representation of the time spent in dark fields in bright-dark field behavioural experiments in normal mice, AAV blank control drug group mice and AAV8-590 RGD-anti-VEGF gene drug treated group mice. Because the mice have the nature of light shielding, when the retinal light sensing capability of the mice is normal, the normal mice tend to move in dark fields in a majority of the total experimental time of 300 seconds, and the mice with impaired retinal light sensing capability (AAV blank control drug group mice) cannot effectively distinguish dark fields from bright field areas, and the mice treated by AAV8-590 RGD-VEGF gene resistant drugs show the trend to the dark field areas, which indicates that the retinal light sensing capability of the mice is recovered.

FIG. 10 is a schematic diagram showing the structure of pAAV-CAG-LGI1-Linker-EGFP-polyA vector in example 1 of the present invention;

FIG. 11 is a schematic diagram of the structure of a control blank AAV vector containing AAV-mediated expression of an anti-VEGF gene drug according to example 1 of the invention.

Detailed Description

The invention is further illustrated below in connection with specific embodiments. It should be understood that the particular embodiments described herein are presented by way of example and not limitation. The principal features of the invention may be used in various embodiments without departing from the scope of the invention.

Example 1 vector construction and detection

pAAV-CAG-sp-VL-Linker-VH-Fc-polyA vector (see FIG. 1) was constructed on the basis of pAAV-CAG-LGI1-P2A-EGFP-polyA vector (see FIG. 10 for vector structure). As shown in FIG. 10, the pAAV-CAG-LGI1-P2A-EGFP-polyA vector has a CAG promoter, a multiple cloning site MCS, EGFP fluorescent gene, an LGI1 gene, an ampicillin resistance gene, etc., and forms a DNA fragment of 6.9 kb. The original gene was removed at the multiple cloning site between the CAG promoter and polyA, and then an sp-VL-Linker-VH-Fc sequence was added to construct the vector pAAV-CAG-sp-VL-Linker-VH-Fc-polyA (see FIG. 1). The specific construction process of the vector comprises the following steps:

1. SalI-VEGF-scFv-Fc (1-725 aa) -MulI gene DNA fragment was designed and sent to Shanghai in vitro. Designing an upstream primer: agaattggatcctctagagtcgacg, as shown in SEQ ID NO.12, downstream primer: tccagaggttgattacgcgttc, shown in SEQ ID NO.13, was sent to Shanghai in vitro company for synthesis.

2. Double-stranded DNA molecules (synthesized by Shanghai Invitrogen) were synthesized using the synthesized primers, respectively, and the PCR system was as follows:

PCR was performed as follows

PCR cycle conditions:

after completion of PCR, about 1.5kb PCR product was recovered.

3. Restriction enzymes SalI and MulI are used for enzyme digestion of the starting vector pAAV-CAG-LGI1-P2A-EGFP-polyA, and enzyme digestion system is adopted: salI 1. Mu.L, mulI 1. Mu.L, buffer 3. Mu.L, pAAV-CAG-LGI1-P2A-EGFP-polyA plasmid 1. Mu.g, make up water to 30. Mu.L. And (3) enzyme cutting at 37 ℃ for 4 hours, and recovering the carrier framework.

4. Recombining the PCR product and the vector framework, and recombining the system: 15. Mu.L of recombinase, 40ng of recovered PCR product DNA, and 20ng of recovered plasmid. After 30min of water bath at 42 ℃, the recombinant plasmid pAAV-CAG-sp-VL-Linker-VH-Fc-polyA is obtained by transforming into Escherichia coli, screening positive bacteria and extracting plasmids thereof. The structural schematic diagram of the recombinant plasmid pAAV-CAG-sp-VL-Linker-VH-Fc-polyA is shown in FIG. 1.

As shown in FIG. 1, the vector pAAV-CAG-sp-VL-Linker-VH-Fc-polyA of the present invention includes a CAG promoter, a signal peptide sp, a light chain variable region VL, a Linker, a heavy chain variable region VH, a Hinge region Hinge, a crystallizable section fragment crystallizable of human immunoglobulin, fc, a human growth hormone polyA element, and the like. The gene sequence of the vector is 1512bp. FIG. 11 is a control blank AAV vector for AAV-mediated expression of an anti-VEGF gene drug.

As shown in FIG. 2, the affinity of plasmid expression products for VEGF was detected by Elisa after transfection of ARPE-19 and CHO-K1 cells, respectively, with pAAV-CAG-sp-VL-Linker-VH-Fc-polyA vector (see FIG. 1) and control blank AAV vector (see FIG. 11). The pAAV-CAG-sp-VL-Linker-VH-Fc-polyA vector expression product has significant affinity with VEGF.

AAV-8 engineered capsid AAV8-590RGD is synthesized by human beings (Shanghai inotropen company), and the sequence is shown in SEQ ID NO. 9.

Example 2 AAV viral packaging

Cryopreservation of AAV-293 cells

With increasing passage times, AAV-293 cells may exhibit decreased growth status, mutations, and the like. To prevent this, we need to freeze the cells in large quantities at the beginning to ensure the stability and persistence of the experiment. Freezing and preserving in the logarithmic growth phase of the cells, and increasing the survival rate of cell resuscitation.

1. Removing

Adding PBS into the cell culture supernatant to wash off residual culture medium;

2. adding 0.25% pancreatin, digesting for 1-2 min, observing cell rounding under a lens, removing pancreatin when the intercellular space is enlarged, adding fresh culture medium, blowing, mixing, and transferring into a centrifuge tube.

3. Counting cells, namely shaking all the cells, adding 3mL of 10% DMEM preheated at 37 ℃, blowing with a 10mL pipette, blowing with a large force for 6-8 times without dead angle, sucking all the cells out, placing the cells in a 15mL centrifuge tube, taking 50 mu L of the uniformly mixed cells in a 1.5mLeppendorf tube, adding 450 mu L of 10% DMEM, namely diluting by 10 times, uniformly mixing, and taking 10 mu L of the cells for counting in a counting plate. The counting plate is provided with 4 big lattices and 16 small lattices each. When counting, the number of cells is 4, the total number is divided by 4 (the number of cells per cell is obtained), and then multiplied by 10 (10 times dilution), namely the actual concentration of cells in n ten thousand/mL.

4. Cells were centrifuged at 1000rpm/min for 5min. The supernatant was removed.

5. Based on the cell count, the cells were resuspended at a density of 3X106 cells/mL by addition of cell cryopreservation (70% complete medium+20% FBS+10% DMSO).

6. Subpackaging into cell freezing tube, placing into freezing box, and placing into ultralow temperature refrigerator at-80deg.C.

7. The following day, the cells were stored in a liquid nitrogen tank for a long time and recorded. In the preservation process, cells are recovered from time to detect the cell survival rate, observe the cell state and the like.

Passage of (II) AAV-293 cells

When the cell grows to reach 80% -90% of the confluence rate, the cell needs to be subjected to passage operation so as to expand the number of the cells and maintain the good growth state of the cells.

1. The cells are digested and stored in the same way as the cells are frozen.

2. After the cell centrifugation is completed, complete medium is added for resuspension.

3. The cells were split into 10cm dishes, each with a make up of 10mL of medium, as the case may be.

Resuscitation of (III) AAV-293 cells

When the number of passages of the cells is too large, the cell state becomes poor, or pollution accidents occur to the cells, the cells which are frozen initially need to be discarded and recovered.

1. Setting water bath at 37-42 deg.c.

2. Checking the record of the cell bank, taking out the frozen cells from the liquid nitrogen tank according to the record (cotton gloves are needed to be worn to prevent the frozen cells from being damaged), rapidly throwing the frozen cells into a water bath kettle, rapidly shaking the frozen cells, and completely dissolving the frozen cells within 1 to 2 minutes as much as possible

Dissolving.

3. The cell solution was transferred to a 15mL centrifuge tube, and 1mL of fresh complete medium was added thereto, and after mixing, the mixture was centrifuged at 1000rpm/min for 5min.

4. The supernatant was removed, 5mL of fresh complete medium was added, and after mixing well, the pellet was transferred to a 6cm dish.

5. The dishes were incubated at 37℃in an incubator with 5% CO2 and 95% relative humidity.

6. Cell viability was observed the next day. The cells were replaced with medium. Cell growth was observed daily afterwards.

(IV) AAV packaging and concentration

1. Plasmid amplification

The constructed AAV vectors, packaging plasmids and helper plasmids need to be subjected to large-scale extraction, the concentration is more than 1 mug/mu L, and A260/280 can be used for virus packaging in a range of 1.7-1.8. A Qiagen large extraction kit is recommended for the large-scale endotoxin removal extraction of plasmids.

2. AAV-293 cell transmission

Sucking up the culture medium in a T75 bottle for culturing AAV-293 cells, adding 2mL of 0.25% pancreatin taken out by a 4-degree refrigerator to uniformly cover the bottle bottom, placing the bottle bottom in a 37-degree incubator for 3-5min, taking out, shaking to find the cells to separate from the bottom, shaking down all the cells, adding 3mL of 10% DMEM preheated in a 37-degree water bath, blowing the pipette with a 10mL pipette, blowing with a large force for 6-8 times, keeping no dead angle, ensuring that the pipette is difficult to blow at the bottle mouth, aligning the pipette with the culture port, and blowing the culture medium with small force to cover the cells close to the bottle mouth. After that, all cells were aspirated, placed in a 15mL centrifuge tube, 50 μl of the homogenized cells were taken in a 1.5mL eppendorf tube, 450 μl of 10% dmem was added, i.e. 10-fold dilution, homogenized, and 10 μl of cells were counted in a counting plate. The counting plate is provided with 4 big lattices and 16 small lattices each. When counting, the number of cells is 4, the total number is divided by 4 (the number of cells per cell is obtained), and then multiplied by 10 (10 times dilution), namely the actual concentration of cells in n ten thousand/mL. Passaging when the astronomical is the first day, if transfection is carried out the next day, spreading 900-1000 ten thousand/T75; if transfected on the third day, 350-400 ten thousand/T75 was spread. 10mL of 10% DMEM medium was added to each flask of T75. The transfection was performed by observing the cell density on the day of transfection, 80-90% full. Culture medium is not required to be changed before transfection.

3. Make lipofection complex

Note that: lipofiter transfection reagent is a Henry biological product, and the instructions for use refer to Lipofiter instructions.

Aav virus detoxification:

viral particles are present in both packaging cells and culture supernatants. Both the cells and the culture supernatant can be collected to obtain the best yields.

1) Preparing a dry ice ethanol bath (the ethanol is poured into a foam box filled with dry ice, or liquid nitrogen is used for replacing the dry ice ethanol bath) and a water bath at 37 ℃;

2) The toxigenic cells were collected along with the medium in a 15mL centrifuge tube. When collecting cells, the culture plate is inclined at a certain angle to scrape the cells into the culture medium;

3) 1000rpm/min, centrifugation for 3 minutes, separation of cells and supernatant, additional storage of supernatant, cell resuspension with 1mL PBS;

4) The cell suspension was repeatedly transferred in a dry ice ethanol bath and a 37 ℃ water bath, frozen and thawed four times. Slightly shaking after each melting. Note that: each setting and thawing takes approximately ten minutes.

Aav virus concentration:

1) Cell debris was removed by centrifugation at 10,000g and the supernatant was transferred to a new centrifuge tube.

2) Mixing the two supernatants, and filtering with 0.45 μm filter to remove impurities

3) Adding 1/2 volume of 1M NaCl,10%PEG8000 solution, mixing well, and standing at 4deg.C overnight

4) Centrifugation at 12,000rpm for 2h, discarding the supernatant, dissolving the viral pellet with an appropriate amount of PBS solution, and filtering and sterilizing with 0.22 μm filter after complete dissolution.

5) The residual plasmid DNA (final concentration 50U/mL) was removed by digestion with Benzonase nuclease. The tube cap was closed and inverted several times to mix thoroughly. Incubation at 37 ℃ for 30 min;

6) Filtering with 0.45 μm filter head, and collecting filtrate to obtain concentrated AAV virus.

Purification of AAV

1) To the virus concentrate was added solid CsCl to a density of 1.41g/mL (refractive index 1.372);

2) Adding the sample into an overspeed centrifuge tube, and filling the residual space of the centrifuge tube with a pre-prepared 1.41g/mL CsCl solution;

3) Centrifuge at 175,000g for 24 hours to develop a density gradient. Samples of different densities were collected in sequential steps and sampled for titer determination. Collecting the fraction enriched in AAV particles;

4) The above procedure was repeated once.

5) The virus was packed into 100kDa dialysis bags and desalted by 4 degree dialysis overnight. This is the purified AAV virus

AAV virus packaging titre assay (Q-PCR method)

1) mu.L of concentrated virus solution is taken, 1 mu.L of RNAse-free DNAse is added, and the mixture is uniformly mixed and reacted in a water bath at 37 ℃ for 30min.

2) Centrifuge at 12 rpm/min at 4℃for 10min, take 10. Mu.L of supernatant into another sterile 1.5mL EP tube.

3) Mu. L Dilution Buffer (1 mM Tris-HCl, pH 8.0,0.1mM EDTA,150mM NaCl) was added, mixed well and reacted in a metal bath at 37℃for 30min.

4) Naturally cooling to room temperature, adding 1 mu L of proteinase K, and reacting for 1h in a water bath at 65 ℃.

5) The metal bath is reacted for 10min at the temperature of 100 ℃, and the reaction is naturally cooled to the room temperature.

6) The titer was detected by Q-PCR.

Storage and dilution of AAV viruses

1. Storage of virus:

after the virus liquid is received, the experiment is carried out by using adeno-associated virus in a short time, and the virus can be temporarily stored at 4 ℃; if long-term preservation is required, placing the virus in-80deg.C (frozen storage tube), and sealing with sealing film.

1) The virus can be stored at-80 ℃ for more than 6 months; however, if the virus is stored for more than 6 months, it is recommended that the virus titer be re-determined before use.

2) Repeated freeze thawing reduces viral titers: each freeze thawing reduces viral titer by 10%; therefore, repeated freeze thawing should be avoided as much as possible in the use process of the virus, and in order to avoid repeated freeze thawing, split charging is recommended according to the usage amount of each time after the virus is received.

2. Dilution of virus:

if dilution of the virus is desired, please remove the virus and thaw it in ice bath, then use PBS buffer or culture target cells serum-free medium (serum or dual antibody containing does not affect virus infection). Mixing, packaging, storing at 4deg.C (please use up in three days), and packaging.

AAV safety precautions

1. Biological safety cabinets are preferably used for virus handling. If the virus is operated by using the common ultra-clean bench, the exhaust fan is not required to be turned on.

2. When the virus is operated, the experiment clothes are worn, and the mask and the glove are taken.

3. Special care is taken not to generate aerosol or splash when handling the virus. If the ultra clean bench is contaminated by virus during operation, the ultra clean bench is immediately wiped clean with 70% ethanol and 1% SDS solution. The tips, centrifuge tubes, culture plates, culture media, etc. that had been exposed to the virus were immersed in 84 disinfectant or 1% SDS overnight and discarded.

4. The following steps should be followed when observing the infection of cells with a microscope: screw down the flask or cover the plate. The outer wall of the culture flask is cleaned by 70% ethanol, and then observed and photographed by a microscope. Before leaving the microscope stand, the microscope stand was cleaned with 70% ethanol.

5. If centrifugation is required, a centrifuge tube with good sealing performance is used, or a centrifuge tube in a tissue culture chamber is used as much as possible after sealing by a sealing film.

6. After removing the glove, both hands are washed with soap and water.

Example 3 administration and detection of an animal model for neovascular proliferation

1. Constructing a C57BL/6J transgenic neovascular proliferation animal model mouse knocked in human VEGFA at a ROSA26 locus of the mouse;

2. transgenic animal model mice, breeding and genotype identification, and taking heterozygous transgenic mice as experimental groups for experiments;

2. 14-day-old mice are taken and anesthetized with 4.3% chloral hydrate at 0.01 mL/g;

3. mydriatic fluid mydriatic, methyl cellulose keeps the ocular surface moist;

4. adjusting the head position of the mouse, wherein the injection position is positioned about 1mm behind the limbus;

5. making a incision by using a 33G injector, enabling a needle tip to vertically enter, then tilting, slowly injecting AAV gene medicine, gene medicine contrast and Abelmoschus with the volume of 1 mu L into a mouse vitreous cavity, leaving a needle for 0.5-1min after injection, and rapidly taking out the needle;

6. after one week, 200. Mu.L of fluorescein isothiocyanate-labeled dextran (5 mg/mL) was injected into the tail vein for angiography, after 3 minutes, mice were sacrificed, petaloid incision was performed, the light-sensitive cell layer (inner side) was laid up, and the condition of the neovascular proliferation of the comparative bolus was observed; as can be seen from FIG. 4, (A) is normal mouse retinal blood vessel, the morphology of the blood vessel is regular and consistent without vascular plaque, (B) is a model mouse with neovascular proliferation, the blood vessel is irregular and broken by injecting AAV blank control group into the vitreous cavity, and a plurality of neovascular plaque exists, (C-G) is AAV8-590RGD type shell mediated VEGF gene drug expression, and the viral loads are 10 th order viral load, 9 th order viral load, 8 th order viral load, 7 th order viral load and 6 th order viral load. The figure shows that the treatment effect of the 10-time square viral load is most obvious, the blood vessel morphology is clearer and more consistent, the neovascular plaque is less, and the 9-time square viral load still has more obvious treatment effect. FIG. 5 is a graph showing statistical analysis of neovascular area using Tukey multiple comparison test, and AAV blank for healthy mice and mice vascular proliferation model injection, AAV8-590RGD antibody drug and mice vascular proliferation model injection, and significant differences of three stars (P < 0.001). FIG. 6 shows the vascular staining patterns of retinal tissues of normal mice (A), vascular proliferation transgenic mice (B), AAV blank drug group (C), AAV-8-anti-VEGF gene drug treatment group (D), AAV8-590 RGD-anti-VEGF gene drug treatment group (E) and A Bai Xi general administration group (F), and it can be seen from the patterns that the number of new blood vessels in the form of agglomerates is significantly smaller than that of vascular proliferation transgenic mice (B), A Bai Xi general administration group (F) and AAV blank drug group (C) in AAV-8-anti-VEGF gene drug treatment group (D) and AAV-8-anti-VEGF gene drug treatment group (E) is better than that of AAV-8-anti-VEGF gene drug treatment group (D). FIG. 3 is a schematic diagram showing that AAV8-590 RGD-anti-VEGF gene drug in example 3 can target vascular endothelial growth factor in retinal tissue. Wherein, (A) represents vascular endothelial growth factor (green fluorescence) in retina, (B) represents anti-VEGF single-chain antibody (red fluorescence) generated by AAV8-590 RGD-anti-VEGF gene drug expression, (C) represents DAPI cell nucleus staining, (D) represents that the anti-VEGF single-chain antibody and vascular endothelial growth factor can be combined together (in circle). FIG. 7 shows that the fluorescent pixel point statistics of the vascular area of the retinal tissue in FIG. 6 show that the AAV blank drug group is significantly different from the AAV-8-anti-VEGF gene drug treatment group (D) and the AAV8-590 RGD-anti-VEGF gene drug treatment group (E) (P < 0.001), and the AAV8-590 RGD-anti-VEGF gene drug treatment group (E) is significantly different from the A Bai Xi general administration group (F) (P < 0.05). FIG. 9 is a graph showing the statistics of the time for a mouse to stay in a dark field in a behavioural experiment of the dark field of the mouse after administration of a gene drug, wherein the experimental time period is 300 seconds, and the phototropism of the mouse, that is, the time for the mouse to stay in the dark field, is observed. The Tukey multiple comparison test shows that, the AAV8-590RGD antibody drug and the mouse vascular proliferation model are injected with AAV blank control, and the significant difference between two stars (P < 0.01) is shown, thus the vision of the mouse is obviously improved after gene drug treatment, and the time in dark field is prolonged.

Sequence listing

<110> Shanghai eyepiece biomedical technology Co., ltd

<120> an anti-vascular endothelial growth factor gene drug expressed by the mediation of adeno-associated virus vector, and its preparation method and application

<130> WH002211406

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 937

<212> DNA

<213> Artificial sequence (unknown)

<400> 1

ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac tttccattga 60

cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca agtgtatcat 120

atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg gcattatgcc 180

cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt agtcatcgct 240

attaccatgg tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc 300

ccacccccaa ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg 360

gggggggggg ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg cggggcgagg 420

cggagaggtg cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc ttttatggcg 480

aggcggcggc ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcggg agtcgctgcg 540

acgctgcctt cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc cccggctctg 600

actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa 660

ttagcgcttg gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa gccttgaggg 720

gctccgggag ggccctttgt gcggggggag cggctcgggg ctgtccgcgg ggggacggct 780

gccttcgggg gggacggggc agggcggggt tcggcttctg gcgtgtgacc ggcggctcta 840

gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg ggcaacgtgc 900

tggttattgt gctgtctcat cattttggca aagaatt 937

<210> 2

<211> 63

<212> DNA

<213> Artificial sequence (unknown)

<400> 2

atggagagag gactgccact cctgtgcgca gtgctggctc tggtcctggc tccagcagga 60

gca 63

<210> 3

<211> 333

<212> DNA

<213> Artificial sequence (unknown)

<400> 3

gacatccagc tgacccagtc tcctagcagc ctgagcgcta gcgtgggaga tagagtgacc 60

atcacttgca gcgccagcca ggacatcagc aactacctga attggtacca gcagaagccc 120

ggcaaggccc ctaaggtgct gatctacttc acaagcagcc tgcacagcgg agtgccttct 180

agattcagcg gcagcggaag cggcacagat ttcaccctga ccatcagcag cctgcagcca 240

gaggacttcg ccacctacta ctgccagcag tacagcaccg tgccttggac attcggccag 300

gggaccaagg tggagatcaa gaggaccgtg gcc 333

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (unknown)

<400> 4

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatct 45

<210> 5

<211> 372

<212> DNA

<213> Artificial sequence (unknown)

<400> 5

gaagtgcagc tggtggaaag cggaggagga ctggtgcagc caggaggatc tctgagactg 60

tcttgcgccg ctagcggcta cgatttcacc cactacggca tgaattgggt ccggcaggca 120

ccaggaaaag gactggagtg ggtcggatgg atcaacacct acaccggcga gcctacctac 180

gccgccgatt tcaagaggcg gttcaccttc agcctggata ccagcaagag caccgcctac 240

ctgcagatga acagcctgag ggccgaggat accgccgtgt actattgcgc caagtacccc 300

tactactacg gcaccagcca ttggtacttc gacgtctggg gacagggaac actggtgaca 360

gtgtctagcg cc 372

<210> 6

<211> 36

<212> DNA

<213> Artificial sequence (unknown)

<400> 6

gaaccgaaaa gctgcgacaa aactcacaca tgccca 36

<210> 7

<211> 699

<212> DNA

<213> Artificial sequence (unknown)

<400> 7

gaaccgaaaa gctgcgacaa aactcacaca tgcccaccgt gcccagcacc tgaactcctg 60

gggggaccgt cagtcttcct cttcccccca aaacccaagg acaccctcat gatctcccgg 120

acccctgagg tcacatgcgt ggtggtggac gtgagccacg aagaccctga ggtcaagttc 180

aactggtacg tggacggcgt ggaggtgcat aatgccaaga caaagccgcg ggaggagcag 240

tacaacagca cgtaccgtgt ggtcagcgtc ctcaccgtcc tgcaccagga ctggctgaat 300

ggcaaggagt acaagtgcaa ggtctccaac aaagccctcc cagcccccat cgagaaaacc 360

atctccaaag ccaaagggca gccccgagaa ccacaggtgt acaccctgcc cccatcccgg 420

gaggagatga ccaagaacca ggtcagcctg acctgcctgg tcaaaggctt ctatcccagc 480

gacatcgccg tggagtggga gagcaatggg cagccggaga acaactacaa gaccacgcct 540

cccgtgctgg actccgacgg ctccttcttc ctctacagca agctcaccgt ggacaagagc 600

aggtggcagc aggggaacgt cttctcatgc tccgtgatgc acgaggctct gcacaaccac 660

tacacgcaga agagcctctc cctgtctccg ggtaaatga 699

<210> 8

<211> 479

<212> DNA

<213> Artificial sequence (unknown)

<400> 8

acgggtggca tccctgtgac ccctccccag tgcctctcct ggccctggaa gttgccactc 60

cagtgcccac cagccttgtc ctaataaaat taagttgcat cattttgtct gactaggtgt 120

ccttctataa tattatgggg tggagggggg tggtatggag caaggggcaa gttgggaaga 180

caacctgtag ggcctgcggg gtctattggg aaccaagctg gagtgcagtg gcacaatctt 240

ggctcactgc aatctccgcc tcctgggttc aagcgattct cctgcctcag cctcccgagt 300

tgttgggatt ccaggcatgc atgaccaggc tcagctaatt tttgtttttt tggtagagac 360

ggggtttcac catattggcc aggctggtct ccaactccta atctcaggtg atctacccac 420

cttggcctcc caaattgctg ggattacagg cgtgaaccac tgctcccttc cctgtcctt 479

<210> 9

<211> 7366

<212> DNA

<213> Artificial sequence (unknown)

<400> 9

ccgccatgcc ggggttttac gagattgtga ttaaggtccc cagcgacctt gacgagcatc 60

tgcccggcat ttctgacagc tttgtgaact gggtggccga gaaggaatgg gagttgccgc 120

cagattctga catggatctg aatctgattg agcaggcacc cctgaccgtg gccgagaagc 180

tgcagcgcga ctttctgacg gaatggcgcc gtgtgagtaa ggccccggag gctcttttct 240

ttgtgcaatt tgagaaggga gagagctact tccacatgca cgtgctcgtg gaaaccaccg 300

gggtgaaatc catggttttg ggacgtttcc tgagtcagat tcgcgaaaaa ctgattcaga 360

gaatttaccg cgggatcgag ccgactttgc caaactggtt cgcggtcaca aagaccagaa 420

atggcgccgg aggcgggaac aaggtggtgg atgagtgcta catccccaat tacttgctcc 480

ccaaaaccca gcctgagctc cagtgggcgt ggactaatat ggaacagtat ttaagcgcct 540

gtttgaatct cacggagcgt aaacggttgg tggcgcagca tctgacgcac gtgtcgcaga 600

cgcaggagca gaacaaagag aatcagaatc ccaattctga tgcgccggtg atcagatcaa 660

aaacttcagc caggtacatg gagctggtcg ggtggctcgt ggacaagggg attacctcgg 720

agaagcagtg gatccaggag gaccaggcct catacatctc cttcaatgcg gcctccaact 780

cgcggtccca aatcaaggct gccttggaca atgcgggaaa gattatgagc ctgactaaaa 840

ccgcccccga ctacctggtg ggccagcagc ccgtggagga catttccagc aatcggattt 900

ataaaatttt ggaactaaac gggtacgatc cccaatatgc ggcttccgtc tttctgggat 960

gggccacgaa aaagttcggc aagaggaaca ccatctggct gtttgggcct gcaactaccg 1020

ggaagaccaa catcgcggag gccatagccc acactgtgcc cttctacggg tgcgtaaact 1080

ggaccaatga gaactttccc ttcaacgact gtgtcgacaa gatggtgatc tggtgggagg 1140

aggggaagat gaccgccaag gtcgtggagt cggccaaagc cattctcgga ggaagcaagg 1200

tgcgcgtgga ccagaaatgc aagtcctcgg cccagataga cccgactccc gtgatcgtca 1260

cctccaacac caacatgtgc gccgtgattg acgggaactc aacgaccttc gaacaccagc 1320

agccgttgca agaccggatg ttcaaatttg aactcacccg ccgtctggat catgactttg 1380

ggaaggtcac caagcaggaa gtcaaagact ttttccggtg ggcaaaggat cacgtggttg 1440

aggtggagca tgaattctac gtcaaaaagg gtggagccaa gaaaagaccc gcccccagtg 1500

acgcagatat aagtgagccc aaacgggtgc gcgagtcagt tgcgcagcca tcgacgtcag 1560

acgcggaagc ttcgatcaac tacgcagaca ggtaccaaaa caaatgttct cgtcacgtgg 1620

gcatgaatct gatgctgttt ccctgcagac aatgcgagag aatgaatcag aattcaaata 1680

tctgcttcac tcacggacag aaagactgtt tagagtgctt tcccgtgtca gaatctcaac 1740

ccgtttctgt cgtcaaaaag gcgtatcaga aactgtgcta cattcatcat atcatgggaa 1800

aggtgccaga cgcttgcact gcctgcgatc tggtcaatgt ggatttggat gactgcatct 1860

ttgaacaata aatgatttaa atcaggtatg gctgccgatg gttatcttcc agattggctc 1920

gaggacaacc tctctgaggg cattcgcgag tggtgggcgc tgaaacctgg agccccgaag 1980

cccaaagcca accagcaaaa gcaggacgac ggccggggtc tggtgcttcc tggctacaag 2040

tacctcggac ccttcaacgg actcgacaag ggggagcccg tcaacgcggc ggacgcagcg 2100

gccctcgagc acgacaaggc ctacgaccag cagctgcagg cgggtgacaa tccgtacctg 2160

cggtataacc acgccgacgc cgagtttcag gagcgtctgc aagaagatac gtcttttggg 2220

ggcaacctcg ggcgagcagt cttccaggcc aagaagcggg ttctcgaacc tctcggtctg 2280

gttgaggaag gcgctaagac ggctcctgga aagaagagac cggtagagcc atcaccccag 2340

cgttctccag actcctctac gggcatcggc aagaaaggcc aacagcccgc cagaaaaaga 2400

ctcaattttg gtcagactgg cgactcagag tcagttccag accctcaacc tctcggagaa 2460

cctccagcag cgccctctgg tgtgggacct aatacaatgg ctgcaggcgg tggcgcacca 2520

atggcagaca ataacgaagg cgccgacgga gtgggtagtt cctcgggaaa ttggcattgc 2580

gattccacat ggctgggcga cagagtcatc accaccagca cccgaacctg ggccctgccc 2640

acctacaaca accacctcta caagcaaatc tccaacggga catcgggagg agccaccaac 2700

gacaacacct acttcggcta cagcaccccc tgggggtatt ttgactttaa cagattccac 2760

tgccactttt caccacgtga ctggcagcga ctcatcaaca acaactgggg attccggccc 2820

aagagactca gcttcaagct cttcaacatc caggtcaagg aggtcacgca gaatgaaggc 2880

accaagacca tcgccaataa cctcaccagc accatccagg tgtttacgga ctcggagtac 2940

cagctgccgt acgttctcgg ctctgcccac cagggctgcc tgcctccgtt cccggcggac 3000

gtgttcatga ttccccagta cggctaccta acactcaaca acggtagtca ggccgtggga 3060

cgctcctcct tctactgcct ggaatacttt ccttcgcaga tgctgagaac cggcaacaac 3120

ttccagttta cttacacctt cgaggacgtg cctttccaca gcagctacgc ccacagccag 3180

agcttggacc ggctgatgaa tcctctgatt gaccagtacc tgtactactt gtctcggact 3240

caaacaacag gaggcacggc aaatacgcag actctgggct tcagccaagg tgggcctaat 3300

acaatggcca atcaggcaaa gaactggctg ccaggaccct gttaccgcca acaacgcgtc 3360

tcaacgacaa ccgggcaaaa caacaatagc aactttgcct ggactgctgg gaccaaatac 3420

catctgaatg gaagaaattc attggctaat cctggcatcg ctatggcaac acacaaagac 3480

gacgaggagc gtttttttcc cagtaacggg atcctgattt ttggcaaaca aaatgctgcc 3540

agagacaatg cggattacag cgatgtcatg ctcaccagcg aggaagaaat caaaaccact 3600

aaccctgtgg ctacagagga atacggtatc gtggcagata acttgcagca gcaaaacttg 3660

gctagaggtg atagcacaaa gtctgccacg gctcctcaaa ttggaactgt caacagccag 3720

ggggccttac ccggtatggt ctggcagaac cgggacgtgt acctgcaggg tcccatctgg 3780

gccaagattc ctcacacgga cggcaacttc cacccctctc cgctgatggg cggctttggc 3840

ctgaaacatc ctccgcctca gatcctgatc aagaacacgc ctgtacctgc ggatcctccg 3900

accaccttca accagtcaaa gctgaactct ttcatcacgc aatacagcac cggacaggtc 3960

agcgtggaaa ttgaatggga gctgcagaag gaaaacagca agcgctggaa ccccgagatc 4020

cagtacacct ccaactacta caaatctaca agtgtggact ttgctgttaa tacagaaggc 4080

gtgtactctg aaccccgccc cattggcacc cgttacctca cccgtaatct gtaattgcct 4140

gttaatcaat aaaccggttg attcgtttca gttgaacttt ggtctctgcg aagggcgaat 4200

tcgtttaaac ctgcaggact agaggtcctg tattagaggt cacgtgagtg ttttgcgaca 4260

ttttgcgaca ccatgtggtc acgctgggta tttaagcccg agtgagcacg cagggtctcc 4320

attttgaagc gggaggtttg aacgcgcagc cgccaagccg aattctgcag atatccatca 4380

cactggcggc cgctcgacta gagcggccgc caccgcggtg gagctccagc ttttgttccc 4440

tttagtgagg gttaattgcg cgcttggcgt aatcatggtc atagctgttt cctgtgtgaa 4500

attgttatcc gctcacaatt ccacacaaca tacgagccgg aagcataaag tgtaaagcct 4560

ggggtgccta atgagtgagc taactcacat taattgcgtt gcgctcactg cccgctttcc 4620

agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg 4680

gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc 4740

ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag 4800

gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 4860

aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 4920

gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 4980

ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 5040

cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt 5100

cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 5160

gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 5220

cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 5280

agttcttgaa gtggtggcct aactacggct acactagaag aacagtattt ggtatctgcg 5340

ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 5400

ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 5460

gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact 5520

cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa 5580

attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 5640

accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 5700

ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 5760

gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 5820

agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 5880

ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 5940

ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 6000

gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 6060

ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 6120

tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 6180

tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 6240

cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 6300

tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 6360

gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 6420

tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 6480

ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 6540

attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc 6600

cgcgcacatt tccccgaaaa gtgccaccta aattgtaagc gttaatattt tgttaaaatt 6660

cgcgttaaat ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat 6720

cccttataaa tcaaaagaat agaccgagat agggttgagt gttgttccag tttggaacaa 6780

gagtccacta ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg 6840

cgatggccca ctacgtgaac catcacccta atcaagtttt ttggggtcga ggtgccgtaa 6900

agcactaaat cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc 6960

gaacgtggcg agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag 7020

tgtagcggtc acgctgcgcg taaccaccac acccgccgcg cttaatgcgc cgctacaggg 7080

cgcgtcccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc 7140

ttcgctatta cgccagctgg cgaaaggggg atgtgctgca aggcgattaa gttgggtaac 7200

gccagggttt tcccagtcac gacgttgtaa aacgacggcc agtgagcgcg cgtaatacga 7260

ctcactatag ggcgaattgg gtaccgggcc ccccctcgat cgaggtcgac ggtatcgggg 7320

gagctcgcag ggtctccatt ttgaagcggg aggtttgaac gcgcag 7366

<210> 10

<211> 5797

<212> DNA

<213> Artificial sequence (unknown)

<400> 10

cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 60

cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 120

acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 180

ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 240

ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 300

gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 360

gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 420

ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 480

actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 540

gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 600

ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta 660

ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 720

gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 780

tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 840

tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 900

aatcaatcta aagtatatat gagtaaactt ggtctgacag tcagaagaac tcgtcaagaa 960

ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 1020

ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 1080

gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 1140

ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1200

gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1260

ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1320

gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1380

catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1440

ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1500

ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1560

cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1620

gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1680

gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatactct 1740

tcctttttca atattattga agcatttatc agggttattg tctcatgagc ggatacatat 1800

ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc 1860

cacctaaatt gtaagcgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag 1920

ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac 1980

cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga 2040

ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc 2100

accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg 2160

gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa 2220

gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac 2280

caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc cattcaggct 2340

gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctgcgcgc 2400

tcgctcgctc actgaggccg cccgggcaaa gcccgggcgt cgggcgacct ttggtcgccc 2460

ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc 2520

cttgtagtta atgattaacc cgccatgcta cttatctacg tagccatgct ctaggaagat 2580

cgtaccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca 2640

ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta 2700

tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta 2760

tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat 2820

cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca tctccccccc 2880

ctccccaccc ccaattttgt atttatttat tttttaatta ttttgtgcag cgatgggggc 2940

gggggggggg ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc 3000

gaggcggaga ggtgcggcgg cagccaatca gagcggcgcg ctccgaaagt ttccttttat 3060

ggcgaggcgg cggcggcggc ggccctataa aaagcgaagc gcgcggcggg cgggagtcgc 3120

tgcgacgctg ccttcgcccc gtgccccgct ccgccgccgc ctcgcgccgc ccgccccggc 3180

tctgactgac cgcgttactc ccacaggtga gcgggcggga cggcccttct cctccgggct 3240

gtaattagcg cttggtttaa tgacggcttg tttcttttct gtggctgcgt gaaagccttg 3300

aggggctccg ggagggccct ttgtgcgggg ggagcggctc ggggctgtcc gcggggggac 3360

ggctgccttc gggggggacg gggcagggcg gggttcggct tctggcgtgt gaccggcggc 3420

tctagagcct ctgctaacca tgttcatgcc ttcttctttt tcctacagct cctgggcaac 3480

gtgctggtta ttgtgctgtc tcatcatttt ggcaaagaat tggatcctct agagtcgacg 3540

ccaccatgga gagaggactg ccactcctgt gcgcagtgct ggctctggtc ctggctccag 3600

caggagcaga catccagctg acccagtctc ctagcagcct gagcgctagc gtgggagata 3660

gagtgaccat cacttgcagc gccagccagg acatcagcaa ctacctgaat tggtaccagc 3720

agaagcccgg caaggcccct aaggtgctga tctacttcac aagcagcctg cacagcggag 3780

tgccttctag attcagcggc agcggaagcg gcacagattt caccctgacc atcagcagcc 3840

tgcagccaga ggacttcgcc acctactact gccagcagta cagcaccgtg ccttggacat 3900

tcggccaggg gaccaaggtg gagatcaaga ggaccgtggc cggtggcggt ggctcgggcg 3960

gtggtgggtc gggtggcggc ggatctgaag tgcagctggt ggaaagcgga ggaggactgg 4020

tgcagccagg aggatctctg agactgtctt gcgccgctag cggctacgat ttcacccact 4080

acggcatgaa ttgggtccgg caggcaccag gaaaaggact ggagtgggtc ggatggatca 4140

acacctacac cggcgagcct acctacgccg ccgatttcaa gaggcggttc accttcagcc 4200

tggataccag caagagcacc gcctacctgc agatgaacag cctgagggcc gaggataccg 4260

ccgtgtacta ttgcgccaag tacccctact actacggcac cagccattgg tacttcgacg 4320

tctggggaca gggaacactg gtgacagtgt ctagcgccga accgaaaagc tgcgacaaaa 4380

ctcacacatg cccaccgtgc ccagcacctg aactcctggg gggaccgtca gtcttcctct 4440

tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc acatgcgtgg 4500

tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg 4560

aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg taccgtgtgg 4620

tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac aagtgcaagg 4680

tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc aaagggcagc 4740

cccgagaacc acaggtgtac accctgcccc catcccggga ggagatgacc aagaaccagg 4800

tcagcctgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg gagtgggaga 4860

gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgctggac tccgacggct 4920

ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag gggaacgtct 4980

tctcatgctc cgtgatgcac gaggctctgc acaaccacta cacgcagaag agcctctccc 5040

tgtctccggg taaatgaacg cgtaaacggg tggcatccct gtgacccctc cccagtgcct 5100

ctcctggccc tggaagttgc cactccagtg cccaccagcc ttgtcctaat aaaattaagt 5160

tgcatcattt tgtctgacta ggtgtccttc tataatatta tggggtggag gggggtggta 5220

tggagcaagg ggcaagttgg gaagacaacc tgtagggcct gcggggtcta ttgggaacca 5280

agctggagtg cagtggcaca atcttggctc actgcaatct ccgcctcctg ggttcaagcg 5340

attctcctgc ctcagcctcc cgagttgttg ggattccagg catgcatgac caggctcagc 5400

taatttttgt ttttttggta gagacggggt ttcaccatat tggccaggct ggtctccaac 5460

tcctaatctc aggtgatcta cccaccttgg cctcccaaat tgctgggatt acaggcgtga 5520

accactgctc ccttccctgt ccttatcgat aaggatcttc ctagagcatg gctacgtaga 5580

taagtagcat ggcgggttaa tcattaacta caaggaaccc ctagtgatgg agttggccac 5640

tccctctctg cgcgctcgct cgctcactga ggccgggcga ccaaaggtcg cccgacgccc 5700

gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc agctgcatta atgaatcggc 5760

caacgcgcgg ggagaggcgg tttgcgtatt gggcgct 5797

<210> 11

<211> 4146

<212> DNA

<213> Artificial sequence (unknown)

<400> 11

cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 60

cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 120

acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 180

ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 240

ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 300

gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 360

gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 420

ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 480

actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 540

gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 600

ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta 660

ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 720

gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 780

tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 840

tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 900

aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 960

aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg 1020

tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 1080

gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 1140

agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 1200

aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 1260

gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 1320

caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc 1380

cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 1440

ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 1500

ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 1560

gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 1620

cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 1680

gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 1740

caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 1800

tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 1860

acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 1920

aagtgccacc taaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta 1980

aatcagctca ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga 2040

atagaccgag atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa 2100

cgtggactcc aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga 2160

accatcaccc taatcaagtt ttttggggtc gaggtgccgt aaagcactaa atcggaaccc 2220

taaagggagc ccccgattta gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga 2280

agggaagaaa gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg 2340

cgtaaccacc acacccgccg cgcttaatgc gccgctacag ggcgcgtccc attcgccatt 2400

caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct 2460

gcgcgctcgc tcgctcactg aggccgcccg ggcaaagccc gggcgtcggg cgacctttgg 2520

tcgcccggcc tcagtgagcg agcgagcgcg cagagaggga gtggccaact ccatcactag 2580

gggttccttg tagttaatga ttaacccgcc atgctactta tctacgtagc catgctctag 2640

gaagatcgta ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac 2700

tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca 2760

agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 2820

gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt 2880

agtcatcgct attaccatgg tcgaggtgag ccccacgttc tgcttcactc tccccatctc 2940

ccccccctcc ccacccccaa ttttgtattt atttattttt taattatttt gtgcagcgat 3000

gggggcgggg gggggggggg ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg 3060

cggggcgagg cggagaggtg cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc 3120

ttttatggcg aggcggcggc ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcggg 3180

agtcgctgcg acgctgcctt cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc 3240

cccggctctg actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc 3300

cgggctgtaa ttagcgcttg gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa 3360

gccttgaggg gctccgggag ggccctttgt gcggggggag cggctcgggg ctgtccgcgg 3420

ggggacggct gccttcgggg gggacggggc agggcggggt tcggcttctg gcgtgtgacc 3480

ggcggctcta gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg 3540

ggcaacgtgc tggttattgt gctgtctcat cattttggca aagaattgga tcttctagag 3600

ctagcgaatt cgccaccctc gagagcttat cgataaatcg ataccgtcga cccgggcggc 3660

cgcttcgagc agacatgata agatacattg atgagtttgg acaaaccaca actagaatgc 3720

agtgaaaaaa atgctttatt tgtgaaattt gtgatgctat tgctttattt gtaaccatta 3780

taagctgcaa taaacaagtt aacaacaaca attgcattca ttttatgttt caggttcagg 3840

gggagatgtg ggaggttttt taaagcaagt aaaacctcta caaatgtggt aaaatcgata 3900

aggatcttcc tagagcatgg ctacgtagat aagtagcatg gcgggttaat cattaactac 3960

aaggaacccc tagtgatgga gttggccact ccctctctgc gcgctcgctc gctcactgag 4020

gccgggcgac caaaggtcgc ccgacgcccg ggctttgccc gggcggcctc agtgagcgag 4080

cgagcgcgca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg 4140

ggcgct 4146

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<220>

<221> misc_feature

<223> primer

<400> 12

agaattggat cctctagagt cgacg 25

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (unknown)

<220>

<221> misc_feature

<223> primer

<400> 13

tccagaggtt gattacgcgt tc 22

Claims

1. An anti-vascular endothelial growth factor gene drug which is expressed by the mediation of an adeno-associated virus vector, which is characterized in that the adeno-associated virus vector is an adeno-associated virus AAV expression vector and comprises a CAG promoter, a signal peptide sp, a light chain variable region VL, a heavy chain variable region VH, a Hinge region Hinge, a crystallizable section Fc of human immunoglobulin and a human growth hormone polyA signal; the heavy chain variable region VH and the light chain variable region VL are derived from ranibizumab; the specific sequence is as follows:

CAG promoter: as shown in SEQ ID NO. 1;

signal peptide sp: as shown in SEQ ID NO. 2;

light chain variable region VL: as shown in SEQ ID NO. 3;

heavy chain variable region VH: as shown in SEQ ID NO. 5;

hinge region Hinge: as shown in SEQ ID NO. 6;

crystallizable section Fc of human immunoglobulin: as shown in SEQ ID NO. 7;

human growth hormone polyA signal: as shown in SEQ ID NO. 8.

2. The anti-vascular endothelial growth factor gene drug of claim 1, wherein the sequence of the Linker between the light chain variable region VL and the heavy chain variable region VH is shown in SEQ ID No. 4.

3. The anti-vascular endothelial growth factor gene drug according to claim 1, wherein the adeno-associated virus AAV expression vector is packaged with AAV-8 engineered capsid AAV8-590RGD to obtain an AAV-mediated expression anti-vascular endothelial growth factor gene drug;

the sequence of AAV-8 modified shell AAV8-590RGD is shown in SEQ ID NO. 9.

4.A method for preparing an anti-vascular endothelial growth factor gene drug mediated by an adeno-associated viral vector according to any one of claims 1-3, comprising the steps of:

step 1, constructing an AAV expression vector;

step 2, AAV virus packaging.

5. The method of claim 4, wherein step 1 comprises the steps of:

6. The method of claim 5, wherein in step 12, the PCR system of the PCR reaction is as follows:

the PCR procedure for the PCR reaction was as follows:

PCR cycle conditions:

after the PCR is completed, the PCR product is recovered.

7. The method of claim 5, wherein in step 13, the restriction enzyme system for the restriction enzyme SalI and MulI to cleave the starting vector pAAV-CAG-LGI1-P2A-EGFP-polyA is as follows: salI 1. Mu.L, mulI 1. Mu.L, buffer 3. Mu.L, pAAV-CAG-LGI1-P2A-EGFP-polyA plasmid 1. Mu.g, make up water to 30. Mu.L; the enzyme was digested at 37℃for 4 hours.

8. The method according to claim 5, wherein in step 14, the recombination system for recombining the PCR product of step 12 and the vector backbone of step 13 is: 15 mu L of recombinase, 40ng of recovered PCR product DNA and 20ng of recovered plasmid; the water bath condition is water bath at 42 ℃ for 30min.

9. The method of claim 4, wherein step 2 comprises the steps of:

step 21, cryopreserving AAV-293 cells;

step 22, passage of AAV-293 cells;

step 23, resuscitating AAV-293 cells;

step 24, aav packaging and concentrating.

10. Use of an anti-vascular endothelial growth factor gene drug expressed by the vector of any one of claims 1 to 3 in the preparation of a medicament for treating tissue or organ neovascular proliferation diseases.

11. The use according to claim 10, wherein the tissue or organ neovascular proliferation disorder is ocular neovascular proliferation disorder.

12. The use according to claim 11, wherein the ocular neovascular proliferation disorders include age-related macular degeneration, diabetic retinopathy, diabetic macular edema, retinal vein occlusion, and pathologic myopic choroidal neovascular ophthalmic disorders.