CN116536412A

CN116536412A - Biomarker PGLYRP2 and application of kit thereof

Info

Publication number: CN116536412A
Application number: CN202310356517.3A
Authority: CN
Inventors: 李慧
Original assignee: Affiliated Hospital of Shandong University of Traditional Chinese Medicine
Current assignee: Affiliated Hospital of Shandong University of Traditional Chinese Medicine
Priority date: 2023-04-06
Filing date: 2023-04-06
Publication date: 2023-08-04

Abstract

The invention relates to the technical field of biomedicine, in particular to a biomarker PGLYRP2 and application of a kit thereof in diagnosing systemic lupus erythematosus activity. The invention provides a biomarker PGLYRP2 for diagnosing systemic lupus erythematosus activity, which is initiated and easy to clinically operate, and a kit thereof, wherein the biomarker can sensitively and specifically diagnose systemic lupus erythematosus disease activity and lipid metabolism abnormality; the invention firstly makes the variable site into the kit and discovers that the variable site is efficiently expressed in the systemic lupus erythematosus patient, so the kit can be used for evaluating the disease activity of the systemic lupus erythematosus disease.

Description

Biomarker PGLYRP2 and application of kit thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to application of a biomarker PGLYRP2 in preparing a product for diagnosing systemic lupus erythematosus or evaluating disease activity.

Background

Systemic lupus erythematosus (systemic lupus erythematosus, SLE) is a chronic autoimmune disease with multiple organ involvement, affecting multiple end organs including kidneys, brain, heart, etc., well developed in women of childbearing age. Among them, kidney involvement is a major cause of the incidence and mortality of systemic lupus erythematosus, affecting about 60% of patients, one of the major causes affecting the prognosis of systemic lupus erythematosus. In addition to conventional evaluation indicators of systemic lupus disease activity, such as anti-double stranded DNA, complement C3, C4, etc., and conventional kidney injury markers such as creatinine (SCr), urea nitrogen (BUN), and proteinuria, etc., there is still a need for more biomarkers that are sensitive to systemic lupus disease activity and that can predict more organ tissue damage or poor prognosis.

The research finds that systemic lupus erythematosus disease activity is related to cardiac metabolism risk, and autoantibodies and immune complexes can influence lipoprotein metabolism by damaging vascular endothelial cells, so that the endothelial damage and atherosclerosis protection mechanism are unbalanced, atherosclerosis is finally caused, and the incidence rate of atherosclerosis, myocardial infarction, heart failure and the like of systemic lupus erythematosus patients is increased by 2 times compared with healthy people. Dyslipidemia plays a key role in atherosclerosis in patients with systemic lupus erythematosus, but the exact mechanism is not yet clear. So far, little research has been progressed on systemic lupus erythematosus disease activity and dyslipidemia.

Peptidoglycan recognition protein 2 (Peptidoglycan recognition protein, pglyrp2), an innate immune pattern recognition receptor, is specifically expressed in liver tissue and is involved in regulating inflammation. PGLYRP2 can isolate cross-linked bacterial Peptidoglycans (PGNs) and digest them into fragments by hydrolyzing the amide bond between N-acetylcarbamic acid and L-alanine. Few studies have been conducted on PGLYRP2 and autoimmune diseases, and there have been studies showing that PGLYRP2 is necessary as an induction cytokine, chemokine, and some of its receptors in arthritis induction models; it has also been reported that anti-PGLYRP 2 may be a novel marker for rheumatoid arthritis; PGLYRP2 is a protein associated with Reverse Cholesterol Transport (RCT) and dyslipidemia, PGLYRP2 is important in maintaining innate immunity and chronic inflammation, and high levels of PGLYRP2 induce long-term inflammation, promote the formation of atherosclerotic lesions, and can lead to RCT damage and chronic inflammation, leading to atherosclerosis and myocardial infarction. PGLYRP2 has also been reported to be involved in immune responses, infectious diseases, inflammatory responses, and brain diseases in the tumor microenvironment. Up to now, no studies have described the expression of PGLYRP2 in systemic lupus erythematosus and its disease-related relationship. Thus, the present study was directed to detecting serum PGLYRP2 levels in systemic lupus erythematosus cases and to discussing their association with disease activity, organ involvement.

In recent years, the pathogenesis of systemic lupus erythematosus is continuously studied, but no biological marker capable of simultaneously and specifically evaluating the activity degree of systemic lupus erythematosus diseases, organ tissue involvement and dyslipidemia is widely accepted and accepted. Finding a biomarker that can effectively predict early kidney involvement in the early stages of systemic lupus erythematosus is very important for improving treatment and prognosis of lupus nephritis. The biological marker which is convenient for clinical operation is found by our research, is obviously related to the activity index of the systemic lupus erythematosus, can be used as one of the activity judgment indexes of the clinical diseases of the systemic lupus erythematosus, is a predictive factor for worsening the nephritis of the systemic lupus erythematosus, is related to the lipid metabolism index, and can provide predictive value for clinically and synchronously predicting the activity of the diseases of the systemic lupus erythematosus and the morbidity of diseases related to lipid metabolism abnormality.

Disclosure of Invention

The invention discovers for the first time that the serum PGLYRP2 is increased in the serum expression level of the systemic lupus erythematosus patient, is a good index of systemic disease activity of the systemic lupus erythematosus patient, can be used as a predictive factor of longitudinal deterioration of renal function and is also a risk factor of bad prognosis of lupus nephritis; and the PGLYRP2 expression level is firstly found to be related to lipid metabolism abnormality of the systemic lupus erythematosus, so that the occurrence risk of cardiovascular diseases of the systemic lupus erythematosus is predicted.

In view of this, the present invention provides the use of the biomarker PGLYRP2 in the manufacture of a product for diagnosing systemic lupus erythematosus or assessing disease activity. The invention overcomes the defects of diagnosing and evaluating the activity degree of systemic lupus erythematosus diseases in the prior art, and provides a novel biomarker for diagnosing systemic lupus erythematosus and evaluating the activity degree of the systemic lupus erythematosus diseases.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a marker for auxiliary diagnosis of systemic lupus erythematosus, which more accurately measures the systemic lupus erythematosus, and performs diagnosis and evaluation of the activity of the formed systemic lupus erythematosus.

A gene expression profile detection kit for detecting systemic lupus erythematosus, the kit comprising a substance that detects specific binding of PGLYRP2 protein or a protein fragment thereof; and/or a substance that specifically binds to the PGLYRP2 gene or a gene fragment thereof.

The substance specifically combined with PGLYRP2 gene or its gene fragment includes one or several of primer pair, probe, antisense oligonucleotide and aptamer.

The primer pair comprises: primer pairs for amplifying the PGLYRP2 gene were as follows:

the detection sites of the PGLYRP2 gene are rs34440547, rs892145, rs74688727 and rs3813135, and the upstream and downstream primers of the above sites are as follows:

the amplification primers are used for the gene expression level of PGLYRP 2.

SNP locus related to detection of systemic lupus erythematosus, the SNP locus is located in PGLYRP2 gene coding region, is 3407 th site of the whole gene sequence, and the base is A/G; the PGLYRP2 gene coding region is 7216 th position of the whole gene sequence, and the base is T; the coding region of PGLYRP2 gene is 7692 th site of the whole gene sequence, and the base is T; the PGLYRP2 gene coding region is 7889 th site of the whole gene sequence, and the base is one or more than two of A.

A kit for detecting systemic lupus erythematosus, comprising the following reagents:

(1) Reagent 1: reagents for the first long fragment PCR amplification;

(2) Reagent 2: a second high-content PCR amplification reagent;

(3) Primer and probe: the reagent for PCR amplification comprises the primer group and a DNA probe;

(4) Internal standard substance: housekeeping gene primer pairs.

The nucleotide sequence of the DNA probe is as follows:

nucleotide sequence

Probe 1CGCCTTATCTGGGCCGCCCGAAGCTGCTGCAGCTGCCGCTGGG

Probe 2CGCCTTATCCGGGCCGCCCGAAGCTGCTGCAGCTGCCGCTGGG

Probe 3TTAACCAAGGCCTTCCTCAATGGCGCCCTGGATGG

Probe 4TGGTACTGGCACCTGATGGCTCGACCGTGGCTGTGGA

Probe 5AAAGTGCCAGCTGCCAAGACCAGACACACAGCTTCT

The two ends of the DNA probe are respectively marked with a fluorescent group and a quenching group, wherein the fluorescent group is FAM, and the quenching group is Eclipse.

A method of using a kit for detecting systemic lupus erythematosus, the method of detecting the kit comprising the steps of:

1) Nucleic acid extraction: extracting DNA of a sample to be detected;

preparing a reaction system: preparing a 15 mu L quantitative PCR reaction system comprising template DNA, dNTP mixture, DNA polymerase, primer, probe, 10 XPCR Buffer and water;

2) First PCR reaction: comprises pre-denaturation at 96 ℃ for 5 minutes; denaturation at 95℃for 15 seconds, annealing at 59℃for 90 seconds, 30-38 cycles;

3) Second PCR reaction: comprises pre-denaturation at 96 ℃ for 5 minutes; denaturation at 95℃for 15 seconds, annealing at 59℃for 90 seconds, 30-38 cycles;

4) And (3) result detection: and adding a DNA probe for real-time fluorescent signal interpretation and drawing a standard curve.

In particular embodiments provided herein, methods for detecting the presence or absence, or the amount of expression, of the PGLYRP2 gene include, but are not limited to: one or more of PCR-based detection methods, southern hybridization, northern hybridization, dot hybridization, fluorescent in situ hybridization, DNA microarrays, and high throughput sequencing platforms.

In particular embodiments provided herein, PCR-based detection methods include, but are not limited to, reverse transcription PCR, real-time quantitative PCR.

In embodiments provided herein, the test sample of the product comprises one or more of serum, skin, joint, serosa, placenta, skeletal muscle, kidney, aortic endothelial cells, or liver.

In embodiments provided herein, kits include, but are not limited to, qPCR kits, immunoblot detection kits, immunochromatographic detection kits, flow cytometry analysis kits, immunohistochemical detection kits, ELISA kits, and electrochemiluminescence detection kits.

In an embodiment provided by the invention, the method for diagnosing or assisting in diagnosing the systemic lupus erythematosus comprises the following steps: if the level of PGLYRP2 in the sample is 5299.94 + -570.87 pg/ml, then high activity of systemic lupus erythematosus is diagnosed.

In embodiments provided herein, the evaluation or co-evaluation of systemic lupus erythematosus disease activity: the SLE is the patient with stable period, and the level of PGLYRP2 in the tested sample is 4468.99 + -457.02 pg/ml; systemic lupus erythematosus is active LN, and serum PGLYRP2 levels are 5152.93 + -446.13 pg/ml.

In one embodiment of the invention, the serum PGLYRP2 expression level of the systemic lupus erythematosus hyperlipoidemia metabolic seed sample is correlated with C3, C4 and renal function parameters eGFR, igA, 24 hours urine protein in diagnosis or auxiliary diagnosis of systemic lupus erythematosus.

In one embodiment of the invention, the serum PGLYRP2 level in the systemic lupus erythematosus activity correlates with the lipid metabolism index HDL-c, apo-A1, apo B/A1 ratio.

In the examples provided herein, the primary test samples are serum and morning urine.

In another aspect, the invention provides a method of screening a candidate drug for preventing and/or treating systemic lupus erythematosus, comprising the steps of:

(1) Contacting a test substance with a system comprising or expressing a PGLYRP2 protein;

(2) Detecting the expression level of PGLYRP2 protein in said system;

(3) Detecting HDL-c, apo-A1 and Apo-B/A1 ratio;

(4) Substances which can reduce the expression level of PGLYRP2 protein are selected as candidate medicines for preventing and/or treating systemic lupus erythematosus.

Compared with the prior art, the invention has the following beneficial effects:

the biomarker PGLYRP2 for diagnosing the activity of the systemic lupus erythematosus, which is initiated and easy to clinically operate, can sensitively and specifically diagnose the activity of the systemic lupus erythematosus, has higher specificity and sensitivity, and is proved by experiments that the coincidence rate of the biomarker PGLYRP2 is more than 85 percent.

The invention discovers for the first time that PGLYRP2 is more expressed in patients with high disease activity and patients with neuropsychiatric lupus, so the biomarker can also be used for evaluating the disease activity; the invention discovers for the first time that the expression of the plasma PGLYRP2 in patients with the systemic lupus erythematosus is increased, and can be used as a predictive factor for the worsening of the systemic lupus erythematosus nephritis; the invention discovers that the plasma PGLYRP2 is obviously and inversely correlated with lipid metabolism indexes HDL-c and Apo-A1 and with Apo-B/A1 ratio for the first time, which shows that the PGLYRP2 can be used for predicting cardiovascular disease risk and disease severity of systemic lupus erythematosus;

the invention also provides a kit for diagnosing and detecting the disease activity of the systemic lupus erythematosus, which comprises the following components: real-time fluorescent quantitative PCR amplification reagent premix, primer pair of PGLYRP2 gene, primer pair of housekeeping gene GAPDH, and specific primer sequences are provided. The accuracy of the kit is further verified through serum detection of 45 qualified systemic lupus erythematosus patients and 15 healthy volunteers, and the compliance rate of the kit is found to be more than 90% through sensitivity and specificity experiments.

The invention also finds that PGLYRP2 can be used for screening candidate medicines for preventing and/or treating systemic lupus erythematosus, thereby further developing effective therapeutic medicines for the diseases.

Drawings

FIG. 1 shows the serum PGLYRP2 levels in healthy volunteers, patients with stable systemic lupus erythematosus, active LN patients, and NP-systemic lupus erythematosus. The results in FIG. 1 show that serum PGLYRP2 levels were significantly elevated in the stationary phase of systemic lupus erythematosus (4468.99.+ -. 457.02 pg/mL), LN active phase (5152.93.+ -. 446.13 pg/mL) and NP-systemic lupus erythematosus patients (5141.52.+ -. 579.61 pg/mL) compared to healthy volunteers (3938.56.+ -. 576.07 pg/mL). Active LN patients had higher serum PGLYRP2 levels than those of stationary phase systemic lupus erythematosus, but there was no significant difference (P > 0.05) between active LN patients and NP-systemic lupus erythematosus patients.

FIG. 2 relative expression of PGLYRP2 in serum in healthy volunteers, patients with stable systemic lupus erythematosus and active LN patients. The results showed that the serum PGLYRP2 expression levels were higher in active LN or NP-systemic lupus erythematosus patients than in healthy volunteers (P < 0.01).

FIG. 3 ROC curves of PGLYRP2 in serum for patients with systemic lupus erythematosus active and those with stationary phase. The diagnostic potential of PGLYRP2 in systemic lupus erythematosus was tested by plotting ROC curves, as shown in fig. 3, auc=0.841, which indicates good prediction accuracy, demonstrating sensitivity and specificity of PGLYRP2 in distinguishing active and stationary phase systemic lupus erythematosus patients.

FIG. 4 serum PGLYRP2 content in healthy volunteers, low-activity LN patients (0-9), medium-activity LN patients (10-14), and high-activity LN patients (. Gtoreq.15). High active group serum PGLYRP2 (5299.94 + -570.87 pg/mL) was significantly higher than low active group (4610.64 + -533.59 pg/mL) (P < 0.01). The moderate active set (4970.85.+ -. 402.61 pg/mL) was compared to the high active set (5299.94.+ -. 570.87 pg/mL) with no significant difference (P > 0.05). But all systemic lupus erythematosus patients had higher levels of PGLYRP2 in serum than healthy volunteers.

FIG. 5 correlation curves of serum PGLYRP2 and systemic lupus erythematosus disease activity. There is a positive correlation between serum PGLYRP2 content and systemic lupus erythematosus DAI in patients with systemic lupus erythematosus, and the patient's disease activity increases with increasing serum PGLYRP2 content (r=0.5783, p <0.01, n=45)

FIG. 6 ROC curve of PGLYRP2 kit for detecting systemic lupus erythematosus patient

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

Specific embodiments of the present invention have been described in detail so that those skilled in the art will readily understand. Various modifications or substitutions of details may be made in accordance with all that has been disclosed, and such modifications and alterations are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Example 1: primer design and construction

According to the method, PGLYRP2 gene is selected from GenBank, the positive rate accuracy is up to more than 95% by using the gene kit of the invention, and Primer Premier 5.0 on-line Primer design software is utilized to design a Primer and probe composition, wherein the Primer is synthesized by Shanghai certain biotechnology company, and the specific sequence condition of the Primer is shown in the following table 1.

Table 14 primers for site selection

In order to further optimize the detection procedure, a DNA probe design is carried out on the conserved sequence of each gene, the two ends of the DNA probe are respectively marked with a fluorescent group and a quenching group, the fluorescent group is FAM, and the quenching group is Eclipse. The synthesis of the probes was performed by Shanghai, inc., and the specific sequence is shown in Table 2 below.

TABLE 2 sequences and nucleotides of probes

	Nucleotide sequence
		Probe 1	CGCCTTATCTGGGCCGCCCGAAGCTGCTGCAGCTGCCGCTGGG
Probe 2	CGCCTTATCCGGGCCGCCCGAAGCTGCTGCAGCTGCCGCTGGG
		Probe 3	TTAACCAAGGCCTTCCTCAATGGCGCCCTGGATGG
Probe 4	TGGTACTGGCACCTGATGGCTCGACCGTGGCTGTGGA
		Probe 5	AAAGTGCCAGCTGCCAAGACCAGACACACAGCTTCT

Example 2 Gene extraction from systemic lupus erythematosus cells

And (3) extracting DNA of the systemic lupus erythematosus cells by using a nucleic acid extraction kit and a nucleic acid extraction instrument, crushing and cracking the systemic lupus erythematosus cells by using a cracking solution containing guanidine isothiocyanate, washing twice by using a Wash Buffer A and a Buffer B, removing proteins and other impurities, finally separating the proteins from the nucleic acid, collecting the liquid, dissolving in a TE Buffer solution, and obtaining 50 mu L of extract containing the systemic lupus erythematosus cell DNA as a sample to be detected, wherein the final elution volume is 50 mu L.

Example 3 Gene amplification and detection of systemic lupus erythematosus cells

First PCR amplification reaction: the interference of other DNA exists in the extraction process of the systemic lupus erythematosus cell gene, the labeled DNA after the extraction in the example 2 is used as a template, the nested PCR method is adopted for amplification, and a reaction system (15 μl): 1.5. Mu.l 10 XTaq Buffer (Mg2+Plus), 1. Mu.l 2mM dNTP, 0.2. Mu.l 10mM primer, 1. Mu.l template DNA (50 ng), 0.5UTaq, make up 15. Mu.l with ddH 2O.

Purifying the first PCR product: according to the DNA content of each sample, diluting to 30-50 ng/. Mu.l with 1 xTE, and storing at-20 ℃ for standby.

Second PCR amplification reaction: and (3) taking 1 mu L of diluted extract for PCR amplification experiments, and respectively screening 8 pairs of primers for 2 times, wherein the PCR reaction system is 20ul. Reaction system (15 μl): 1.5. Mu.l 10 XTaq Buffer (Mg2+Plus), 1. Mu.l 2mM dNTP, 0.2. Mu.l 10mM primer, 1. Mu.l template DNA (50 ng), 0.5UTaq, 15. Mu.l with ddH2O, DNA probe primer (1.5 ng/ml). The sequence result of the first amplification is used as a DNA template of the second amplification result, and finally, the further amplification of the SNPs loci is carried out, so that the specific reaction system and primers are shown in the following table 3:

TABLE 3 reaction systems and primers

The control process of the first PCR amplification reaction PCR reaction is as follows:

TABLE 4 PCR primers for each Gene and PCR Process

Second PCR amplification

TABLE 4 PCR primers for each Gene and PCR Process

TABLE 5 primers for the 2 nd PCR reaction

TABLE 6 reaction systems and primers

And (3) result detection: and carrying out real-time fluorescent signal interpretation and drawing a standard curve.

Example 4: second anneal extension temperature optimization

The second PCR amplification reaction, because of the presence of DNA probes, cannot be based on the design software, and from the standpoint of annealing temperature design and base sequencing, 5 sets of reaction procedures were designed:

reaction procedure 1: the first step: pre-denaturation at 95 ℃ for 5 min; and a second step of: denaturation at 95 ℃ for 15 seconds, annealing at 59 ℃ for 90 seconds, and fluorescence collection after extension; the second step was repeated for 38 cycles.

Reaction procedure 2: the first step: pre-denaturation at 95 ℃ for 5 min; and a second step of: denaturation at 95 ℃ for 15 seconds, annealing at 55 ℃ for 90 seconds, and fluorescence collection after extension; the second step was repeated for 38 cycles.

Reaction procedure 3: the first step: pre-denaturation at 95 ℃ for 5 min; and a second step of: denaturation at 95 ℃ for 15 seconds, annealing at 56 ℃ for 90 seconds, and fluorescence collection after extension; the second step was repeated for 38 cycles.

Reaction procedure 4: the first step: pre-denaturation at 95 ℃ for 5 min; and a second step of: denaturation at 95 ℃ for 15 seconds, annealing at 57 ℃ for 90 seconds, and fluorescence collection after extension; the second step was repeated for 38 cycles.

Reaction procedure 5: the first step: pre-denaturation at 95 ℃ for 5 min; and a second step of: denaturation at 95 ℃ for 15 seconds, annealing at 58 ℃ for 90 seconds, and fluorescence collection after extension; the second step was repeated for 38 cycles.

TABLE 7 annealing extension temperature optimization comparative test

	Reaction procedure 1	Reaction procedure 2	Reaction procedure 3	Reaction procedure 4	Reaction procedure 5
						rs34440547	N/A	--	--	N/A	N/A
rs892145	N/A	N/A	N/A	N/A	N/A
						rs74688727	N/A	N/A	N/A	N/A	--
rs3813135	N/A	--	N/A	--	N/A

The difference between the above 5 sets of reaction procedures is that the annealing extension temperatures are different, the amplification results are shown in the table, N/A

The result of detection is negative, the value of Ct value of detection indicates amplification, the result of detection is positive (21.5 and 35.2 in sequence in reaction procedure 2, 30.5 in sequence in reaction procedure 3, 24.7 in reaction procedure 4, and 23.1 in reaction procedure 5). From the amplification results, it can be seen that: at an annealing temperature of 59 ℃,4 sets of primers have the best specificity, no false positive amplification result appears, and at an annealing temperature of 56-58 ℃,3 sets of primers have individual non-specificity significance, namely the false positive detection result appears.

Example 5: gene purification and detection of systemic lupus erythematosus

After completion of the amplification, 5. Mu.l of each sample was taken and tested on a 1% DNA gel for positive individuals. As a result, the fragment length was rs34440547, 105bp, rs892145, 135bp, rs74688727, 114bp and rs 383335, 109bp. It can be seen that the target fragment is clearly seen through 2 times of PCR amplification, which proves that the PCR has good effect, and other conditions of the invention meet the detection requirement.

Example 6: kit for detecting activity of systemic lupus erythematosus

Including the SLE cell extraction set, primers for 6 genes, DNA probes, housekeeping gene GAPDH (primer pair 5'-TCAGTGGTGGACCTGACCTG-3' and 5'-TGCTGTAGCCAAATTCGTTG-3').

Example 7: study data and specimens

45 eligible systemic lupus erythematosus patients (15 stable systemic lupus erythematosus patients, 15 active LN patients, 15 active NP-systemic lupus erythematosus patients, and 15 healthy volunteers) were recruited in me hospital from 1 in 2019, 1 to 11 in 2020, 39 women (86.6%), 6 men (13.4%), and the average age was 36.53+ -13.54 years.

Classification criteria:

systematic lupus erythematosus is diagnosed and classified according to the systematic lupus erythematosus classification standard revised by the american college of rheumatology in 1982, and selected systemic lupus erythematosus patients are classified into a low disease active group (systemic lupus erythematosus dai+.9, n=19), a moderate disease active group (10 < systemic lupus erythematosus DAI <14, n=12), and a high disease active group (systemic lupus erythematosus dai+.15, n=14).

Method for detecting PGLYRP2 in serum:

(1) morning quiet blood was collected after 8 hours of fasting in 45 patients with systemic lupus erythematosus and 15 volunteers.

(2) Blood collected from each participant was centrifuged at 1000 XG for 10 minutes, sub-packaged and stored at-80 ℃.

(3) Samples were taken and thawed at room temperature, serum samples were diluted 1:10, taking care that each sample was cycled and thawed only once to prevent protein degradation.

(4) The serum levels of PGLYRP2 were detected using a PGLYRP2 ELISA kit.

(5) The optical density at 450nm was measured with a microplate reader and two measurements were made for each sample. The expression level of the serum PGLYRP2 is PG/ml.

Detection results and analysis

Serum PGLYRP2 levels in healthy volunteers, patients with stable disease, active LN patients, and NP-systemic lupus erythematosus; relative expression of PGLYRP2 in serum in healthy volunteers, patients with stable systemic lupus erythematosus and patients with active LN; PGLYRP2 in serum can distinguish ROC curves of patients with systemic lupus erythematosus active phase and patients with stationary phase; serum PGLYRP2 levels in healthy volunteers, low activity LN patients, medium activity LN patients, and high activity LN patients; correlation curve of serum PGLYRP2 with systemic lupus erythematosus disease activity.

The high active group serum PGLYRP2 (5299.94 + -570.87 pg/mL) was found to be significantly higher than the low active group (4610.64 + -533.59 pg/mL) (P < 0.01). The moderate active set (4970.85.+ -. 402.61 pg/mL) was compared to the high active set (5299.94.+ -. 570.87 pg/mL) with no significant difference (P > 0.05). But all systemic lupus erythematosus patients had higher levels of PGLYRP2 in serum than healthy volunteers.

Example 8: PGLYRP2 kit for detecting compliance rate of systemic lupus erythematosus activity

In order to further verify the accuracy of the kit of the present invention, the 36 genes were classified and combined, specifically, the combination as shown in table 7, and the theory of the combination was to reduce the cost as much as possible and improve the experimental efficiency.

The kit was selected from the kit in example 6 and operated as follows:

Second PCR amplification reaction: and (3) taking 1 mu L of diluted extract for PCR amplification experiments, and respectively screening 6 pairs of primers for 2 times, wherein the PCR reaction system is 20ul. Reaction system (15 μl): 1.5. Mu.l 10 XTaq Buffer (Mg2+Plus), 1. Mu.l 2mM dNTP, 0.2. Mu.l 10mM primer, 1. Mu.l template DNA (50 ng), 0.5UTaq, 15. Mu.l with ddH2O, DNA probe primer (1.5 ng/ml). The sequence result of the first amplification is used as a DNA template of the second amplification result, and finally the sequence result is further amplified and displayed through the screened SNPs loci.

It is known from the prior art that the detection of combination 3 should be most efficient as seen from the combination, but the primer and other reagents used in combination 3 are more and time-consuming and costly. The specific detection results are shown in tables 8 and 9.

Combination mode

TABLE 8 Probe Assembly System

Combination mode	Site(s)
		①	Probe 1+Probe 3
②	Probe 1+Probe 3+Probe 4
		③	Probe1+probe3+probe4+probe5
④	Probe1+probe2+probe3+probe4+probe5

Table 93 results of Gene detection from different combinations

Combination mode	Positive number	True positive number	False positive number	Number of false negatives	Positive rate (%)
						①	31	14	17	31	68.9
②	30	22	8	12	66.7
						③	37	33	4	7	82.2
④	43	42	1	2	95.6

As can be seen from Table 8, the detection results of the combination (4) are more reliable, the accuracy is more than 95%, and nearly half of the detection results of the combinations (1) - (3) are not detected. Therefore, the detection method using the combination of (1) to (3) is not suggested.

Example 9: detection of different degrees of activity of systemic lupus erythematosus by using PGLYRP2 kit

The kit comprises: the PGLYRP2 kit used the probe in the combination of (4) in example 8.

To evaluate the test effect of the PGLYRP2 kit, 45 patients with systemic lupus erythematosus and 15 healthy volunteers of example 7 were tested. The diagnosis results were classified into 4 grades of healthy volunteers, low-activity LN patients, medium-activity LN patients and high-activity LN patients, and the results are shown in Table 10 as indicated by 1 to 4, respectively.

TABLE 10 test scoring results for PGLYRP2 kit

The specific detection result is shown in fig. 6, and the detection result shows that: the area under the ROC curve of the kit is 0.936, and compared with 0.5, the detection capability of the kit is better, wherein the detection capability is obviously poor (P < 0.001).

Claims

1. A gene expression profile detection kit for detecting the activity of systemic lupus erythematosus, which is characterized in that the kit contains a substance for detecting the specific binding of PGLYRP2 protein or protein fragments thereof; and/or a substance that specifically binds to the PGLYRP2 gene or a gene fragment thereof.

2. The kit for detecting gene expression profile according to claim 1, wherein the substance specifically binding to PGLYRP2 gene or gene fragment thereof comprises one or more of primer pair, probe, antisense oligonucleotide, and aptamer.

3. The gene expression profiling kit of claim 2, wherein the primer pair comprises: primer pairs for amplifying the PGLYRP2 gene were as follows:

4. the gene expression profile test kit of claim 2, wherein the single nucleotide polymorphism sites of the PGLYRP2 gene are rs34440547, rs892145, rs74688727, rs3813135.

5. The gene expression profile detection kit of claim 4, wherein the upstream and downstream primers of rs34440547, rs892145, rs74688727, rs3813135 are as follows:

6. the kit for detecting gene expression profile according to claim 1, wherein the amplification primer is used for the expression level of PGLYRP2 gene.

7. The SNP locus related to the activity of detecting the systemic lupus erythematosus is characterized in that the SNP locus is positioned in a PGLYRP2 gene coding region and is 3407 th site of the whole sequence, and the base is A or G; the PGLYRP2 gene coding region is 7216 th position of the whole sequence, and the base is T; the coding region of PGLYRP2 gene is 7692 th position of the whole sequence, and the base is T; the PGLYRP2 gene coding region is 7889 th site of the whole sequence, and the base is one or more than two of A.

8. A kit for detecting systemic lupus erythematosus activity comprising the following reagents:

(1) Reagent 1: reagents for the first long fragment PCR amplification;

(2) Reagent 2: a second high-content PCR amplification reagent;

(3) Primer and probe: the reagent for PCR amplification comprises the primer set according to any one of claims 1 to 2 and a DNA probe.

9. The kit of claim 8, wherein the DNA probe has the nucleotide sequence as follows:

probe 1CGCCTTATCTGGGCCGCCCGAAGCTGCTGCAGCTGCCGCTGGG

Probe 2CGCCTTATCCGGGCCGCCCGAAGCTGCTGCAGCTGCCGCTGGG

Probe 3TTAACCAAGGCCTTCCTCAATGGCGCCCTGGATGG

Probe 4TGGTACTGGCACCTGATGGCTCGACCGTGGCTGTGGA

Probe 5AAAGTGCCAGCTGCCAAGACCAGACACACAGCTTCT

The two ends of the DNA probe are respectively marked with a fluorescent group and a quenching group, the fluorescent group is FAM, and the quenching group is Eclipse.

10. The kit according to claim 9, wherein the method of detection of the kit comprises the steps of:

1) Nucleic acid extraction: extracting DNA of a sample to be detected;