CN116536448B - KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof - Google Patents

KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof Download PDF

Info

Publication number
CN116536448B
CN116536448B CN202310763894.9A CN202310763894A CN116536448B CN 116536448 B CN116536448 B CN 116536448B CN 202310763894 A CN202310763894 A CN 202310763894A CN 116536448 B CN116536448 B CN 116536448B
Authority
CN
China
Prior art keywords
sweet corn
gene
yield
fructose
fructose content
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202310763894.9A
Other languages
Chinese (zh)
Other versions
CN116536448A (en
Inventor
李坤
朱文广
李高科
于永涛
胡建广
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CROP Research Institute of Guangdong Academy of Agricultural Sciences
Original Assignee
CROP Research Institute of Guangdong Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CROP Research Institute of Guangdong Academy of Agricultural Sciences filed Critical CROP Research Institute of Guangdong Academy of Agricultural Sciences
Priority to CN202310763894.9A priority Critical patent/CN116536448B/en
Publication of CN116536448A publication Critical patent/CN116536448A/en
Application granted granted Critical
Publication of CN116536448B publication Critical patent/CN116536448B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Botany (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof relate to the technical field of genetic engineering; the application of the gene Zm00001d042066 in the fructose amount and yield identification of sweet corn is located at the 149.5Mb position of the genome No. 3 chromosome of sweet corn. The gene is a key functional gene for regulating and controlling fructose in sweet corn, the expression quantity of the gene has obvious correlation with the fructose content and the lateral root quantity of plants, and the gene is used for identifying the fructose quantity and yield of the sweet corn and has high accuracy. The KASP molecular marker is closely linked with the fructose amount and yield of the sweet corn, the sweet corn can be rapidly subjected to genotyping through a fluorescence quantitative PCR instrument, the fructose amount and yield can be effectively predicted, the selection precision of breeding can be improved, and the KASP molecular marker has important application value in genetic improvement of high-yield low-fructose content characters of the sweet corn and is suitable for large-scale popularization and application.

Description

KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a KASP (KASP sequence related to fructose content and yield of sweet corn) marker and application thereof.
Background
Sweet corn is a crop with rich nutrition and used as both fruits and vegetables. Among the numerous sweet corn evaluation indexes, yield is one of the most important economic indexes, and directly determines the economic value of sweet corn. Subaedah S T (2021) et al suggested that sucrose in sweet corn is the main manifestation of sweet taste in sweet corn, while other sugars such as fructose, glucose, maltose, melezitose, etc. also play a role in sweet corn flavor formation. Moreover, the sugar not only affects the flavor of corn, but also can be used as a sugar signal molecule to affect the growth and development of corn and even the final yield. The evaluation mode of the sweet taste of the excessively sweet corn in the prior sweet corn breeding is mainly a mode of grading by artificial taste. There is little research on the content and function of each saccharide. Yang Quan female (2018) and the like consider that the determination of saccharides in sweet corn mainly includes methods such as near infrared spectroscopy, resorcinol method, liquid chromatography and the like. However, each method has the defects that the operation of the spectrometry experiment is relatively simple, but the error is larger. The chemical method is complex to operate and has a certain dangerous line. Liquid chromatography is more accurate but costly. Although sugars are related to sweet corn yield, quality, there is no corresponding biological or genetic marker to detect and predict sweet corn yield.
The yield is an important economic index in sweet corn production, is a complex agronomic character, and is influenced by factors such as inheritance, climate, cultivation and the like. Under certain circumstances, genetic improvement is an important way to increase sweet corn yield. Direct genetic localization and mechanical resolution of yield traits is very challenging. Yang N (2019) et al have found genetic variation for controlling yield factors by decomposing yield traits into single traits such as grain width, grain length, grain thickness, grain number and the like for genetic localization and genetic function analysis, and genetically improving the yield traits. In addition, wen W (2015) et al found that yield and agronomic traits can be predicted by specific markers (agronomic traits, metabolite traits, etc.). The above research provides a theoretical basis for predicting crop yield by genetic means.
The current prediction of fructose content in sweet corn by genetic markers is essentially blank. The fructose content among different sweet corn germplasm has rich genetic variation, and the effective fructose-related genetic markers can be obtained by using analysis methods (association analysis, linkage analysis and the like) of population genetics along with the reduction of the whole genome sequencing price. In recent years, molecular markers have also been widely developed in sweet corn breeding, such as PAPD (randomly amplified polymorphic DNA) markers, SSR (simple repeat) markers, inDel (InDel) markers, and the like. PAPD markers are not stable enough, SSR marker density is low, and the PAPD markers are often influenced by factors such as recombination, selection and the like in the breeding process; the InDel mark density is lower; the SNP markers cover the whole genome basically uniformly, and the density is high; SNP markers close enough to the functional variation can be identified, so that the marker is prevented from being invalid due to recombination and the like; the detection KASP for SNP has the characteristics of simple operation, low cost and short period, and is very suitable for being used as a technical means of molecular marking type. Therefore, the development of the molecular marker with high yield and low fructose content based on whole genome association analysis and KASP technical research has great significance.
Disclosure of Invention
In order to overcome the defects in the prior art, one of the purposes of the invention is to provide application of the gene Zm00001d042066 in the identification of fructose amount and yield of sweet corn. The gene Zm00001d042066 is a key functional gene for regulating and controlling fructose in sweet corn, the expression quantity of the gene has a remarkable correlation with the fructose content and the lateral root quantity of plants, and meanwhile, the gene can be used for identifying the yield of the sweet corn due to the fact that the yield and the fructose content are in a negative correlation, and the accuracy is high.
The second purpose of the invention is to provide an application of an expression inhibitor of the gene Zm00001d042066 in reducing the fructose content of sweet corn. The fructose content and the yield of sweet corn can be effectively regulated and controlled by controlling the expression of the gene Zm00001d 042066.
The invention further aims to provide a KASP molecular marker closely linked with the fructose amount and yield of the sweet corn, the KASP molecular marker is closely linked with the fructose amount and yield of the sweet corn, the condition of the fructose amount and yield can be effectively predicted, the selection precision of breeding can be improved, and the KASP molecular marker has important application value in genetic improvement of high-yield low-fructose content characters of the sweet corn and is suitable for large-scale popularization and application.
The invention aims at providing a KASP molecular marker primer group which can flexibly and economically complete detection of SNP loci and efficiently identify alleles with high yield and low fructose content of sweet corn, so that the high yield and low fructose sweet corn and other types of sweet corn can be accurately distinguished, and the KASP molecular marker primer group plays an important role in promoting high yield and high quality breeding of sweet corn.
The invention aims to provide a kit for detecting the fructose content and the yield of high-sweet corn, which can effectively detect KASP molecular markers and identify the high-yield low-fructose-content sweet corn.
The sixth purpose of the invention is to provide a screening method for high-yield low-fructose sweet corn, which can effectively predict the fructose amount and yield of breeding and has high accuracy.
One of the purposes of the invention is realized by adopting the following technical scheme:
use of the gene Zm00001d042066 in the identification of fructose and yield in sweet corn, said gene Zm00001d042066 being located at the 149.5Mb position of chromosome 3 of the sweet corn genome.
Further, when the gene Zm00001d042066 increased expression, it was identified that the fructose content of sweet corn was increased; when the gene Zm00001d042066 reduced expression, it was identified that the fructose content of sweet corn was reduced.
Further, a method for identifying fructose amount and yield of sweet corn comprises the following steps:
s1, analyzing the allelic types of the gene Zm00001d042066 in a sample to be tested, wherein the allelic types comprise HG1 haplotype, HG2 haplotype and HG3 haplotype;
s2, identifying the fructose amount and yield of the sweet corn according to the expression amount of HG2 haplotype of the gene Zm00001d 042066.
The second purpose of the invention is realized by adopting the following technical scheme:
use of an expression inhibitor of gene Zm00001d042066 for reducing fructose content in sweet corn.
The third purpose of the invention is realized by adopting the following technical scheme:
a KASP molecular marker closely linked to fructose amount and yield of sweet corn comprising at least one of the following SNP sites:
1) The SNP locus of 149522680 position of chromosome 3 of sweet corn genome has polymorphism of C/A;
2) The SNP locus of 149524563 position of chromosome 3 of sweet corn genome has polymorphism A/C;
3) The SNP locus of 149525378 position of chromosome 3 of sweet corn genome has polymorphism of T/C;
4) The SNP locus of 149526365 position of chromosome 3 of sweet corn genome has polymorphism A/G;
5) The SNP locus of 149526884 position of chromosome 3 of sweet corn genome has G/A polymorphism;
6) The SNP locus of 149526939 position of chromosome 3 of sweet corn genome has polymorphism of T/G;
7) The SNP locus of 149526953 position of chromosome 3 of sweet corn genome has polymorphism of C/G;
8) The SNP locus of 149527531 position of chromosome 3 of sweet corn genome has polymorphism of C/G;
9) The SNP locus of 149527659 position of chromosome 3 of sweet corn genome has polymorphism of C/T;
10 A SNP site at 149527664 position of chromosome 3 of sweet corn genome, the polymorphism is C/T;
11 A SNP site at 149527769 position of chromosome 3 of sweet corn genome, the polymorphism is C/T;
12 A SNP site at 149527813 position of chromosome 3 of sweet corn genome, the polymorphism is G/T;
13 A SNP site at position 149529596 of chromosome 3 of sweet corn genome, the polymorphism is G/A;
14 A SNP site at position 149529878 of chromosome 3 of sweet corn genome, polymorphism A/T;
15 A SNP site at position 149530290 of chromosome 3 of sweet corn genome, the polymorphism is A/G;
16 A SNP site at position 149530322 of chromosome 3 of sweet corn genome, the polymorphism is T/C;
17 A SNP site at position 149530635 of chromosome 3 of sweet corn genome, the polymorphism is G/A;
18 A SNP site at position 149531279 of chromosome 3 of sweet corn genome, the polymorphism is G/A;
19 A SNP site at position 149531432 of chromosome 3 of sweet corn genome, the polymorphism is A/G;
20 A SNP site at position 149531501 of chromosome 3 of sweet corn genome, the polymorphism is A/G.
Further, the KASP molecular marker is a SNP locus at 149529878 position of chromosome 3 of sweet corn genome, and the allele with high yield and low fructose content is TT type gene.
The fourth purpose of the invention is realized by adopting the following technical scheme:
a primer set for detecting a KASP molecular marker closely linked to fructose and yield of sweet corn, comprising a KASP molecular marker as set forth in SEQ ID NO: 1. the first primer shown as SEQ ID NO:2 and a second primer as set forth in SEQ ID NO:3, a third primer shown in FIG. 3.
Further, the first primer is labeled with a HEX fluorophore and the second primer is labeled with a FAM fluorophore.
The fifth technical scheme adopted by the invention is as follows:
a kit for detecting fructose content and yield of high-sweet corn comprises the KASP molecular marker primer group.
The sixth purpose of the invention is realized by adopting the following technical scheme:
a screening method of high-yield low-fructose sweet corn comprises the following steps:
a1, obtaining a Zm00001d042066 gene fragment at 149.5Mb position of genome No. 3 chromosome in a sweet corn sample;
a2, KASP amplification is carried out on the gene fragment by adopting the kit, and a sample of TT type gene serving as an allele at 149529878 position of chromosome 3 of the sweet corn genome is screened out, so that corn germplasm with high yield and low fructose content is obtained.
Compared with the prior art, the invention has the beneficial effects that:
the gene Zm00001d042066 of the invention is applied to the identification of fructose amount and yield of sweet corn. The gene Zm00001d042066 is a key functional gene for regulating and controlling fructose in sweet corn, the expression quantity of the gene has a remarkable correlation with the fructose content and the lateral root quantity of plants, and meanwhile, the gene can be used for identifying the yield of the sweet corn due to the fact that the yield and the fructose content are in a negative correlation, and the accuracy is high.
The invention relates to application of an expression inhibitor of a gene Zm00001d042066 in reducing fructose content of sweet corn. The fructose content and the yield of sweet corn can be effectively regulated and controlled by controlling the expression of the gene Zm00001d 042066.
The KASP molecular marker closely linked with the fructose amount and yield of the sweet corn is closely linked with the fructose amount and yield of the sweet corn, is suitable for detection by a common high-throughput detection means, can quickly genotype the sweet corn by a fluorescent quantitative PCR instrument, can effectively predict the conditions of the fructose amount and yield, can improve the selection precision of breeding, has important application value in genetic improvement of high-yield low-fructose content traits of the sweet corn, and is suitable for large-scale popularization and application.
The KASP molecular marker primer group can flexibly and economically complete detection of SNP loci, and efficiently identify alleles with high yield and low fructose content of sweet corn, so that the high yield and low fructose sweet corn is accurately distinguished from other types of sweet corn, and plays an important role in promoting high yield and high quality breeding of the sweet corn.
The kit for detecting the fructose content and the yield of the high-sweet corn can effectively detect KASP molecular markers and identify the high-yield low-fructose-content sweet corn.
The screening method of the sweet corn with high yield and low fructose content can effectively predict the fructose amount and yield of breeding and has high accuracy.
Drawings
FIG. 1 is a Manhattan chart and candidate genes of the related analysis of fructose content trait genes in example 1 of the present invention; wherein the x-axis represents the physical location of the chromosome and the y-axis represents the negative logarithm (upper) of log10 of the P-value of the corresponding SNP;the candidate gene region color represents the average expression level of the gene (bottom) in the sweet corn population, with a threshold line of p=1.0×10 -6 。
FIG. 2 is a diagram showing haplotype analysis of the gene Zm00001d042066 of example 1 of the present invention; wherein a in fig. 2 is a schematic representation of the division of sweet corn populations into three haplotype groups by PCA analysis; b in FIG. 2 is a plot of the difference in fructose content across haplotype groups; FIG. 2, c, is a plot of the difference in sweet corn cob weight in different haplotype groups.
FIG. 3 is a graph showing the results of gene editing of the gene Zm00001d042066 of example 1 of the present invention; wherein, WT is wild line, M1/M2 is knockout line.
FIG. 4 a is a graph showing the comparison of the differences in fructose content in the edit line of the gene Zm00001d042066 of example 1 of the present invention; FIG. 4 b is a graph showing the comparison of the yield in the edit line of the gene Zm00001d042066 of example 1 of the present invention.
FIG. 5 is a graph showing the genotyping results of the A/T sites using the KASP markers in example 2 of the present invention.
FIG. 6 is a graph showing comparison of differences in fructose content and yield in the A/T allele in example 2 of the present invention.
Detailed Description
The present invention will be further described with reference to the following specific embodiments, and it should be noted that, on the premise of no conflict, new embodiments may be formed by any combination of the embodiments or technical features described below.
In the following examples, the specific conditions are specified by the conventional experimental conditions or the experimental conditions suggested by the manufacturer, and the various reagents involved in the examples are commercially available unless otherwise specified.
In order to supplement the blank state of genetic markers for predicting the fructose content in sweet corn in the prior art, the invention provides a method for identifying high-yield low-fructose sweet corn by utilizing the correlation analysis and KASP technology to develop the molecular markers in the gene Zm00001d 042066. Determining fructose content phenotype data of a plurality of sweet corn inbred lines by a chromatography-mass spectrometry method, combining high-density SNP markers of a whole genome, performing whole genome base association analysis on the fructose phenotype, identifying to obtain a fructose content functional gene Zm00001d042066, identifying to obtain 20 SNP loci related to fructose content and yield as KASP molecular markers, and providing a high-efficiency identification means for genetic improvement of high-yield traits of sweet corn by the application of the molecular markers; meanwhile, the invention designs a primer for one SNP by using a KASP technical method to realize the identification of high-yield low-fructose sweet corn.
Example 1
Screening and analysis of Gene Zm00001d042066
1. Materials and methods
1.1 Sweet corn material
This example collected 295 parts of material from widely representative selfing line material collected from the major sweet corn growing areas of the world (including china, united states, thailand, japan, argentine, etc.), and consisted of a sweet corn selfing line population. In 2019, we planted the present sweet corn population with a completely random block field design for collecting phenotype data and set 2 biological replicates at a planting density of: the row length is 2.5 meters, the plant spacing is 0.25 meter, and the row spacing is 0.7 meter. Each plant was subjected to selfing treatment, and yield measurements and grain sampling (about 20 g) were performed 20 days after pollination. The sample is quickly frozen in liquid nitrogen and then stored in a refrigerator at-80 ℃ until the sugar content is measured.
1.2 determination of saccharide content
Sugar metabolite extraction:
before sugar metabolite extraction we harvested young kernels of sweet corn germplasm with 2 biological replicates (20 days after pollination) and stored in an environment of-80 ℃. Sweet corn kernels pre-chilled in liquid nitrogen were ground for 30 seconds at a frequency of 30 Hz using a grinder (MM 400; retsch). Extraction of saccharide metabolites was performed as described in Wang H (2019) et al. The extract was centrifuged at 14000 rpm for 10 minutes at 4 ℃. Two fixed volumes of 200 μl of polar phase (lower phase) were transferred separately into pre-labeled 1.5 mL microcentrifuge tubes. The samples were then dried without heating using a vacuum concentrator (SpeedVac; thermo fisher) concentrator. Two dried 200 μl polarity phase aliquots in each sample were analyzed using GC-MS to detect metabolites.
1.3 determination of saccharide metabolites (gas chromatography-mass spectrometry):
for saccharide metabolite analysis, the dried treatments were derivatized with N-methyl-N- (trimethylsilyl) trifluoroacetamide and further analyzed using GC-MS (7890A-5975C, agilent, USA). 1 μl of the liquid mixture was removed from each sample and GC-MS was injected in split mode (50:1) at 270 ℃, helium carrier gas (> 99.999% purity) flow set to 1 mL/min and the-35 MS UI (30 m ×0.25 mm,0.25 μm) capillary column was separated by DB. The temperature was isothermal at 90 ℃ for 4 minutes, then increased to 205 ℃ at a rate of 8 ℃ per minute, then kept constant for 2 minutes, and finally increased to 310 ℃ at a rate of 15 ℃ per minute and kept constant for 5 minutes. The transmission line temperature was set at 300 ℃ and the ion source temperature was set at 230 ℃. The mass range of the analysis was 85-700 m/z.
2. Extraction of corn sample DNA
The extraction of corn sample DNA adopts a CTAB method, about 50mg of corn seedling leaves are placed in a 2ml centrifuge tube, frozen by liquid nitrogen, added with steel beads and put into a grinding instrument for grinding, then CTAB extraction buffer solution is added, and the corn seedling leaves are put into a water bath at 65 ℃ for water bath for 30 minutes; taking out the water bath from the centrifuge tube, and placing the centrifuge tube at room temperature for 10 minutes; an equal volume of chloroform was added: isoamyl alcohol (24:1) to a centrifuge tube, sealing, and putting into a shaking table to shake for 20 minutes; after centrifugation at room temperature for 10 minutes at 14,000rpm, the supernatant was carefully aspirated into a fresh 1.5 ml centrifuge tube at about 500 microliters; adding 2/3 volume of isopropanol, and placing in a-20 refrigerator for 30 minutes; centrifuge at 14,000rpm for 10 minutes at room temperature and pour off the supernatant. Washing the DNA precipitate with 1ml of 75% alcohol 1 time, centrifuging at 14,000rpm at room temperature for 10 minutes each time, and pouring the ethanol liquid; slightly airing the DNA precipitate at room temperature; the DNA precipitate was dissolved by adding 0.3ml of ddH 2O.
3. Whole genome association analysis
By combining fructose phenotype data with SNP data covering the whole genome, a number of genes which may have a relation to the variation of the phenotype data are screened as candidate genes by association analysis. The candidate gene was confirmed to be the gene causing the phenotypic change by verification of the candidate gene.
The method comprises the following steps: combining 980 ten thousand high quality SNP markers obtained from 295 sweet corn populations, correlation analysis was performed on fructose content and genome-wide SNP using a Mixed Linear Model (MLM) provided by TASSEL3.0 software. The Kinship matrix is calculated by the software TASSEL3 and the PCA is calculated by the GCTA software.
The results show that a significant QTL site (P.ltoreq.1X10) was identified at the 149.5Mb position of chromosome 3 of the sweet corn genome -6 ). This QTL locus contains 279 SNPs up to significant levels, the most significant SNP can account for 14.5% of fructose variation.
As shown in FIG. 1, by screening the genes within this QTL, we determined that the gene Zm00001d042066 is a functional gene of this QTL. The basis of the screening is the following 2 points:
(1) The significant SNP sites are located within the gene region.
(2) The expression level and fructose content of the gene Zm00001d042066 were significant (r=0.30, p=1.17×10 -6 ) Is a correlation of (3).
4. High-yield low-fructose-content allele analysis of sweet corn
As shown in fig. 2, by further haplotype analysis, we found that the gene Zm00001d042066 had mainly three haplotypes (HG (haplotype group) haplotype, HG2 haplotype and HG3 haplotype), with fructose content of haplotype 2 (HG 2) significantly lower than other types of haplotype, while also significantly higher yield of haplotype 2 than other haplotypes.
At the same time, haplotype 2 was a rare allele type with a low proportion (about 12%) in the whole population by allele frequency analysis. The gene is not strongly selected in the breeding process of sweet corn, so that the beneficial allele is not enriched in the existing breeding materials, and the gene has strong screening and application values.
5. Functional identification of candidate genes by CRISPR/cas9
To verify the function of the gene Zm00001d042066, the exon region of the gene was edited by using the gene editing technique, and the knockout line of the gene was obtained. A sgRNA was designed in the first and second exon regions of gene Zm00001d042066, respectively, to edit this region using cas9 editing system, and yield and fructose content measurements were performed on knockout line and wild line. The gene editing experiments were performed according to Liu (2020) et al report procedure, which was performed by the company Ulmi Biotechnology Co.
As shown in FIG. 3, the knockout line of the gene Zm00001d042066 was obtained by CRISPR-cas9 editing technique.
As shown in FIG. 4, the fructose content and agronomic characteristics of the knockout line of the gene Zm00001d042066 were identified, and the number of lateral roots and the yield of plants in the knockout line were reduced, and the fructose content was only 2.4% of that of the wild line. This demonstrates that the gene Zm00001d042066 is indeed a key gene for fructose regulation and also has an effect on yield. Zm00001d042066 is a functional gene identified by fructose content whole genome, the gene can change the expression of fructose and corn yield, and the expression inhibitor of the gene Zm00001d042066 has certain application potential in reducing the fructose content of sweet corn.
Example 2
KASP molecular marker development and primer design
1. Kasp molecular marker development
The strong mutants artificially created by the gene editing of example 1 verify the function of the gene Zm00001d042066 in terms of fructose content and yield, while suggesting that weak mutation types in natural populations may have important utility. This example uses PCA analysis of 279 SNPs on gene Zm00001d042066 to divide gene Zm00001d042066 into 3 haplotype groups.
By combining the data of the ear weight and the fructose content in the sweet corn population, the haplotype 2 is an advantageous allele type and has the characteristics of low fructose content and high yield. As shown in Table 1, we identified 20 SNP allele types unique to haplotype group 2, 4 of which are located in the coding region of gene Zm00001d042066, all belonging to synonymous mutations.
TABLE 1 SNP loci useful for high yield low fructose sweet corn screening
As can be seen from Table 1, the invention screens out 20 SNP allele types specific to haplotype group 2, the frequency of the favorable allele type in this haplotype type is 100%, and the frequency of the favorable allele type in other haplotype types is 0%, so that haplotype group 2 can be separated from other types of materials by typing out the specific SNP in haplotype group 2; by genotyping the SNP, high-yield sweet corn with low fructose content can be effectively identified.
2. KASP labeled primer design
We designed a pair of KASP marker primers for the SNP (A/T) at position 149529878 of the genome at one of the above SNP sites.
Primer design was done in the web tool primer-blast provided at NCBI. Primer synthesis and dilution were performed by LGC corporation (Laboratory of the Government Chemist, hodeston, UK).
Primer information is as follows:
KASP primer sequence F1: CAGATTGAGAGCCCACCCAA (SEQ ID NO: 1)
KASP primer sequence F2: CAGATTGAGAGCCCACCCAT (SEQ ID NO: 2)
KASP universal primer sequence: GCCTGTAGGTTGGGAGAAGG (SEQ ID NO: 3)
PCR amplification was performed using the designed primers, and the reaction system for PCR amplification is shown in Table 2 (96-well plate, 10. Mu.l reaction system):
TABLE 2
The KASP amplification reaction procedure is shown in Table 3:
TABLE 3 Table 3
The result of the KASP amplification reaction is shown in figure 5, SNP T of the KASP primer excites HEX fluorescence in the high-yield low-fructose sweet corn material, SNP A excites FAM fluorescence in the non-high-yield low-fructose sweet corn material, and the allele TT and the allele AA can be distinguished through fluorescence quantitative PCR detection; the KASP primer developed by the invention can flexibly and economically complete SNP detection, and can well separate high-yield low-fructose sweet corn from other types of sweet corn.
As shown in fig. 6, combined with ear weight and fructose content data in the sweet corn population, allele TT type material had 46% lower fructose content than allele AA and 9.7% higher yield than allele AA. The application of the marker in sweet corn identification plays an important role in promoting high-yield and high-quality breeding of sweet corn.
The above embodiments are only preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, but any insubstantial changes and substitutions made by those skilled in the art on the basis of the present invention are intended to be within the scope of the present invention as claimed.

Claims (7)

1. The application of the reagent for detecting the expression level of the gene Zm00001d042066 in the identification of the fructose content of sweet corn is characterized in that: the gene Zm00001d042066 is located at 149.5Mb of chromosome 3 of the sweet corn genome, and when the gene Zm00001d042066 increases expression, it is identified that the fructose content of sweet corn is increased; when the gene Zm00001d042066 reduced expression, it was identified that the fructose content of sweet corn was reduced.
2. Use of an agent for detecting the allele of the gene Zm00001d042066 in the identification of fructose and yield in sweet corn, characterized in that: the alleles include HG1 haplotype, HG2 haplotype and HG3 haplotype; the fructose content of HG2 is significantly lower than that of other haplotypes, and the yield of HG2 is significantly higher than that of other haplotypes; the 20 SNP allele types specific for HG2 are as follows:
。
3. use of an expression inhibitor of gene Zm00001d042066 for reducing fructose content in sweet corn, characterized in that: the expression inhibitor of the gene Zm00001d042066 is to inhibit the expression of the gene Zm00001d042066 by the CRISPR-cas9 editing technology.
4. A KASP molecular marker primer set, characterized in that: comprising the amino acid sequence as shown in SEQ ID NO: 1. the first primer shown as SEQ ID NO:2 and a second primer as set forth in SEQ ID NO:3, a third primer shown in FIG. 3.
5. The KASP molecular marker primer set of claim 4 wherein: the first primer is labeled with a HEX fluorophore and the second primer is labeled with a FAM fluorophore.
6. A kit for detecting fructose content and yield of high-sweet corn is characterized in that: a KASP molecular marker primer set comprising the nucleic acid molecule of claim 4 or 5.
7. The screening method of the sweet corn with high yield and low fructose content is characterized by comprising the following steps of:
a1, obtaining a Zm00001d042066 gene fragment at 149.5Mb position of genome No. 3 chromosome in a sweet corn sample;
a2, KASP amplification is carried out on the gene fragment by adopting the kit of claim 6, and samples of which the allele at 149529878 position of chromosome 3 of the sweet corn genome is TT-type genes are screened out, so that corn germplasm with high yield and low fructose content is obtained, wherein the position is based on B73V4.
CN202310763894.9A 2023-06-27 2023-06-27 KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof Active CN116536448B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310763894.9A CN116536448B (en) 2023-06-27 2023-06-27 KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310763894.9A CN116536448B (en) 2023-06-27 2023-06-27 KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof

Publications (2)

Publication Number Publication Date
CN116536448A CN116536448A (en) 2023-08-04
CN116536448B true CN116536448B (en) 2023-11-10

Family

ID=87445610

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310763894.9A Active CN116536448B (en) 2023-06-27 2023-06-27 KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof

Country Status (1)

Country Link
CN (1) CN116536448B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008220269A (en) * 2007-03-13 2008-09-25 Japan Grassland Farming Forage Seed Association Primer set for detecting dna marker linked to gene locus relating to fat-content in corn seed and its use
WO2011019331A1 (en) * 2009-08-12 2011-02-17 Abbott & Cobb, Inc. Methods for enhancing the production and consumer traits of plants
CN112553363A (en) * 2020-12-11 2021-03-26 广东省农业科学院作物研究所 Molecular marker closely linked with vigor character of sweet corn seeds and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110214200A1 (en) * 2009-10-30 2011-09-01 Syngenta Participations Ag Yield traits for maize
US9861048B2 (en) * 2014-12-22 2018-01-09 Hm.Clause, Inc. Hybrid sweet corn plant HMX5385WS

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008220269A (en) * 2007-03-13 2008-09-25 Japan Grassland Farming Forage Seed Association Primer set for detecting dna marker linked to gene locus relating to fat-content in corn seed and its use
WO2011019331A1 (en) * 2009-08-12 2011-02-17 Abbott & Cobb, Inc. Methods for enhancing the production and consumer traits of plants
CN112553363A (en) * 2020-12-11 2021-03-26 广东省农业科学院作物研究所 Molecular marker closely linked with vigor character of sweet corn seeds and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Kun Li 等.Multi-omics analyses reveal the flavor code of sweet corn.SSRN Electronic Journal.2022,第1-49页. *
玉米开花期转录因子候选基因的关联分析;马拴红 等;中国农业科学;第55卷(第1期);第12-25页 *
甜玉米品质遗传改良研究进展;李坤 等;广东农业科学;第47卷(第11期);第70-77页 *

Also Published As

Publication number Publication date
CN116536448A (en) 2023-08-04

Similar Documents

Publication Publication Date Title
Chapman et al. A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus)
CN111979345B (en) Development and application of KASP (Kaempferi protein) marker related to wheat biomass and yield under salt stress condition
CN111763755B (en) SNP molecular marker of rice cadmium absorption related gene OsNRAMP5 and application thereof
CN109609671B (en) SNP molecular marker for detecting leaf edge cracking character of brassica species and vegetables and application thereof
CN108504773B (en) Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker
Walia et al. Array-based genotyping and expression analysis of barley cv. Maythorpe and Golden Promise
CN116536448B (en) KASP molecular marker closely linked with fructose amount and yield of sweet corn and application thereof
CN113862387B (en) Molecular marker of rice drought tolerance regulatory gene OsNAC6 and application thereof
CN112941084B (en) Gene and molecular marker for osmotic stress caused by salt stress tolerance of corn and application of gene and molecular marker
CN115852021A (en) SNP molecular marker for identifying wheat grain weight and grain length and application thereof
CN114574627A (en) Pea neutral SNaPshot marker and application thereof in population genetic diversity analysis
CN116397041B (en) InDel marker SiDmr6 closely linked with millet saline-alkali sensitivity, primer and application thereof
CN112342309B (en) SNP molecular marker related to cotton flower basal leaf spot character and application thereof
CN114032330B (en) SNP molecular marker for rapidly identifying apple anthracnose
CN112176094B (en) Method for screening wheat with different thousand grain weight, plant height and/or chlorophyll content and kit used by method
CN117737282A (en) Peach early-flowering phenotype molecular marker and application thereof
CN116103434A (en) KASP mark and application thereof in green-keeping and colder identification of canopy in later wheat grouting stage
CN116287417A (en) SNP (Single nucleotide polymorphism) marker related to drought resistance of sesame and application thereof
Sathapondecha et al. Development of Gene-Based InDel Markers on Putative Drought Stress-Responsive Genes and Genetic Diversity of Durian (Durio zibethinus)
CN116656852A (en) CAPS (CAPS tag) for detecting Abi (Abi) of tobacco cis-abietyl gene and application thereof
CN115992287A (en) Molecular marker of gene SbPH11 related to sorghum plant height and application thereof
CN112322617A (en) KASP molecular marker capable of identifying waxy property of barley grains and application thereof
CN117757973A (en) Molecular marker related to drought resistance of tomatoes and application thereof
CN116083633A (en) SNP (Single nucleotide polymorphism) remarkably associated with corn plant height under different moisture conditions and application thereof
CN116426673A (en) Rice salt tolerance related molecular marker and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant