CN116529363A

CN116529363A - RNA-guided clearance of herpes simplex virus type I and other related human herpesviruses

Info

Publication number: CN116529363A
Application number: CN202080107693.8A
Authority: CN
Inventors: K·哈利利
Original assignee: Temple University of Commonwealth System of Higher Education
Current assignee: Temple University of Commonwealth System of Higher Education
Priority date: 2020-10-02
Filing date: 2020-11-11
Publication date: 2023-08-01

Abstract

The present disclosure relates to compositions and methods for inhibiting herpes virus infection. The present disclosure relates generally to compositions and methods for treating or eradicating herpes virus infections. The present disclosure relates in particular to targeting herpes virus genes by gene editing complexes.

Description

RNA-guided clearance of herpes simplex virus type I and other related human herpesviruses

RELATED APPLICATIONS

The present application claims the benefit of U.S. provisional application No. 63/086,648, filed on day 2 of 10 in 2020, and U.S. provisional application No. 63/109,511, filed on day 4 of 11 in 2020, each of which is incorporated herein by reference.

Technical Field

The present disclosure relates generally to compositions and methods for treating or eradicating herpes simplex virus infection. The present disclosure relates particularly to targeting herpes simplex virus genes by gene editing complexes.

Background

Drug treatment with nucleoside analogs is the primary therapy for HSV1 primary infection and viral reactivation events. While these agents may be effective in limiting the spread of HSV1 infection to other cell-induced lesions, they are ineffective in the establishment of potential HSV1 reactivation or future HSV1 reactivation events. In view of the limitations of current therapies, there is a need in the art for compositions and methods for the treatment and prevention of lytic and potential HSV1 infections.

Disclosure of Invention

In one aspect, the present disclosure provides a composition for treating or preventing a herpes virus infection. The composition comprises a) a CRISPR-associated (Cas) peptide or an isolated nucleic acid encoding a Cas peptide; and b) an isolated guide nucleic acid or an isolated nucleic acid encoding a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence that is substantially complementary to a target sequence in the herpesvirus genome.

In certain embodiments, the pharmaceutical composition comprises a) a CRISPR-associated (Cas) peptide or an isolated nucleic acid encoding a Cas peptide; and b) an isolated guide nucleic acid or an isolated nucleic acid encoding a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence that is substantially complementary to a target sequence in the herpesvirus genome.

In certain embodiments, the composition comprises an expression vector encoding a CRISPR-associated (Cas) peptide and a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence that is substantially complementary to a target sequence in a herpesvirus genome. In some embodiments, the present disclosure provides a host cell comprising an expression vector.

In certain embodiments, a method of treating or preventing a herpes virus infection or a herpes virus-related disorder in a subject, comprising contacting the subject with a therapeutically effective amount of a composition comprising a) a CRISPR-associated (Cas) peptide or an isolated nucleic acid encoding a Cas peptide; and b) an isolated guide nucleic acid or an isolated nucleic acid encoding a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence that is substantially complementary to a target sequence in the herpesvirus genome.

In certain embodiments, the composition comprises a plurality of isolated guide nucleic acids, wherein each guide nucleic acid comprises a nucleotide sequence that is substantially complementary to a different target sequence in the herpesvirus genome. In certain embodiments, the composition comprises one or more isolated nucleic acids, wherein the one or more isolated nucleic acids encode a plurality of guide nucleic acids, wherein each guide nucleic acid comprises a nucleotide sequence that is substantially complementary to a different target sequence in the herpesvirus genome.

In certain embodiments, the Cas peptide is Cas9 or a variant thereof. In certain embodiments, the Cas9 variant comprises one or more point mutations relative to wild-type streptococcus pyogenes (Streptococcus pyogenes) Cas9 (spCas 9) selected from the group consisting of R780A, K810A, K848A, K855A, H982A, K1003A, R1060A, D1135E, N497A, R661A, Q695A, Q926A, L169A, Y450A, M495A, M694A and M698A. In some embodiments, the Cas peptide is Cpfl or a variant thereof.

In some embodiments, the isolated nucleic acid encoding the Cas peptide is optimized for expression in a human cell.

In some embodiments, the target sequence comprises a sequence of the ICP0 domain of the herpesvirus genome. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises crRNA and tracrRNA.

In certain embodiments, the target sequence to which the gRNA is substantially complementary is within the UL56, ICP0, ICP4, or ICP27 gene.

In certain embodiments, the HSV target sequence is within the ICP0 gene, UL56 gene, or a combination thereof.

In certain embodiments, the gRNA comprises a nucleic acid sequence having at least about 70% (such as at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater) sequence identity to SEQ ID NOs 1 to 96, 194 to 212, and 356 to 371.

In certain embodiments, the gRNA comprises a nucleic acid sequence having SEQ ID NOs 1 to 96, 194 to 212 and 356 to 371.

In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more grnas comprising a nucleic acid sequence having SEQ ID NOs 1 to 96, 194 to 212, and 356 to 371.

In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of two or more grnas comprising nucleic acid sequences having SEQ ID NOs 1 to 96, 194 to 212, and 356 to 371.

In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of three or more grnas comprising nucleic acid sequences having SEQ ID NOs 1 to 96, 194 to 212, and 356 to 371.

In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of four or more grnas comprising nucleic acid sequences having SEQ ID NOs 1 to 96, 194 to 212, and 356 to 371.

In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of 5 or 6 or 7 or 8 or 9 or 10 or more grnas comprising nucleic acid sequences having SEQ ID NOs 1 to 96, 194 to 212 and 356 to 371.

In some embodiments, PAM sequences comprise nucleic acid sequences having at least about 70% (such as at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater) sequence identity to SEQ ID NOs 97 to 193, 213 to 231, or combinations thereof.

In certain embodiments, the PAM sequence comprises a nucleic acid sequence having SEQ ID NOS 97 to 193, 213 to 231, or combinations thereof.

In certain embodiments, the herpes virus comprises type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; EBV), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roselle virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi's sarcoma-associated herpes virus (KSHV)).

In certain embodiments, provided herein are compositions comprising: clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases or nucleic acid sequences encoding the CRISPR-associated endonucleases; a first guide nucleic acid or a nucleic acid sequence encoding the first guide nucleic acid, the first guide nucleic acid being complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; a second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. In some embodiments, the composition further comprises the fourth guide nucleic acid or a nucleic acid sequence encoding a fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome. In some embodiments, the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence. In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a Cas phi endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a staphylococcus aureus (Staphylococcus aureus) Cas9 nuclease. In some embodiments, the CRISPR-associated endonuclease is optimized for expression in a human cell. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises crRNA and tracrRNA. In some embodiments, the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID NO. 7 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID NO. 376 or a complement thereof. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the fourth target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof. In some embodiments, the herpes virus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; EBV), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roselle virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi's sarcoma-associated herpes virus (KSHV)).

In certain embodiments, disclosed herein are compositions comprising: clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases or nucleic acids encoding the CRISPR-associated endonucleases; a first guide nucleic acid or a nucleic acid sequence encoding the first guide nucleic acid, the first guide nucleic acid being complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; a second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first nucleic acid sequence, the second target nucleic acid and the third target nucleic acid sequence are different. In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a Cas phi endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a staphylococcus aureus (Staphylococcus aureus) Cas9 nuclease. In some embodiments, the CRISPR-associated endonuclease is optimized for expression in a human cell. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises crRNA and tracrRNA. In some embodiments, the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complementary sequence of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO. 2 or 7 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID NO. 376 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID NO. 377 or a complement thereof. In some embodiments, the herpes virus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; EBV), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roselle virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi's sarcoma-associated herpes virus (KSHV)).

In certain embodiments, disclosed herein is a CRISPR-Cas system comprising: clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; a first pilot nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 or 7 or the complement thereof; and a second nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 376 or 377 or the complement thereof. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 2. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 7. In some embodiments, the second nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 376. In some embodiments, the second nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 377. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 2, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 376. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 2, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 377. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 7, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 376. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 7, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 377.

In certain embodiments, disclosed herein are nucleic acids encoding a CRISPR-Cas system described herein.

In certain embodiments, disclosed herein are adeno-associated virus (AAV) vectors comprising nucleic acids encoding: clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; a first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; a second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. In some embodiments, the vector further comprises a fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome. In some embodiments, the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence. In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a Cas Φ endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a staphylococcus aureus (Staphylococcus aureus) Cas9 nuclease. In some embodiments, the CRISPR-associated endonuclease is optimized for expression in a human cell. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises crRNA and tracrRNA. In some embodiments, the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID NO. 7 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID NO. 376 or a complement thereof. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the fourth target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof. In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the promoter is a ubiquitous promoter. In some embodiments, the promoter is a tissue specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a human cytomegalovirus promoter. In some embodiments, the nucleic acid further comprises an enhancer element. In some embodiments, the enhancer element is a human cytomegalovirus enhancer element. In some embodiments, the nucleic acid further comprises a 5'itr element and a 3' itr element. In some embodiments, the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8. In some embodiments, the herpes virus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; EBV), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roselle virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi's sarcoma-associated herpes virus (KSHV)).

In certain embodiments, disclosed herein are adeno-associated virus (AAV) vectors comprising nucleic acids encoding: clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; a first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; a second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and a third nucleic acid that is complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a Cas phi endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a staphylococcus aureus (Staphylococcus aureus) Cas9 nuclease. In some embodiments, the CRISPR-associated endonuclease is optimized for expression in a human cell. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises crRNA and tracrRNA. In some embodiments, the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complementary sequence of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO. 2 or 7 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID NO. 376 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID NO. 377 or a complement thereof. In some embodiments, the herpes virus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; EBV), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roselle virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi's sarcoma-associated herpes virus (KSHV)). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the promoter is a ubiquitous promoter. In some embodiments, the promoter is a tissue specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a human cytomegalovirus promoter. In some embodiments, the nucleic acid further comprises an enhancer element. In some embodiments, the enhancer element is a human cytomegalovirus enhancer element. In some embodiments, the nucleic acid further comprises a 5'itr element and a 3' itr element. In some embodiments, the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8.

In certain embodiments, disclosed herein are methods of resecting a portion or all of a herpesvirus sequence from a cell, the method comprising providing to the cell a composition described herein, a CRISPR-Cas system described herein, or an AAV vector described herein.

In certain embodiments, disclosed herein are methods of inhibiting or reducing herpes virus replication in a cell, the method comprising providing to the cell a composition described herein, a CRISPR-Cas system described herein, or an AAV vector described herein. In some embodiments, the cell is in a subject. In some embodiments, the subject is a human.

Drawings

Figures 1A to 1B show schematic representations of a herpesvirus genome and a gene editing vector for targeting the herpesvirus genome.

FIG. 2 shows data indicating the delivery expression of the gene editing vector in cells.

FIG. 3 shows data indicating DNA excision assay in cells.

Figure 4 shows data indicating HSV replication in cells.

FIG. 5 shows data indicating the expression of gRNA in cells.

Figure 6 shows data for a herpes virus model in cells.

FIG. 7 shows data indicating DNA excision assay in cells.

Figure 8 shows data indicating reduced expression of the targeted gene in infected cells.

Detailed Description

Definition of the definition

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are described herein.

As used herein, each of the following terms has the meaning associated therewith in this section.

The word "a" is used herein to refer to one or more than one (i.e., at least one) of the grammatical object of the word. For example, "an element" means one element or more than one element.

As used herein, "about" when referring to a measurable value, such as an amount, duration, or the like, is intended to encompass variations of ±20%, ±10%, ±5%, ±1% or ±0.1% relative to the specified value, as such variations are suitable for carrying out the disclosed methods.

The term "abnormal" when used in the context of an organism, tissue, cell, or component thereof refers to those organisms, tissues, cells, or components thereof that differ from those organisms, tissues, cells, or components thereof that exhibit a "normal" (expected) corresponding characteristic in at least one observable or detectable characteristic (e.g., age, treatment, time of day count, etc.). Features that are normal or expected for one cell or tissue type may be abnormal for a different cell or tissue type.

As used herein, the terms "comprises," "comprising," or "includes" and variations thereof with respect to elements of a defined or described item, composition, apparatus, method, process, system, etc., are intended to be inclusive or open-ended, allowing additional elements to be included, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc., includes those specified elements (or equivalents thereof, as appropriate), and that other elements may be included and still fall within the scope/definition of the defined item, composition, apparatus, method, process, system, etc.

A "disease" is a state of health of an animal, wherein the animal is unable to maintain homeostasis, and wherein the animal's health continues to deteriorate if the disease is not alleviated.

In contrast, an animal's "condition" is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than the state of health in the absence of the condition. Leaving aside, the condition does not necessarily cause a further decline in the health status of the animal.

A disease or disorder is "reduced" if the severity of the symptoms of the disease or disorder, the frequency of such symptoms experienced by the patient, or both, are reduced.

"coding" refers to the inherent properties of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, as a template for other polymers and macromolecules in the synthetic biological process, which have defined nucleotide sequences (i.e., rRNA, tRNA, and mRNA) or defined amino acid sequences and biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to the gene produces the protein in a cell or other biological system. Both the coding strand (which has the same nucleotide sequence as the mRNA sequence and is typically provided in the sequence listing) and the non-coding strand (which serves as a transcription template for a gene or cDNA) can be referred to as encoding the protein or other product of the gene or cDNA.

An "effective amount" or "therapeutically effective amount" of a compound is an amount of the compound sufficient to provide a beneficial effect to the subject to whom the compound is administered. An "effective amount" of a delivery vehicle is an amount sufficient to effectively bind or deliver a compound.

An "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence covalently linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked plasmids or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides.

"homologous" refers to sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When the positions of both of the two compared sequences are occupied by the same base or amino acid monomer subunit, for example, if the position of each of the two DNA molecules is occupied by adenine, then the two molecules are homologous at that position. The percent homology between two sequences is a function of the number of matched or homologous positions shared by the two sequences divided by the number of compared positions and then X100. For example, if 6 of 10 positions in two sequences are matched or homologous, then the two sequences are 60% homologous. For example, the DNA sequences ATTGCC and TATGGC share 50% homology. Typically, the comparison is made when the two sequences are aligned to give maximum homology.

"isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide, partially or completely separated from coexisting materials in its natural state, is "isolated. The isolated nucleic acid or protein may be present in a substantially pure form, or may be present in a non-native environment such as a host cell.

In the context of the present disclosure, the following abbreviations for common nucleobases are used. "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

Unless otherwise specified, "nucleotide sequences encoding amino acid sequences" include all nucleic acid sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA may also include introns to the extent that the nucleotide sequence encoding the protein may contain one or more introns in some versions.

The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal or cell thereof that is in compliance with the methods described herein, whether in vitro or in situ. In certain non-limiting embodiments, the patient, subject, or individual is a human.

"parenteral" administration of a composition includes, for example, subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques.

As used herein, the term "polynucleotide" is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, as used herein, nucleic acids and polynucleotides are interchangeable. Those skilled in the art have the following general knowledge: a nucleic acid is a polynucleotide that can be hydrolyzed to a monomer "nucleotide". Monomeric nucleotides can be hydrolyzed to nucleosides. As used herein, polynucleotides include, but are not limited to, nucleic acid sequences obtained by any means available in the art, including, but not limited to, recombinant means, i.e., using conventional cloning techniques and PCR ^TM And nucleic acid sequence clones obtained from recombinant libraries or cell genomes, as well as nucleic acid sequences obtained by synthetic means.

The term "pharmaceutically acceptable" (or "pharmacologically acceptable") refers to a molecular entity or composition that, if applicable, does not produce a negative, allergic, or other untoward reaction upon administration to a freeze-thaw or human. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gelling agents, surfactants and the like, which can serve as a medium for pharmaceutically acceptable substances.

As used herein, the terms "peptide," "polypeptide" and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. The protein or peptide must contain at least two amino acids and there is no limit to the maximum number of amino acids that can constitute the protein or peptide sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains (e.g., which are also commonly referred to in the art as peptides, oligopeptides, and oligonucleotides) and longer chains (which are commonly referred to in the art as proteins), of which there are multiple types. For example, "polypeptide" includes biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, homologs, fusion proteins, and the like. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

As used herein, the term "promoter" is defined as a DNA sequence that is recognized by or introduced into a synthetic mechanism of a cell, which is required to initiate specific transcription of a polynucleotide sequence.

As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence required for expression of a gene product operably linked to the promoter/regulatory sequence. In some cases, the sequence may be a core promoter sequence, while in other cases, the sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. For example, the promoter/regulatory sequence may be one that expresses the gene product in a tissue specific manner.

A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specific for a gene product, results in the production of the gene product in a cell under most or all physiological conditions of the cell.

An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specific for a gene product, causes the gene product to be produced in a cell substantially only when an inducer corresponding to the promoter is present in the cell.

As used in the specification and the appended claims, the term "or" is generally employed in its sense including "and/or" unless the content clearly dictates otherwise.

A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specific for a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

A "therapeutic" treatment is a treatment administered to a subject exhibiting signs and pathology for the purpose of reducing or eliminating those signs.

As used herein, "treating a disease or disorder" means reducing the frequency of symptoms of the disease or disorder experienced by a patient. Diseases and conditions are used interchangeably herein.

As used herein, the phrase "therapeutically effective amount" refers to an amount sufficient or effective to prevent or treat a disease or disorder (delay or prevent the onset of a disease or disorder, prevent the progression of a disease or disorder, inhibit, reduce or reverse a disease or disorder), including alleviating the symptoms of such a disease.

As used herein, the term "treating" a disease means reducing the frequency or severity of at least one sign or symptom of the disease or disorder experienced by a subject.

As used herein, a "variant" is a nucleic acid sequence or peptide sequence that differs from a reference nucleic acid sequence or peptide sequence, respectively, but retains the primary properties of the reference molecule. Changes in the sequence of the nucleic acid variant may not alter the amino acid sequence of the peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Variations in peptide variant sequences are typically limited or conservative, such that the sequences of the reference peptide and the variant are generally very similar and identical in many regions. Variants may differ from the reference peptide in terms of amino acid sequence by one or more substitutions, additions, deletions in any combination. Variants of the nucleic acid or peptide may be naturally occurring, such as allelic variants, or may not be known naturally occurring variants. Variants of non-naturally occurring nucleic acids and peptides can be prepared by mutagenesis techniques or by direct synthesis.

A "vector" is a composition of matter that comprises an isolated nucleic acid and that can be used to deliver the isolated nucleic acid into the interior of a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphoteric compounds, plasmids, and viruses. Thus, the term "vector" includes spontaneously replicating plasmids or viruses. The term should also be understood to include non-plasmid and non-viral compounds that facilitate transfer of nucleic acids into cells, such as polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, lentiviral vectors, adeno-associated viral vectors, retroviral vectors, and the like.

The range is as follows: throughout this disclosure, aspects of the disclosure may be presented in a range format. It should be understood that the description of the range format is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered as having all possible subranges and individual numerical values of that range specifically disclosed. For example, descriptions of ranges such as 1 to 6 should be considered as having specifically disclosed sub-ranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within the range, e.g., 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

Herpes virus targeting

Embodiments include compositions and methods for treating and preventing herpes virus infections in a subject in need thereof. For example, in certain embodiments, the present disclosure provides a composition that specifically cleaves a viral target sequence in the genome of a herpes virus, thereby preventing or reducing the ability of the virus to replicate, and thus inhibiting herpes virus infectivity.

In certain embodiments, gene editing complexes specific for single and multiple conformations of human herpes simplex virus, such as CRISPR-Cas systems, disrupt the integrity of viral DNA sequences, resulting in excision of the HSV genome between targeted HSV regions. For example, CRISPR-Cas molecules described herein have the potential to remove large segments of the HSV genome and impair the ability of the virus to replicate in infected cells. Accordingly, the present disclosure provides a composition and method that targets the HSV genome in an infected cell to destroy the viral genome in an acute or latent HSV1 infection as a novel therapeutic and prophylactic strategy.

In certain embodiments, described herein are compositions and methods relating to targeting HSV genomes. In some embodiments, the compositions and methods include a CRISPR/Cas system for targeting HSV genomes. In some embodiments, the compositions and methods result in excision of part or all of the HSV genome. In some embodiments, the compositions and methods result in excision of a portion or all of the HSV genome in 1, 2, 3, 4, 5, or 6 different genes of the HSV genome. In some embodiments, the compositions and methods result in excision of at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or more than 9000 base pairs of the HSV genome.

In some embodiments, provided herein are methods and compositions comprising a CRISPR-associated (Cas) peptide or a nucleic acid sequence encoding the CRISPR-associated (Cas) peptide and a plurality of guide nucleic acids or a nucleic acid sequence encoding the plurality of guide nucleic acids. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 grnas. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different grnas. In some embodiments, the compositions and methods described herein comprise 4 or at least 4 different grnas. In certain embodiments, the one or more grnas target one or more different regions or sequences in the HSV genome (e.g., ICPO and ICP 27).

In some embodiments, the different grnas target different sequences within the HSV genome. In some embodiments, the different grnas are complementary to different target sequences within the HSV genome. In some embodiments, the target sequence is within or near the UL56, ICPO, ICP4, or ICP27 genes of the HSV genome. In certain embodiments, a gRNA targeting the UL56, ICPO, ICP4, or ICP27 gene hybridizes to a region within or near the UL56, ICPO, ICP4, or ICP27 gene. In some embodiments, the region within the UL56, ICPO, ICP4, or ICP27 gene comprises at least one nucleotide within the UL56, ICPO, ICP4, or ICP27 gene. In some embodiments, the region near the UL56, ICPO, ICP4, or ICP27 gene comprises 5, 10, 15, 20, 25, 30, or 35 base positions around the UL56, ICPO, ICP4, or ICP27 gene.

In some embodiments, the compositions and methods described herein include 2, 3, 4, 5, 6, or more than 6 different grnas that target (e.g., hybridize or anneal to) or are complementary to a region within UL56, ICPO, ICP4, ICP27, or a combination thereof, of the HSV genome. In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas targeting the UL56 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the UL56 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP0 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP0 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP4 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas targeting the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 2 different grnas targeting the UL56 gene of the HSV genome and 1 gRNA targeting the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the UL56 gene of the HSV genome and 2 different grnas targeting the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA targeting the UL56 gene of the HSV genome and 2 different grnas targeting the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the UL56 gene of the HSV genome and 1 gRNA targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the UL56 gene of the HSV genome and 2 grnas targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA targeting the UL56 gene of the HSV genome and 2 different grnas targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the UL56 gene of the HSV genome and 1 gRNA targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the UL56 gene of the HSV genome and 2 grnas targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA targeting the UL56 gene of the HSV genome and 2 different grnas targeting the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 2 different grnas targeting the ICP0 gene of the HSV genome and 1 gRNA targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the ICP0 gene of the HSV genome and 2 grnas targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA targeting the ICP0 gene of the HSV genome and 2 different grnas targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the ICP0 gene of the HSV genome and 1 gRNA targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the ICP0 gene of the HSV genome and 2 grnas targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA targeting the ICP0 gene of the HSV genome and 2 different grnas targeting the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 2 different grnas targeting the ICP4 gene of the HSV genome and 1 gRNA targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas targeting the ICP4 gene of the HSV genome and 2 grnas targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA targeting the ICP4 gene of the HSV genome and 2 different grnas targeting the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP0 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to an ICP0 gene of an HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to an ICP27 gene of an HSV genome. In some embodiments, the compositions and methods described herein include 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP4 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different grnas that hybridize to the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the UL56 gene of the HSV genome and 1 gRNA that hybridizes to the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the UL56 gene of the HSV genome and 2 different grnas that hybridize to the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA that hybridizes to the UL56 gene of the HSV genome and 2 different grnas that hybridize to the ICPO gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the UL56 gene of the HSV genome and 1 gRNA that hybridizes to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the UL56 gene of the HSV genome and 2 different grnas that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA that hybridizes to the UL56 gene of the HSV genome and 2 different grnas that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the UL56 gene of the HSV genome and 1 gRNA that hybridizes to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the UL56 gene of the HSV genome and 2 different grnas that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA that hybridizes to the UL56 gene of the HSV genome and 2 different grnas that hybridize to the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the ICP0 gene of the HSV genome and 1 gRNA that hybridizes to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the ICP0 gene of the HSV genome and 2 different grnas that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA that hybridizes to the ICP0 gene of the HSV genome and 2 different grnas that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the ICP0 gene of the HSV genome and 1 gRNA that hybridizes to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the ICP0 gene of the HSV genome and 2 different grnas that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA that hybridizes to the ICP0 gene of the HSV genome and 2 different grnas that hybridize to the ICP27 gene of the HSV genome.

In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the ICP4 gene of the HSV genome and 1 gRNA that hybridizes to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 2 different grnas that hybridize to the ICP4 gene of the HSV genome and 2 different grnas that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein include 1 gRNA that hybridizes to the ICP4 gene of the HSV genome and 2 different grnas that hybridize to the ICP27 gene of the HSV genome.

In certain embodiments, provided herein are methods and compositions for targeting the HSV genome using four guide nucleic acids. In some embodiments, a first guide nucleic acid of the plurality of guide nucleic acids is complementary to a first target sequence in the HSV genome. In some embodiments, a second guide nucleic acid of the plurality of guide nucleic acids is complementary to a second target sequence in the HSV genome. In some embodiments, a third guide nucleic acid of the plurality of guide nucleic acids is complementary to a third target sequence in the HSV genome. In some embodiments, a fourth guide nucleic acid of the plurality of guide nucleic acids is complementary to a fourth target sequence in the HSV genome. In some embodiments, the first target sequence, the second target sequence, the third target sequence, and the fourth target sequence are different.

In some embodiments, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 373 or the sequences detailed in Table 4. In some embodiments, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the complement of any one of SEQ ID NOS: 1 to 96 or 372 to 373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to any of SEQ ID NOs 1 to 96 or 372 to 373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to the complement of any one of SEQ ID NOS: 1-96 or 372-373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to any of SEQ ID NOs 1 to 96 or 372 to 373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to the complement of any one of SEQ ID NOS: 1-96 or 372-373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to any of SEQ ID NOs 1 to 96 or 372 to 373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to the complement of any one of SEQ ID NOS: 1-96 or 372-373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 100% homology to any of SEQ ID NOs 1 to 96 or 372 to 373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 100% homology to the complement of any one of SEQ ID NOS: 1-96 or 372-373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any of SEQ ID NOs 1 to 96 or 372 to 373 or the sequences detailed in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of a sequence complementary to any of SEQ ID NOs 1 to 96 or 372 to 373 or the sequences detailed in Table 4.

In some embodiments, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 363, 371 or 374 to 377. In some embodiments, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the complement of any one of SEQ ID NOs 363, 371 or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to any of SEQ ID NOs 363, 371, or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to the complement of any one of SEQ ID NOs 363, 371 or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to any of SEQ ID NOs 363, 371, or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to the complement of any one of 363, 371, or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to any of SEQ ID NOs 363, 371, or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to the complement of any one of SEQ ID NOs 363, 371 or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 100% homology to any of SEQ ID NOs 363, 371, or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence having at least or about 100% homology to the complement of any one of SEQ ID NOs 363, 371 or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any of SEQ ID NOs 363, 371, or 374 to 377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of the complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

In some embodiments, the ICP0 sequence targeted by the first gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 372 or 373, and the ICP27 sequence targeted by the second gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 374 or 375.

In some embodiments, the sequence targeted by the gRNA comprises a sequence as detailed in any one of SEQ ID NOs 372 to 375. In some embodiments, the sequence targeted by the first gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 372; the sequence targeted by the second gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 373; the sequence targeted by the third gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 374; and the sequence targeted by the fourth gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 375.

In some embodiments, the sequence targeted by the gRNA comprises a sequence as detailed in any one of SEQ ID NOs 2, 7, 376 to 377. In some embodiments, the sequence targeted by the first gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 2 or a complement thereof; the sequence targeted by the second gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 7 or the complement thereof; the sequence targeted by the third gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO 376 or the complement thereof; and the sequence targeted by the fourth gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO 377 or its complement

In some embodiments, described herein are compositions and methods comprising a sequence having at least or about 0%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 97 to 193 or the sequences detailed in Table 4. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs 97 to 193 or the sequences detailed in table 4. In some cases, the PAM sequence comprises a sequence having at least or about 97% homology to any one of SEQ ID NOs 197 to 193 or the sequences detailed in table 4. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs 97 to 193 or the sequences detailed in table 4. In some cases, the PAM sequence comprises a sequence having at least or about 100% homology to any one of SEQ ID NOs 97 to 193 or the sequences detailed in table 4. In some cases, the PAM sequence comprises a sequence of at least or about 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs 97 to 193 or the sequences detailed in table 4. In some embodiments, PAM sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 97 to 193 are used with grnas for targeting sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 1 to 96 or 372 to 375.

In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 194 to 212 or a sequence detailed in Table 1. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to any of SEQ ID NOs 194 through 212 or the sequences detailed in Table 1. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to any of SEQ ID NOs 194 through 212 or the sequences detailed in Table 1. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to any of SEQ ID NOs 194 through 212 or the sequences detailed in Table 1. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 100% homology to any of SEQ ID NOs 194 through 212 or the sequences detailed in Table 1. In some cases, the sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs 194 to 212 or the sequences detailed in table 1.

In some embodiments, described herein are compositions and methods comprising a sequence having at least or about 0%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 213 to 231 or a sequence detailed in Table 1. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs 213 to 231 or the sequences detailed in table 1. In some cases, the PAM sequence comprises a sequence having at least or about 97% homology to any of SEQ ID NOs 213 to 231 or the sequences detailed in table 1. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs 213 to 231 or the sequences detailed in table 1. In some cases, the PAM sequence comprises a sequence having at least or about 100% homology to any one of SEQ ID NOs 213 to 231 or the sequences detailed in table 1. In some cases, the PAM sequence comprises a sequence of at least or about 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs 213 to 231 or the sequences detailed in table 1. In some embodiments, PAM sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 213 to 231 are combined with grnas targeting sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 194 to 212.

In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 232 to 243 or a sequence detailed in Table 2. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 95% homology with any of SEQ ID NOs 232 to 243 or the sequences detailed in Table 2. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to any of SEQ ID NOs 232 to 243 or the sequences detailed in Table 2. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 99% homology with any of SEQ ID NOs 232 to 243 or the sequences detailed in Table 2. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 100% homology with any of SEQ ID NOs 232 to 243 or the sequences detailed in Table 2. In some cases, the sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs 232 to 243 or the sequences detailed in table 2.

In some embodiments, described herein are compositions and methods comprising a sequence having at least or about 0%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 244 to 255 or a sequence detailed in Table 2. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs 244 to 255 or the sequences detailed in table 2. In some cases, the PAM sequence comprises a sequence having at least or about 97% homology to any one of SEQ ID NOs 244 to 255 or the sequences detailed in table 2. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs 244 to 255 or the sequences detailed in table 2. In some cases, the PAM sequence comprises a sequence having at least or about 100% homology to any one of SEQ ID NOs 244 to 255 or the sequences detailed in table 2. In some cases, the PAM sequence comprises a sequence of at least or about 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs 244 to 255 or the sequences detailed in table 2. In some embodiments, PAM sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 244 to 255 are used with grnas for targeting sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 232 to 243.

In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 256 to 305 or a sequence detailed in Table 3. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to any of SEQ ID NOs 256 to 305 or the sequences detailed in Table 3. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to any of SEQ ID NOs 256 to 305 or the sequences detailed in Table 3. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to any of SEQ ID NOs 256 to 305 or the sequences detailed in Table 3. In some cases, the sequence targeted by the gRNA comprises a sequence having at least or about 100% homology to any of SEQ ID NOs 256 to 305 or the sequences detailed in Table 3. In some cases, the sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs 256 to 305 or the sequences detailed in table 3.

In some embodiments, described herein are compositions and methods comprising a sequence having at least or about 0%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs 306 to 355 or a sequence detailed in Table 3. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs 306 to 355 or the sequences detailed in table 3. In some cases, the PAM sequence comprises a sequence having at least or about 97% homology to any one of SEQ ID NOs 306 to 355 or the sequences detailed in table 3. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs 306 to 355 or the sequences detailed in table 3. In some cases, the PAM sequence comprises a sequence having at least or about 100% homology to any one of SEQ ID NOs 306 to 355 or the sequences detailed in table 3. In some cases, the PAM sequence comprises a sequence of at least or about 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs 306 to 355 or the sequences detailed in table 3. In some embodiments, PAM sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 306 to 355 are combined with grnas targeting sequences having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 256 to 305.

In certain embodiments, described herein are compositions and methods for targeting sequences in the HSV genome. In some embodiments, the construct or vector is used with the compositions and methods described herein. In some embodiments, the construct or vector comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 380. In some cases, the construct or vector comprises a sequence having at least or about 95% homology to SEQ ID NO. 380. In some cases, the construct or vector comprises a sequence having at least or about 97% homology to SEQ ID NO. 380. In some cases, the construct or vector comprises a sequence having at least or about 99% homology to SEQ ID NO. 380. In some cases, the construct or vector comprises a sequence having at least or about 100% homology to SEQ ID NO. 380. In some cases, the construct or vector comprises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, or a sequence of more than 8400 nucleotides of SEQ ID No. 380. In certain embodiments, the construct or vector comprises a CRISPR-Cas enzyme sequence and the gRNA sequence of SEQ ID NO. 380. In certain embodiments, the construct or vector comprises a CRISPR-Cas enzyme sequence and a gRNA sequence having 70%, 80%, 85%, 90%, 95% sequence identity to the CRISPR-Cas enzyme sequence and a gRNA sequence of SEQ ID No. 380.

In certain embodiments, described herein are compositions and methods for targeting sequences in the HSV genome. In some embodiments, the nucleic acid construct or vector is used in combination with the compositions and methods described herein. In some embodiments, the construct or vector comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 381. In some cases, the construct or vector comprises a sequence having at least or about 95% homology to SEQ ID NO 381. In some cases, the construct or vector comprises a sequence having at least or about 97% homology to SEQ ID NO 381. In some cases, the construct or vector comprises a sequence having at least or about 99% homology to SEQ ID NO 381. In some cases, the construct or vector comprises a sequence having at least or about 100% homology to SEQ ID NO 381. In some cases, the construct or vector comprises a sequence of at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, or 5000 nucleotides of SEQ ID No. 381.

Further provided are nucleic acids comprising one or more grnas that encode hybridization to one or more target sequences of an ICP0 gene and/or one or more grnas that hybridize to one or more target sequences of an ICP27 gene. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs according to SEQ ID NO. 2 and/or SEQ ID NO. 7. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs according to any of SEQ ID NO 376 and/or SEQ ID NO 377. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs according to any of SEQ ID NOs 2, 7, 376 and 377. In some embodiments, the nucleic acid comprises a sequence encoding one or more grnas having about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NOs 2, 7, 376 and 377.

In certain embodiments, further provided herein are nucleic acids comprising a nucleic acid encoding one or more grnas that hybridize to one or more target sequences of an ICP0 gene and/or one or more grnas that hybridize to one or more target sequences of an ICP27 gene. In some embodiments, the nucleic acid comprises a sequence encoding one or more grnas according to any one of SEQ ID NOs 1 to 377. In some embodiments, the nucleic acid comprises a sequence encoding one or more grnas having about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NOs 1 to 377. In some embodiments, the nucleic acid further comprises a 5'itr element and a 3' itr element. In some embodiments, the nucleic acid is configured to be packaged within an adeno-associated virus (AAV) vector. In some embodiments, the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8.

In some embodiments, the CRISPR endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a Cas phi endonuclease. In some embodiments, the CRISPR endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

In some embodiments, the present disclosure provides a composition for treating or preventing a herpes viral infection in a subject in need thereof. In some embodiments, the composition comprises at least one isolated guide nucleic acid that is complementary to a target region in the herpesvirus genome. In some embodiments, the composition comprises a CRISPR-associated (Cas) peptide or a functional fragment or derivative thereof. In summary, the isolated nucleic acid guide molecule and CRISPR-associated (Cas) peptide function to introduce one or more mutations at a target site into the herpesvirus genome, thereby inhibiting infectivity of the virus.

The composition also encompasses isolated nucleic acids encoding one or more elements of the CRISPR-Cas system. For example, in some embodiments, the composition comprises an isolated nucleic acid encoding at least one of the guide nucleic acid and CRISPR-associated (Cas) peptide or a functional fragment or derivative thereof.

In some embodiments, the present disclosure provides a method for treating or preventing a herpes viral infection in a subject in need thereof. In some embodiments, the method comprises administering to the subject an effective amount of a composition comprising at least one of a guide nucleic acid and a CRISPR-associated (Cas) peptide or a functional fragment or derivative thereof. In certain instances, the method comprises administering a composition comprising an isolated nucleic acid encoding at least one of the guide nucleic acid and a CRISPR-associated (Cas) peptide or a functional fragment or derivative thereof. In certain embodiments, the method comprises administering a composition described herein to a subject diagnosed as having a herpes virus infection, at risk of developing a herpes virus infection, a subject having a potential herpes virus infection, and the like.

In some embodiments, the method is used to treat or prevent a herpes virus infection, including but not limited to, herpes simplex virus type I (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; EBV), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi's sarcoma-associated herpes virus (KSHV)).

Herpes virus

The herpesvirus genera are divided into three genera: alpha-herpes viruses (e.g., HSV1, herpes simplex virus type 2 which causes genital herpes, and varicella-zoster virus which causes varicella and zoster); beta-herpes viruses (e.g., HHV-6 causing the sixth disease, and HHV-7 causing the rosea in infants); and gamma-herpes viruses (e.g., EB virus causing mononucleosis, and HHV-8 causing Kaposi's sarcoma). Alpha-herpes viruses share not only similar life cycles, but also homologous DNA sequences in many viral proteins that are critical for viral replication and reactivation.

Herpes simplex type 1 (HSV 1) is an encapsulated double-stranded 153 kilobase (kB) DNA virus, an almost ubiquitous human pathogen. Up to 60% of americans have been infected with HSV1 by the age of their 40 years. Primary infections typically occur in early childhood and are characterized by fever and lesions of the oral and gingival mucosa, but often sub-clinical infections occur. Primary HSV1 infection may also occur upon sexual contact, and HSV1 is increasingly found to be the cause of genital herpes. Although the symptoms of the primary infection are typically lighter, life threatening infections may also occur, particularly if the infection occurs during neonatal periods or if HSV1 is contacted by an immunodeficient individual.

Following primary infection, the HSV1 genome may sleep within sensory neurons for a long period of time. During this phase of the viral lifecycle, the HSV1 genome exists in a supercoiled, episomal state within the nucleus of potentially infected neurons. In this state, no viral proteins are produced and only one viral transcript, the Latency Associated Transcript (LAT), is produced. A large amount of stimulation (including stress and UV light) can result in viral reactivation from potentially infected neurons. Reactivation can occur repeatedly many years after the initial infection. Symptoms caused by HSV1 reactivation vary with the primary site of infection and the extent of reactivation. The most commonly identified form of HSV1 reactivation is herpes labialis. Herpes labialis typically occurs on the vermilion edge of the mouth after various stimuli, including UV light exposure. Reactivation of the virus stored in dorsal root ganglion neurons innervating the genitalia is in the form of recurrent genital herpes. The signs of HSV1 reactivation of the labial and anogenital manifestations are initial stinging of this area, followed by painful blisters containing infectious virus, which ulcerate and eventually heal. Other less common manifestations of HSV1 reactivation include bell's palsy, delayed facial paralysis after otology surgery, and vestibular neuritis. HSV1 reactivation may have more damaging manifestations such as herpetic encephalitis and disseminated herpes.

During primary infection, protein expression of defined sequences occurs.

After the virus enters the cell during primary infection, the viral capsid is released into the cytoplasm and host protein synthesis is shut down by VHS/UL41 (a protein of the interlayer). The second, VP 16, forms a complex with the host proteins oct and HCF to induce immediate early HSV1 transcription. These immediate early genes induce HSV1 expression encoded by enzymes required for viral DNA replication, including adenosine kinase (TK) and viral DNA polymerase (UL 30). As viral DNA production progresses, late viral proteins (including capsid proteins, interlayer proteins, and glycoproteins) are produced that are necessary for the entry of the virus into the cell. The viral particle assembly and viral DNA are encapsulated within the capsid. Eventually, infectious viral particles are produced, leading to infection around the cells and transmission to other people.

The initial sequence of steps for virus reactivation is believed to be in concert during HSV1 reactivation in potentially infected neurons at a later stage of reactivation. Proteins that play a key role in lytic infections, such as VP 16, are thought to play a similar key role in reactivation. As the HSV1 reactivation process progresses, immediate early gene expression occurs, followed by early protein production, and then late protein production. Eventually, the production of infectious viral particles occurs, resulting in the transmission of infection to neighboring cells and uninfected individuals.

In recent years, several systems have been developed for targeting endogenous genes, including Homing Endonucleases (HE) or meganucleases (meganucleases), zinc Finger Nucleases (ZFNs), transcription activation-like effector nucleases (TALENs) and recently Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) related systems 9 (Cas 9) proteins, which utilize site-specific double-stranded DNA break (DSB) mediated DNA repair mechanisms. These enzymes induce precise and efficient genome cleavage by DSB-mediated DNS repair mechanisms. These DSB-mediated genome editing techniques are capable of effecting gene deletions, insertions or modifications.

ZFNs and TALENs have revolutionized genome editing over the past few years. The main drawbacks of ZFNs and TALENs are the uncontrolled off-target effects and cumbersome and expensive engineering of DNA binding fusion proteins tailored for each target, which limit universal application and clinical safety.

RNA-guided Cas9 biotechnology induced genome editing without detectable off-target effects. This technology takes advantage of the genomic defense mechanism in bacteria, and the CRISPR/Cas locus encodes an RNA-guided adaptive immune system against mobile gene elements (viruses, transposable elements and conjugative plasmids). Three types (I to III) of CRISPR systems have been identified. CRISPR clusters contain spacer sequences, i.e. sequences complementary to the antecedent mobile element. CRISPR clusters are transcribed and processed into mature CRISPR (clustered regularly interspaced short palindromic repeats) RNAs (crrnas). Cas9 belongs to the type II CRISPR/Cas system and has strong endonuclease activity to cleave target DNA.

Cas9 is guided by mature crrnas (which contain a unique target sequence of about 20 base pairs (bp) (referred to as a spacer sequence)) and trans-acting small RNAs (tracrRNA), which act as guides for ribonuclease Ill-assisted processing of precursor crrnas. crRNA tracrRNA duplex directs Cas9 to target DNA via base pairing between a spacer sequence on the crRNA and a complementary sequence (called pre-spacer sequence) on the target DNA (tDNA). Cas9 recognizes the trinucleotide (NGG) pre-spacer adjacent motif (PAM) to specify the cleavage site (nucleotide 3 from PAM). The crRNA and tracrRNA can be expressed independently or engineered via synthetic stem loops (agaaaau) to artificially fuse small guide RNAs to mimic a natural crRNA/tracrRNA duplex. Such grnas, such as shRNA, can be synthesized or transcribed in vitro for direct RNA transfection or expression from RNA expression vectors (e.g., U6 or Hl promoter driven vectors). Thus, cas9 gRNA technology requires expression of Cas9 proteins and grnas, which then form a gene editing complex at a specific target DNA binding site within the target genome and cause cleavage/mutation of that target DNA.

However, the present disclosure is not limited to the use of Cas 9-mediated gene editing. Conversely, the present disclosure encompasses the use of other CRISPR-associated peptides that can be targeted to the targeted sequence using gRNA and can be edited for the target. For example, in some embodiments, the present disclosure utilizes Cpfl to edit a target.

As described herein, in some embodiments, the present disclosure employs novel RNA-guided genetic strategies targeting the HSV1 genome using CRISPR techniques, and abrogates its expression by editing specific domains of HSV1 immediate early genes, infected cellular protein 0 (ICP 0).

However, the present disclosure is not limited to the prevention or treatment of HSV1. Conversely, the present disclosure may be used to treat or prevent other herpesviruses. For example, since the HSV2 genome is similar to the HSV1 genome, the strategies described herein will be effective in treating or preventing HSV 2.

Nuclease (nuclease)

Engineered CRISPR systems typically contain two components: guide RNAs (grnas or sgrnas) and CRISPR-associated endonucleases (Cas proteins). In nature, CRISPR/CRISPR-associated (Cas) systems provide bacteria and archaea with adaptive immunity to viruses and plasmids by using CRISPR RNA (crRNA) to guide silencing of invasive nucleic acids. CRISPR-Cas is an RNA-mediated adaptive defense system that relies on small RNA molecules for sequence-specific detection and silence of foreign nucleic acids. The CRISPR/Cas system consists of a Cas gene organized in an operon and a CRISPR array consisting of genomic targeting sequences (called spacer sequences). Provided herein are engineered CRISPR systems that detect and silence HSV DNA in cells.

As described herein, a CRISPR-Cas system generally refers to an enzyme system that includes a guide RNA sequence that includes a nucleotide sequence that is complementary or substantially complementary to a region of a target polynucleotide, and a protein having nuclease activity. CRISPR-Cas systems include type I CRISPR-Cas systems, type II CRISPR-Cas systems, type III CRISPR-Cas systems, and derivatives thereof. The CRISPR-Cas system includes engineered and/or programmed nuclease systems derived from naturally occurring CRISPR-Cas systems. In certain embodiments, the CRISPR-Cas system contains engineered and/or mutated Cas proteins. In some embodiments, a nuclease generally refers to an enzyme capable of cleaving a phosphodiester bond between nucleotide subunits of a nucleic acid, and in some embodiments, an endonuclease generally is capable of cleaving a phosphodiester bond within a polynucleotide strand. Nicking enzyme refers to an endonuclease that cleaves only a single strand of a DNA duplex.

In some embodiments, a CRISPR/Cas as used herein can be a type I, type II, or type III system. Non-limiting examples of suitable CRISPR/Cas proteins include Cas3, cas4, cas5e (or CasD), cas6e, cas6f, cas7, cas8a1, cas8a2, cas8b, cas8c, cas9, cas10, caslOd, casF, casG, casH, casX, cas Φ, csy1, csy2, csy3, csel (or CasA), cse2 (or CasB), cse3 (or CasE), cse4 (or CasC), cscl, csc2, csa5, csn2, csm3, csm4, csm5, csm6, cmrl, cmr3, cmr4, cmr5, cmr6, csbl, csb2, csb3, csxl7, csxl4, csxlO, csxl6, csaX, x3, zl, csxl5, csfl 2, csf3, csf 6, and Csf 6. Further for example, in some embodiments, the CRISPR-Cas protein is Cas1, cas1B, cas2, cas3, cas4, cas5, cash, cas7, cas8, casio, csyl, csy2, csy3, csel, cse2, cscl, csc2, csa5, csn2, csm3, csm4, csm5, csm6, cmrl, cmr3, cmr4, cmr5, cmr6, csbl, csb2, csb3, csxl7, csxl4, csxl6, csaX, csx3, csxl5, csfl, csf2, csf3, csf4, cas9, casl2 (e.g., cas12a, cas12b, casl2c, cas12d, cas12k, cas12j, cas phi, casl2L, etc.), cas 13 (e.g., casl3a, casl3b (such as Casl3b-tl, casl3b-t2, casl3b-t 3), casl3c, casl3d, etc.), casl4, casX, casY, or engineered versions of the Cas protein. In some embodiments, the CRISPR/Cas protein or endonuclease is Cas9. In some embodiments, the CRISPR/Cas protein or endonuclease is Cas12. In certain embodiments, the Casl2 polypeptide is Casl2a, casl2b, casl2c, casl2d, casl2e, casl2g, casl2h, casl2i, casl2L, or Casl2J. In some embodiments, the CRISPR/Cas protein or endonuclease is CasX. In some embodiments, the CRISPR/Cas protein or endonuclease is CasY. In some embodiments, the CRISPR/Cas protein or endonuclease is Cas phi.

In some embodiments, the Cas9 protein may be from or derived from: staphylococcus aureus, streptococcus pyogenes, streptococcus thermophilus (Streptococcus thermophilus), streptococcus (Streptococcus sp.), nocardia darunasis (Nocardiopsis dassonvillei), streptomyces pristinaespiralis (Streptomyces pristinaespiralis), streptomyces viridochromogenes (Streptomyces viridochromogenes), streptococcus rubus (Streptosporangium roseum), bacillus acidocaldarius (Alicyclobacillus acidocaldarius), bacillus pseudomycoides (Bacillus pseudomycoides), bacillus arsenicum (Bacillus selenitireducens), bacillus siberia (Exiguobacterium sibiricum), lactobacillus delbrueckii (Lactobacillus delbrueckii), lactobacillus salivarius (Lactobacillus salivarius), marine microbacterium (Microscilla marina), burkholderiales (burkholderia) bacteria, polar pseudomonas naphthalene degradation (Polaromonas naphthalenivorans) polar monads (polar algae sp.), marine nitrogen-fixing cyanobacteria (Crocosphaera watsonii), blue-green algae (cyanheck sp.), microcystis aeruginosa (Microcystis aeruginosa), synechococcus sp.), acetobacter aceti (Acetohalobium arabaticum), paracetamol (Ammonifex degensii), pyrocellulose bacteria 9Caldicelulosiruptor becscii, candidatus Desulforudis, clostridium botulinum (Clostridium botulinum), clostridium difficile (Clostridium difficile), geotrichum (Finegoldia magna), thermosaline-alkali anaerobic bacteria (Natranaerobius thermophilus), anaerobic enterobacter thermophilus (Natranaerobius thermophilus), mesophilic camptothecium (Natranaerobius thermophilus), thiobacillus ferrooxidans (Natranaerobius thermophilus), natranaerobius thermophilus, bacillus Marinobacter sp ], nitrococcus halophilus (Nitrosococcus halophilus), nitrococcus warrior (Nitrosococcus watsoni), pseudoalteromonas tetrodotoxin (Pseudoalteromonas haloplanktis), ktedonobacter racemifer, sarcina methanosarcina (Methanohalobium evestigatum), anabaena variabilis (Anabaena variabilis), chlorella foamosa (Nodularia spumigena), nostoc (Nostoc sp.), dinoflagellate (Arthrospira maxima), arthrospira obtusifolia (Arthrospira platensis), arthrospira (arthspira sp.), sphaeromonas (Lyngbya sp.), azotobacter (Microcoleus chthonoplastes), oscillatoria sp.), dan Paojun (Petrotoga mobilis), thermus africanus (Thermosipho africanus), or blue-green algae (Acaryochloris marina).

In some embodiments, the composition comprises a CRISPR-associated (Cas) protein or a functional fragment or derivative thereof. In some embodiments, the Cas protein is an endonuclease, including but not limited to Cas9 nucleases. In some embodiments, the Cas9 protein comprises an amino acid sequence that is identical to a wild-type streptococcus pyogenes or staphylococcus aureus Cas9 amino acid sequence. In some embodiments, the Cas protein comprises the amino acid sequence of a Cas protein from another species, for example, another streptococcus species such as streptococcus thermophilus; pseudomonas aeruginosa (Pseudomonas aeruginosa), escherichia coli (Escherichia coli) or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. Other Cas proteins useful in the present disclosure are known or can be identified using methods known in the art (see, e.g., esvelt et al, 2013,Nature Methods,10:1116-1121). In some embodiments, the Cas protein comprises an amino acid sequence that is modified compared to its natural source.

The CRISPR/Cas protein comprises at least one RNA recognition and/or RNA binding domain. The RNA recognition and/or RNA binding domain interacts with guide RNAs (grnas). CRISPR/Cas proteins may also comprise nuclease domains (i.e., dnase or rnase domains), DNA binding domains, helicase domains, rnase domains, protein-protein interaction domains, dimerization domains, and other domains.

The CRISPR/Cas-like protein may be a wild-type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild-type or modified CRISPR/Cas protein. CRISPR/Cas-like proteins may be modified to increase nucleic acid binding affinity and/or specificity, alter enzyme activity, and/or alter another property of the protein. For example, the nuclease (i.e., dnase, rnase) domain of the CRISPR/Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR/Cas-like protein may be truncated to remove domains that are not important for the function of the Cas protein. The CRISPR/Cas-like protein may also be truncated or modified to optimize the activity of the effector domain of the Cas protein.

In some embodiments, the CRISPR/Cas-like protein may be derived from a wild-type Cas protein or a fragment thereof. In some embodiments, the CRISPR/Cas-like protein is a modified Cas9 protein. For example, the amino acid sequence of a Cas9 protein may be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, etc.) of the protein relative to the wild-type or another Cas protein. Alternatively, a domain of the Cas9 protein that is not involved in RNA-guided cleavage may be eliminated from the protein, such that the modified Cas9 protein is smaller than the wild-type Cas9 protein.

The disclosed CRISPR-Cas compositions should also be construed to include any type of protein that has substantial homology to the Cas proteins disclosed herein (e.g., cas9, saCas9, cas9 proteins). In some embodiments, a "substantially homologous" protein is about 50% homologous, about 70% homologous, about 80% homologous, about 90% homologous, about 95% homologous, or about 99% homologous to an amino acid sequence of a Cas protein disclosed herein.

In some embodiments, the composition comprises a CRISPR-associated (Cas) peptide or a functional fragment or derivative thereof. In certain embodiments, the Cas peptide is an endonuclease, including but not limited to Cas9 nucleases. In some embodiments, the Cas9 peptide comprises an amino acid sequence identical to a wild-type streptococcus pyogenes Cas9 amino acid sequence. In some embodiments, the Cas peptide may comprise the amino acid sequence of a Cas protein from other species, for example other streptococcus species such as streptococcus thermophilus, pseudomonas aeruginosa, escherichia coli or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. Other Cas peptides useful in the present disclosure are known or can be identified using methods known in the art (see, e.g., esvelt et al, 2013,Nature Methods,10:1116-1121). In certain embodiments, the Cas peptide may comprise a modified amino acid sequence compared to its natural source. For example, in some embodiments, the wild-type staphylococcus aureus Cas9 sequence can be modified. In certain embodiments, the amino acid sequence may be a codon optimized for efficient expression in a human cell (i.e., "humanized") or in a target species. The humanized Cas9 nuclease sequence may be, for example, a Cas9 nuclease sequence encoded by any one of the expression vectors listed in Genbank accession numbers KM099231.1GL669193757, KM099232.1GL669193761 or KM099233.1GL669193765. Alternatively, the Cas9 nuclease sequence may be, for example, a sequence contained within a commercially available vector such as PX330 or PX260 from Addgene (Cambridge, MA). In some embodiments, the Cas9 nuclease may have an amino acid sequence that is a variant or fragment of any of the Cas9 endonuclease sequences of Genbank accession KM099231.1GL669193757, KM099232.1GL669193761, or KM099233.1GL669193765 or a Cas9 amino acid sequence of PX330 or PX260 (Addgene, cambridge, MA).

The Cas9 protein sequence may be modified to encode a biologically active encoding of Cas9, and these variants may have or may include, for example, amino acid sequences that differ from wild-type Cas9 by containing one or more mutations (e.g., addition, deletion, or substitution mutations, or combinations of such mutations). One or more of the substitution mutations may be substitutions (e.g., conservative amino acid substitutions).

In certain embodiments, the Cas peptide is a mutant Cas9, wherein the mutant Cas9 reduces off-target effects compared to wild-type Cas 9. In some embodiments, the mutant Cas9 is a streptococcus pyogenes Cas9 (SpCas 9) variant.

In some embodiments, the SpCas9 variant comprises one or more point mutations, including but not limited to R780A, K810A, K848A, K855A, H982A, K A and R1060A (Slaymaker et al 2016, science,351 (6268): 84-88). In some embodiments, the SpCas9 variant comprises a D1135E point mutation (Kleinstover et al, 2015, nature,523 (7561): 481-485). In some embodiments, the SpCas9 variant comprises one or more point mutations including, but not limited to, N497A, R661A, Q695A, Q926A, D1135E, L a and Y450A (kleinsriver et al 2016, nature, doi: 10.1038/natural 6526). In some embodiments, the SpCas9 variant comprises one or more point mutations including, but not limited to, M495A, M694A and M698A. Y450 is associated with a hydrophobic base pair stack. N497, R661, Q695, Q926 are associated with hydrogen bonding of residues to bases that contribute to off-target effects. N497 is hydrogen bonded through a peptide backbone. L169A is associated with a hydrophobic base pair stack. M495A, M694A and H698A are associated with a hydrophobic base pair stack.

In some embodiments, the SpCas9 variant comprises one or more point mutations at one or more of the following residues: r780, K810, K848, K855, H982, K1003, R1060, D1135, N497, R661, Q695, Q926, L169, Y450, M495, M694, and M698. In some embodiments, the SpCas9 variant comprises one or more point mutations selected from the group consisting of: R780A, K810A, K848A, K855A, H982A, K1003A, R1060A, D1135E, N497A, R661A, Q695A, Q926A, L169A, Y450A, M495A, M694A and M698A.

In some embodiments, the SpCas9 comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A and Q926A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A and D1135E. In some embodiments, the pCas9 variant includes a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A and L169A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A and Y450A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A and M495A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A and M694A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A and H698A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, D1135E and L169A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, D1135E and Y450A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A, D1135E and M495A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, Q926A, D1135E and M694A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: N497A, R661A, Q695A, D1135E and M698A.

In some embodiments, the SpCas9 comprises the point mutations R661A, Q695A and Q926A relative to the wild-type SpCas 9. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A and D1135E. In some embodiments, the SpCas9 comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A and L169A. In some embodiments, the SpCas9 comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A and Y450A. In some embodiments, the SpCas9 comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A and M495A. In some embodiments, the SpCas9 comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A and M694A. In some embodiments, the SpCas9 comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A and H698A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, D1135E and L169A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A, D1135E and Y450A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A, D1135E and M495A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A, D1135E and M694A. In some embodiments, the SpCas9 variant comprises a point mutation relative to wild-type SpCas 9: R661A, Q695A, Q926A, D1135E and M698A.

In some embodiments, the mutant Cas9 comprises one or more mutations that alter PAM specificity (kleinsriver et al 2015, nature,523 (7561): 481-485; kleinsriver et al 2015,Nat Biotechnol,33 (12): 1293-1298). In some embodiments, the mutant Cas9 comprises one or more mutations that alter the catalytic activity of Cas9, including, but not limited to, D10A in RuvC and H840A in HNH (Cong et al 2013;Science 339:919-823; gasubas et al 2012;PNAS 109:E2579-2586; jink et al 2012;Science 337:816-821).

However, the present disclosure is not limited to the use of Cas 9-mediated gene editing. Conversely, the present disclosure encompasses the use of other CRISPR-associated peptides that can be targeted to the targeted sequence using gRNA and can be edited for the target. For example, in some embodiments, the present disclosure utilizes Cpfl to edit a target. Cpfl is a single crRNA-guided class 2 CRISPR effector protein that can efficiently edit target DNA sequences in human cells. Exemplary Cpfl include, but are not limited to, the amino acid coccus (acpfl) Cpfl (AsCpfl) and the treponema (Lachnospiraceae bacterium) Cpfl (LbCpfl).

The present disclosure should also be construed to include any form of peptide having substantial homology to the Cas peptide (e.g., cas 9) disclosed herein. Preferably, a "substantially homologous" peptide is about 50% homologous, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably about 95% homologous, and even more preferably about 99% homologous to the amino acid sequence of the Cas peptide disclosed herein.

The peptides may alternatively be prepared by recombinant means or by cleavage from longer polypeptides. The composition of the peptide can be confirmed by amino acid analysis or sequencing.

Variants of peptides according to the present disclosure may be the following variants: (i) wherein one or more of the amino acids are replaced by a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue), and such a replaced amino acid residue may or may not be encoded by the genetic code, (ii) wherein one or more modified amino acid residues are present, e.g., residues modified by attachment of a substituent, (iii) wherein the peptide is an alternative splice variant of the peptide of the present disclosure, (iv) fragments of the peptide, and/or (v) wherein the peptide is fused to another peptide, such as a leader or secretory sequence or a sequence used for purification (e.g., his transition) or detection (e.g., sv5 epitope tag). The fragments include peptides generated via proteolytic cleavage of the original sequence, including multi-site proteolysis. Variants may be post-translationally or chemically modified. Such variations are considered to be within the scope of those skilled in the art in light of the teachings herein.

As known in the art, "similarity" between two peptides is determined by comparing the amino acid sequence of one polypeptide and its conservative amino acid substitutions to the sequence of a second polypeptide. Variants are defined as comprising peptide sequences that differ from the original sequence, preferably less than 40% of the residues in each target segment differ from the original sequence, more preferably less than 25% of the residues in each target segment differ from the original sequence, more preferably less than 10% of the residues in each target segment differ from the original sequence, most preferably only a few residues in each target segment differ from the original sequence, and at the same time have sufficient homology to the original sequence to preserve the functionality of the original sequence. The present disclosure includes amino acid sequences that are at least 60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 90% or 95% similar or identical to the original amino acid sequence. The degree of identity between two peptides is determined using computer algorithms and methods widely known to those skilled in the art. Identity between two amino acid sequences is preferably achieved by using the BLASTP algorithm [ BLAST Manual, altschul, s., et al, NCBI NLM NIH Bethesda, md.20894; altschul, S., et al, J.mol. Biol.215:403-410 (1990).

The peptides of the present disclosure may be post-translationally modified. For example, post-translational modifications that fall within the scope of the present disclosure include signal peptide cleavage, glycosylation, acetylation, prenylation, proteolysis, myristoylation, protein folding, proteolytic processing, and the like. Some modification or treatment practices require the introduction of additional biological mechanisms. For example, processing events such as signal peptide cleavage and core glycosylation are examined by adding canine microsomal membranes or Xenopus (Xenopus) egg extract (U.S. patent No. 6,103,489) to standard translation reactions.

The peptides of the present disclosure can include unnatural amino acids formed by post-translational modification or by introducing unnatural amino acids during translation. Various methods are available for introducing unnatural amino acids during protein translation.

The peptides or proteins of the present disclosure can be conjugated to other molecules, such as proteins, to prepare fusion proteins. This can be accomplished, for example, by synthesis of an N-terminal or C-terminal fusion protein, provided that the resulting fusion protein retains the functionality of the Cas peptide.

The peptides or proteins of The present disclosure can be phosphorylated using conventional methods such as those described in Reedijk et al (The EMBO Journal 11 (4): 1365,1992).

Cyclic derivatives of the peptides of the present disclosure are also part of the present disclosure. Cyclization can cause the peptide to assume a more favorable conformation to associate with other molecules. Cyclization may be accomplished using techniques known in the art. For example, disulfide bonds may be formed between two appropriately separated components having favorable mercapto groups, or amide bonds may be formed between amino groups of one component and carboxyl groups of the other component. Cyclization can also be achieved using azobenzene containing amino acids as described in ulyse, l., et al, j.am.chem.soc.1995,117, 8466-8467. The components forming these bonds may be side chains of amino acids, non-amino acid components, or a combination of both. In embodiments of the present disclosure, the cyclic peptide may comprise a β -turn in the correct position. The β -turn can be introduced into the peptides of the present disclosure by adding the amino acid Pro-Gly at the correct position.

It may be desirable to produce cyclic peptides that are more flexible than cyclic peptides containing peptide bond linkages as described above. More flexible peptides can be produced by introducing cysteines at the left and right positions of the peptide and forming disulfide bonds between the two cysteines. The two cysteines are arranged so as not to deform the beta sheet and the corner. The peptides are more flexible due to the length of the disulfide linkage and the smaller number of hydrogen bonds in the beta sheet portion. The relative flexibility of cyclic peptides can be determined by molecular dynamics modeling.

The disclosure also relates to peptides comprising Cas peptides fused to or incorporated into a target protein, and/or targeting domains capable of directing the chimeric protein to a desired cell component or cell type or tissue. The chimeric proteins may also contain additional amino acid sequences or domains. The chimeric proteins are recombinant in the sense that the various components are from different sources, and thus are not found together in nature (i.e., are heterologous).

In some embodiments, the targeting domain may be a transmembrane domain, a membrane binding domain, or a sequence that directs the protein to associate with, for example, a vesicle or to associate with a nucleus. In some embodiments, the targeting domain can target the peptide to a particular cell type or tissue. For example, the targeting domain can be a cell surface ligand or an antibody to a cell surface antigen of a target tissue (e.g., cancer tissue). The targeting domain may target the peptides of the disclosure to a cellular component. In certain embodiments, the targeting domain targets a tumor-specific antigen or a tumor-associated antigen.

N-terminal or C-terminal fusion proteins comprising a peptide or chimeric peptide of the present disclosure conjugated to other molecules can be prepared by: the N-terminus or C-terminus of the peptide or chimeric protein is fused by recombinant techniques to a selected protein or selectable marker having the desired biological function. The resulting fusion protein contains the Cas peptide or chimeric protein fused to the selected protein or marker protein, as described herein. Examples of proteins that can be used to prepare the fusion protein include immunoglobulins, glutathione-S-transferase (GST), haemagglutinin (HA), and truncated myc.

The peptides of the present disclosure can be synthesized by conventional techniques. For example, the peptides of the present disclosure can be synthesized by chemical synthesis using solid phase peptide synthesis. These methods employ solid-phase or solution-phase Synthesis methods (see, e.g., for solid-phase Synthesis techniques, J.M. Stewart, and J.D. Young, solid Phase Peptide Synthesis, 2 nd edition, pierce Chemical Co., rockford Ill. (1984) and G.Barany and R.B. Merrifield, the Peptides: analysis Synthesis, biological reagents E.Gross and J.Meienhofer vol.2academic Press, new York,1980, pp.3-254for solid phase Synthesis techniques; and for classical solution Synthesis, M Bodansky, principles of Peptide Synthesis, springer-Verlag, berlin 1984 and E.Gross and J.Meienhofer, the Peptides: analysis, the Synthesis, biology, supra, vol 1).

The peptides of the present disclosure can be prepared by standard chemical and biological means of peptide synthesis. Biological methods include, but are not limited to, expression of a nucleic acid encoding a peptide in a host cell or in an in vitro translation system.

The biological preparation of the peptides of the present disclosure involves expression of nucleic acids encoding the desired peptides. Expression cassettes comprising such coding sequences can be used to produce the desired peptides. For example, subclones of a nucleic acid encoding a peptide of the present disclosure may be generated using conventional molecular genetic manipulation for subcloning of memory fragments, e.g., as described in Sambrook et al, molecular Cloning: A Laboratory Manual, cold Springs Laboratory, cold Springs Harbor, new York (2012) and Ausubel et al (ed.), current Protocols in Molecular Biology, john Wiley & Sons (New York, NY) (1999 and preceding editions), each of which is incorporated herein by reference in its entirety. The subclones are then expressed in bacterial cells, either in vitro or in vivo, to yield smaller proteins or peptides that can be tested for specific activity.

In the context of an expression vector, the vector may be readily introduced into a host cell, such as a mammalian, bacterial, yeast or insect cell, by any method known in the art. The coding sequences for the desired peptides of the present disclosure may be codon optimized based on the intended codon usage of the host cell in order to improve expression efficiency, as shown herein. The password usage pattern can be found in the literature (Nakamura et al, 2000,Nuc Acids Res.28:292). Representative examples of suitable hosts include bacterial cells such as streptococci, staphylococci, escherichia coli, streptomyces and bacillus subtilis cells; fungal cells such as yeast cells and Aspergillus cells; insect cells such as Drosophila (Drosophila) S2 and Spodoptera litura (Spodoptera) Sf9 cells; animal cells such as CHO, COS, heLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells; and a plant cell.

Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphoteric compounds, plasmids, and viruses. Thus, the term "vector" includes spontaneously replicating plasmids or viruses. The term should also be understood to include non-plasmid and non-viral compounds that facilitate transfer of nucleic acids into cells, such as polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, lentiviral vectors, adeno-associated viral vectors, retroviral vectors, and the like.

The expression vector may be transferred into the host cell by physical, biological, or chemical means, as discussed in detail elsewhere herein.

To ensure that peptides obtained from chemical or biosynthetic systems are the desired peptides, analysis of the peptide composition may be performed. Such amino acid composition analysis can be performed using the resolution mass spectrum to determine the molecular weight of the peptide. Alternatively or additionally, the amino acid content of the peptide may be confirmed by: the peptides are hydrolyzed in aqueous acid and the components of the mixture are separated, identified and quantified using HPLC or amino acid analyzers. Protein sequencers that sequentially degrade peptides and sequentially identify amino acids can also be used to positively determine the sequence of the peptide.

Peptides and chimeric proteins of the present disclosure can be converted to pharmaceutical salts by reaction with inorganic acids such as hydrochloric acid, sulfuric acid, hydrobromic acid, phosphoric acid, and the like, or organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, succinic acid, malic acid, tartaric acid, citric acid, benzoic acid, salicylic acid, benzenesulfonic acid, and toluenesulfonic acid.

In certain embodiments, described herein are gene editing systems comprising meganucleases. In some embodiments, the gene editing system comprises a Zinc Finger Nuclease (ZFN). In some embodiments, the gene editing system comprises a transcription activator-like effector nuclease (TALEN). These gene editing systems can be broadly classified into two classes based on their DNA recognition patterns. ZFNs, TALENs and meganucleases achieve specific DNA binding via protein-DNA interactions, whereas CRISPR-Cas systems are targeted to specific DNA sequences through short RNA guide molecules that base pair directly with target DNA and through protein-DNA interactions. Thus, protein targeting or nucleic acid targeting can be used to target the HSV genomes described herein.

Guide nucleic acid

In some embodiments, the composition comprises at least one isolated guide nucleic acid or fragment thereof, wherein the guide nucleic acid comprises a nucleotide sequence complementary to one or more target sequences in the herpesvirus genome. In some embodiments, the guide nucleic acid is a guide RNA (gRNA).

In some embodiments, the gRNA comprises a crRNA tracrRNA duplex. In some embodiments, the gRNA comprises a stem loop that mimics a natural duplex between crRNA and tracrRNA. In some embodiments, the stem loop comprises a nucleotide sequence having agaaaau. For example, in some embodiments, the composition comprises a synthetic or chimeric guide RNA comprising crRNA, stem, and tracrRNA.

In certain embodiments, the composition comprises an isolated crRNA and/or an isolated tracrRNA that hybridizes to form a native duplex. For example, in some embodiments, the gRNA comprises crRNA or a crRNA precursor (precursor crRNA) comprising a targeting sequence.

In some embodiments, the gRNA comprises a nucleotide sequence that is substantially complementary to a target sequence in a herpesvirus genome. The target sequence in the herpesvirus genome can be any sequence in any coding or any non-coding region, wherein CRISPR/Cas mediated gene editing will result in mutation of the genome and suppression of viral infectivity. In certain embodiments, the target sequence to which the gRNA is substantially complementary is within the UL56, ICP0, ICP4, or ICP27 gene.

Exemplary gRNA nucleotide sequences for targeting the ICP0 gene include:

ccatggagccccgccccgga(SEQ ID NO:1)；gtacccgacggcccccgcgt(SEQ ID NO:2)；gacacgggcaccacacacca(SEQ ID NO:3)；tcccgcgtcaatcagcaccc(SEQ ID NO:4)；tcacttttcccctccccgac(SEQ ID NO:5)；ccttactcacacgcatctag(SEQ ID NO:6)；ctcaggccgcgaaccaagaa(SEQ ID NO:7)；gttcgcggcctgagccaggg(SEQ ID NO:8)；gctaaggggaaaaaaggggg(SEQ ID NO:9)；tttgactcagacgcagggcc(SEQ ID NO:10)；ttttttccccttagcccgcc(SEQ ID NO:11)；caacagacagcaaaaatccc(SEQ ID NO:12)；tcgaacagcatgttccccac(SEQ ID NO:13)；gaccctatatatacagggac(SEQ ID NO:14)；gcgggagaagagggaagaag(SEQ ID NO:15)；cctggctgctgcgtctcgct(SEQ ID NO:16)；ccccacttcggtctccgcct(SEQ ID NO:17)；ggtgcgtccgaggaagaggc(SEQ ID NO:18)；gcgtcggagtggaacagcct(SEQ ID NO:19)；ggtctgcaaccaaaggtggt(SEQ ID NO:20)；ggtctgtatatataaagtca(SEQ ID NO:21)；ctcccgccctccagacgcac(SEQ ID NO:22)；gtgtctctgtgtatgagtca(SEQ ID NO:23)；tgcatcccgtgcatgaaaac(SEQ ID NO:24)；gggtaaccacgtgatgcccc(SEQ ID NO:25)；tgatgcggagagggggcggc(SEQ ID NO:26)；cgtgctgtccgcctcggagg(SEQ ID NO:27)；gaggccgccgaggacgtcag(SEQ ID NO:28)；ttacccgcggtctcggggag(SEQ ID NO:29)；ccccacccccctagatgcgt(SEQ ID NO:30)；ctctgttgtttgcaaggggg(SEQ ID NO:31)；gaagagggaagaagaggggt(SEQ ID NO:32)；gggggagtcgctgatcacta(SEQ ID NO:33)；gcaccctgctccccgagacc(SEQ ID NO:34)；cggaagtccagggcgcccac(SEQ ID NO:35)；gatagtgggcgtgacgccca(SEQ ID NO:36)；ggcgaccccgggccctgcgt(SEQ ID NO:37)；gtctgggggtcgttcacgat(SEQ ID NO:38)；tgcatccaggttttcatgca(SEQ ID NO:39)；tcgtccgtggtgggctccgg(SEQ ID NO:40)；tccctgtatatatagtgtca(SEQ ID NO:41)；cacaacaaacacacagggac(SEQ ID NO:42)；gggaaaaaaggggggcgggt(SEQ ID NO:43)；ggggcgtctggcccctccgg(SEQ ID NO:44)；gggacgcgtggactgggggg(SEQ ID NO:45)；acccggagcccaccacggac(SEQ ID NO:46)；ccctaataaaaaaaaactca(SEQ ID NO:47)；tgggggcggccctcaggccg(SEQ ID NO:48)；ccccggccctgagtcggagg(SEQ ID NO:49)；tccctgtatatatagggtca(SEQ ID NO:50)；gccctcaccgtgtgcccccc(SEQ ID NO:51)；ccactccgacgcgggggccg(SEQ ID NO:52)；acggcctcctcggcctccat(SEQ ID NO:53)；atgttccccgtctccatgtc(SEQ ID NO:54)；cccggctcccgtgtatgagt(SEQ ID NO:55)；gcgacgtgtgcgccgtgtgc(SEQ ID NO:56)；atggcgcccggctcccgtgt(SEQ ID NO:57)；gggggcgcccccgcaactgc(SEQ ID NO:58)；atgggggtcgtatgcggctg(SEQ ID NO:59)；ccctectcctcctcctcccc(SEQ ID NO:60)；gtgggggcgtgtctctgtgt(SEQ ID NO:61)；ccggggaccgcggcccgcag(SEQ ID NO:62)；gtcgcggacggagggtccct(SEQ ID NO:63)；gggggcgggtaagaatgggg(SEQ ID NO:64)；cctgtggggagaggccgggg(SEQ ID NO:65)；ccttagcccgccccggatgt(SEQ ID NO:66)；aggggccatgtgtatgtgtt(SEQ ID NO:67)；atggcggccggttccagtgt(SEQ ID NO:68)；cggctggagggtcgcggacg(SEQ ID NO:69)；aggtggtctgggtccgtcct(SEQ ID NO:70)；cctatgttttccctcgtc(SEQ ID NO:71)；ccggttccagtgtaagggtc(SEQ ID NO:72)；gctccggggcggggctccat(SEQ ID NO:73)；cctcggaagaggggggagaa(SEQ ID NO:74)；gaccccggtccctgtatata(SEQ ID NO:75)；ctggccgcgcccccccggcc(SEQ ID NO:76)；gggggggttggggttggggt(SEQ ID NO:77)；ggggaggggggggtcgggcg(SEQ ID NO:78)；gggggggagagggggaactc(SEQ ID NO:79)；gcggaagaggcggcccccgc(SEQ ID NO:80)；acgcgctacctgcccatctc(SEQ ID NO:81)；tgagtaaggggggcctgcgt(SEQ ID NO:82)；ggaccgggggcgccatgtta(SEQ ID NO:83)；ccccgtgtttgtggggaggg(SEQ ID NO:84)；atcctcgtccgtggtgggct(SEQ ID NO:85)；tctggcccctccgggggggt(SEQ ID NO:86)；aggaggagggggggggaggg(SEQ ID NO:87)；ccacggccgcgcgggggcgc(SEQ ID NO:88)；gctcgggggggccgggcgtg(SEQ ID NO:89)；cctccagacgcaccggagtc(SEQ ID NO:90)；cgccccctgctccccggacc(SEQ ID NO:91)；ctcggcctccatgcgggtct(SEQ ID NO:92)；gggaccggggtcgccctgtt(SEQ ID NO:93)；ccctccgggggggttggggt(SEQ ID NO:94)；ggctgctggggccgcagggc(SEQ ID NO:95)；cagggccgggggggcgcggc(SEQ ID NO:96)。

exemplary PAM sequences used with gRNA SEQ ID NOs 1 to 96:

gcgagt(SEQ ID NO:97)；cggagt(SEQ ID NO:98)；gcgggt(SEQ ID NO:99)；acgagt(SEQ ID NO:100)；acggat(SEQ ID NO:101)；gggggt(SEQ ID NO:102)；cagagt(SEQ ID NO:103)；acgagt(SEQ ID NO:104)；gcgggt(SEQ ID NO:105)；cggggt(SEQ ID NO:106)；ccggat(SEQ ID NO:107)；ctgagt(SEQ ID NO:108)；gggggt(SEQ ID NO:109)；cggggt(SEQ ID NO:110)；aggggt(SEQ ID NO:111)；ccgagt(SEQ ID NO:112)；cagagt(SEQ ID NO:113)；gcgggt(SEQ ID NO:114)；ctggat(SEQ ID NO:115)；ctgggt(SEQ ID NO:116)；gggggt(SEQ ID NO:117)；cggagt(SEQ ID NO:118)；gggggt(SEQ ID NO:119)；ctggat(SEQ ID NO:120)；ccgagt(SEQ ID NO:121)；ccgagt(SEQ ID NO:122)；cggagt(SEQ ID NO:123)；gggggt(SEQ ID NO:124)；cagggt(SEQ ID NO:125)；gtgagt(SEQ ID NO:126)；gcgggt(SEQ ID NO:127)；cgggat(SEQ ID NO:128)；tggggt(SEQ ID NO:129)；gcgggt(SEQ ID NO:130)；tagggt(SEQ ID NO:131)；gcgggt(SEQ ID NO:132)；ctgagt(SEQ ID NO:133)；cgggat(SEQ ID NO:134)；cgggat(SEQ ID NO:135)；gtgggt(SEQ ID NO:136)；cggggt(SEQ ID NO:137)；cggggt(SEQ ID NO:138)；aagaat(SEQ ID NO:139)；gggggt(SEQ ID NO:140)；aggggt(SEQ ID NO:141)；gaggat(SEQ ID NO:142)；ggggat(SEQ ID NO:143)；gcgggt(SEQ ID NO:144)；gggggt(SEQ ID NO:145)；gggggt(SEQ ID NO:146)；cagggt(SEQ ID NO:147)；tcgggt(SEQ ID NO:148)；gcgggt(SEQ ID NO:149)；caggat(SEQ ID NO:150)；gggggt(SEQ ID NO:151)；acggat(SEQ ID NO:152)；atgagt(SEQ ID NO:153)；cggggt(SEQ ID NO:154)；gagggt(SEQ ID NO:155)；cagggt(SEQ ID NO:156)；atgagt(SEQ ID NO:157)；ccgggt(SEQ ID NO:158)；gggggt(SEQ ID NO:159)；ggggat(SEQ ID NO:160)；gggagt(SEQ ID NO:161)；ctgggt(SEQ ID NO:162)；gggggt(SEQ ID NO:163)；aagggt(SEQ ID NO:164)；gagggt(SEQ ID NO:165)；ttggat(SEQ ID NO:166)；ccgggt(SEQ ID NO:167)；gggggt(SEQ ID NO:168)；gggggt(SEQ ID NO:169)；aggggt(SEQ ID NO:170)；tagggt(SEQ ID NO:171)；ctgagt(SEQ ID NO:172)；tggggt(SEQ ID NO:173)；ctgggt(SEQ ID NO:174)；gtgggt(SEQ ID NO:175)；gggggt(SEQ ID NO:176)；gggggt(SEQ ID NO:177)；atgagt(SEQ ID NO:178)；gggggt(SEQ ID NO:179)；gggggt(SEQ ID NO:180)；ccgggt(SEQ ID NO:181)；tggggt(SEQ ID NO:182)；aggaat(SEQ ID NO:183)；gcgggt(SEQ ID NO:184)；gagggt(SEQ ID NO:185)；gggggt(SEQ ID NO:186)；SEQ ID NO:187)；acgggt(SEQ ID NO:188)；gggggt(SEQ ID NO:189)；gggggt(SEQ ID NO:190)；tggggt(SEQ ID NO:191)；gtggat(SEQ ID NO:192)；cagggt(SEQ ID NO:193)。

exemplary gRNA nucleotide sequences for targeting the UL56 gene include:

ccgcgctccataaacccgcg(SEQ ID NO:194)；ctggtttccggaagaaacag(SEQ ID NO:195)；cacggacaacaggggcccag(SEQ ID NO:196)；gcttaccgccacaggaatac(SEQ ID NO:197)；ccctctccggaggaggttgg(SEQ ID NO:198)；ttgggccctgtacagctcgc(SEQ ID NO:199)；acaagaggtcccttgtgatg(SEQ ID NO:200)；caagctatcgtaggggggcg(SEQ ID NO:201)；ccgaacgacgtgcgcagcgc(SEQ ID NO:202)；cacgacagtggcataggttg(SEQ ID NO:203)；acaggggcgcttaccgccac(SEQ ID NO:204)；ctgtggcggtaagcgcccct(SEQ ID NO:205)；gcgccggagttttggccctg(SEQ ID NO:206)；cccagcagagtacggtggag(SEQ ID NO:207)；cctaggaggccgccacgcgc(SEQ ID NO:208)；tacggtggaggtgggtccgt(SEQ ID NO:209)；cggaggcggcgcaacccgac(SEQ ID NO:210)；gtgtggcgccatgctgtatt(SEQ ID NO:211)；tcgggcgcgtggcggcctcc(SEQ ID NO:212)。

PAM sequences for use with SEQ ID NOs 194 to 212 include:

tcgggt(SEQ ID NO:213)；gggggt(SEQ ID NO:214)；cagagt(SEQ ID NO:215)；cagaat(SEQ ID NO:216)；cggaat(SEQ ID NO:217)；gcgaat(SEQ ID NO:218)；tcgggt(SEQ ID NO:219)；ggggat(SEQ ID NO:220)；cggagt(SEQ ID NO:221)；gggggt(SEQ ID NO:222)；aggaat(SEQ ID NO:223)；gtgagt(SEQ ID NO:224)；gcgggt(SEQ ID NO:225)；gtgggt(SEQ ID NO:226)；ccgagt(SEQ ID NO:227)；gggggt(SEQ ID NO:228)；gcgggt(SEQ ID NO:229)；tggggt(SEQ ID NO:230)；tagggt(SEQ ID NO:231)。

off-target gRNA sequence for 110:

cagcactgcataaaccctcg(SEQ ID NO:232)；ccgctttccgtaaacccggg(SEQ ID NO:233)；ccgcggttcctaaaaccgcg(SEQ ID NO:234)；ccgggctccctgaactcgcg(SEQ ID NO:235)；gcgggctccataaagccccg(SEQ ID NO:236)；ccggggtccataaaccctct(SEQ ID NO:237)；ccacgctccatcaaccctcc(SEQ ID NO:238)；ccgagctccatctacccacg(SEQ ID NO:239)；ccgccctccacagacacgcg(SEQ ID NO:240)；ccgcactccatgcacgcgcg(SEQ ID NO:241)；ccgccctccagaaagccccg(SEQ ID NO:242)；ccgcgctcccaaaagccccg(SEQ ID NO:243)。

PAM sequences for use with SEQ ID NOs 232 to 231 include:

cagga(SEQ ID NO:244)；ccggg(SEQ ID NO:245)；gtgaa(SEQ ID NO:246)；ccggg(SEQ ID NO:247)；ctgga(SEQ ID NO:248)；gggaa(SEQ ID NO:249)；ctgaa(SEQ ID NO:250)；ccgag(SEQ ID NO:251)；cgggg(SEQ ID NO:252)；atggg(SEQ ID NO:253)；cgggg(SEQ ID NO:254)；gcggg(SEQ ID NO:255)。

off-target gRNA sequence for 417:

ctcctttccagaagaaacag(SEQ ID NO:256)；ctggtttctgtaagaaacag(SEQ ID NO:257)；ctcctttctggaagaaacag(SEQ ID NO:258)；gtggtttccaaaagaaacag(SEQ ID NO:259)；taagtttcctgaagaaacag(SEQ ID NO:260)；gttttttcctgaagaaacag(SEQ ID NO:261)；ctgtatttcagaagaaacag(SEQ ID NO:262)；atgtttcccagaagaaacag(SEQ ID NO:263)；gttgtttgaggaagaaacag(SEQ ID NO:264)；aagatttcaggaagaaacag(SEQ ID NO:265)；ctcgctacctgaagaaacag(SEQ ID NO:266)；attctttctggaagaaacag(SEQ ID NO:267)；ctggcttcggcaagaaacag(SEQ ID NO:268)；caggtttctggaagaatcag(SEQ ID NO:269)；ctggcttctggaagaagcag(SEQ ID NO:270)；ctggattcctgaaggaacag(SEQ ID NO:271)；ttggtttgctgaagaaacgg(SEQ ID NO:272)；ctgtttaagggaagaaacag(SEQ ID NO:273)；gtgatttctgcaagaaacag(SEQ ID NO:274)；ctagcagccggaagaaacag(SEQ ID NO:275)；atagtttctgaaagaaacag(SEQ ID NO:276)；ttggtttatgaaagaaacag(SEQ ID NO:277)；cttgtatggggaagaaacag(SEQ ID NO:278)；cttttgtcaggaagaaacag(SEQ ID NO:279)；ctgccctctggaagaaacag(SEQ ID NO:280)；ctcatttctggaagaaacaa(SEQ ID NO:281)；ctggttaggagaagaaacag(SEQ ID NO:282)；ctgccttctggaagaaacaa(SEQ ID NO:283)；ctgatttaggaaagaaacag(SEQ ID NO:284)；cttgtttttgggagaaacag(SEQ ID NO:285)；cttgttttggggagaaacag(SEQ ID NO:286)；ctgctttgagggagaaacag(SEQ ID NO:287)；atggtttcatgtagaaacag(SEQ ID NO:288)；catgtttcaggaagaatcag(SEQ ID NO:289)；ttggtttacagaaggaacag(SEQ ID NO:290)；ctggtgtcccgaagtaacag(SEQ ID NO:291)；ctggtttgtaaaagaaacag(SEQ ID NO:292)；ttgttttcaggaggaaacag(SEQ ID NO:293)；ctggcttccctaagaaacaa(SEQ ID NO:294)；caggtttgaggacgaaacag(SEQ ID NO:295)；gtggattcctgaagaaaaag(SEQ ID NO:296)；ctgcttttaggaggaaacag(SEQ ID NO:297)；cgggcttcctgaagaaagag(SEQ ID NO:298)；ctggtgcgaggaagaaacag(SEQ ID NO:299)；ctgcattccagaagaaaaag(SEQ ID NO:300)；atggtttcctgaagaatcaa(SEQ ID NO:301)；ctgatttacagaagaaaaag(SEQ ID NO:302)；ctgttttactgaagaaagag(SEQ ID NO:303)；gtgatttccagaagacacag(SEQ ID NO:304)；gtggtgtctggcagaaacag(SEQ ID NO:305)。

PAM sequences for use with SEQ ID NOs 256 to 305 include:

tagaa(SEQ ID NO:306)；cagga(SEQ ID NO:307)；tggga(SEQ ID NO:308)；atgag(SEQ ID NO:309)；taggg(SEQ ID NO:310)；caggg(SEQ ID NO:311)；tcgaa(SEQ ID NO:312)；aagag(SEQ ID NO:313)；aagga(SEQ ID NO:314)；aagga(SEQ ID NO:315)；gaga(SEQ ID NO:316)；caggg(SEQ ID NO:317)；gagag(SEQ ID NO:318)；aagaa(SEQ ID NO:319)；agggg(SEQ ID NO:320)；tagga(SEQ ID NO:321)；tggaa(SEQ ID NO:322)；caggg(SEQ ID NO:323)；ctgaa(SEQ ID NO:324)；ttgaa(SEQ ID NO:325)；aagaa(SEQ ID NO:326)；cggag(SEQ ID NO:327)；tagaa(SEQ ID NO:328)；ctgaa(SEQ ID NO:329)；aagag(SEQ ID NO:330)；gaggg(SEQ ID NO:331)；gaga(SEQ ID NO:332)；aagaa(SEQ ID NO:333)；gaga(SEQ ID NO:334)；aaggg(SEQ ID NO:335)；cagaa(SEQ ID NO:336)；ttgaa(SEQ ID NO:337)；tagaa(SEQ ID NO:338)；ttggg(SEQ ID NO:339)；aagaa(SEQ ID NO:340)；cagag(SEQ ID NO:341)；cagga(SEQ ID NO:342)；tggga(SEQ ID NO:343)；tggaa(SEQ ID NO:344)；ctggg(SEQ ID NO:345)；ctggg(SEQ ID NO:346)；cagga(SEQ ID NO:347)；gaga(SEQ ID NO:348)；gggag(SEQ ID NO:349)；aagga(SEQ ID NO:350)；tagaa(SEQ ID NO:351)；aagga(SEQ ID NO:352)；aaggg(SEQ ID NO:353)；aggga(SEQ ID NO:354)；caggg(SEQ ID NO:355)。

in certain embodiments, the sequence of the gRNA that is substantially complementary to the target is about 10 to 30 nucleotides in length. In certain embodiments, the gRNA comprises a nucleotide sequence that binds to a target sequence of the HSV genome. For example, in certain embodiments, the gRNA comprises a nucleotide sequence that is substantially complementary to and thus binds to a target sequence. For example, in certain embodiments, the gRNA is substantially complementary to a target sequence of an HSV genome selected from the group consisting of:

TCTGGGTGTTTCCCTGCGACCGAGACCTGC(SEQ ID NO:356，“2A”)；

GGACAGCACGGACACGGAACTGTTCGAGACG(SEQ ID NO:357，“2B”)；

GCATCCCGTGCATGAAAACC(SEQ ID NO:358，“2C”)；

TGTGCAACGCCAAGCTGGTGTACCTGATAG-3'(SEQ ID NO:359，“2D”)；

GCGAGTACCCGCCGGCCTGA(SEQ ID NO:360，“1”)；

GCGAGCCGCGGCGCCGCGGG(SEQ ID NO:361，“3”)；

TTCTACGCGCGCTATCGCGA(SEQ ID NO:362，“ICP4 ml”)；

GGAGTGTTCCTCGTCGGACG(SEQ ID NO:363，“ICP27 ml”)

in certain embodiments, the target sequence precedes the PAM sequence. For example, in some embodiments, the target sequence precedes the NGG PAM sequence. Exemplary target sequences + PAM sequences (PAM sequences underlined) are as follows:

TCTGGGTGTTTCCCTGCGACCGAGACCTGCCGG(SEQ ID NO:364，“2A”)；

GGACAGCACGGACACGGAACTGTTCGAGACGGGG(SEQ ID NO:365，“2B”)；

GCATCCCGTGCATGAAAACCTGG(SEQ ID NO:366，“2C”)；

TGTGCAACGCCAAGCTGGTGTACCTGATAGTGG(SEQ ID NO:367，“2D”)；

GCGAGTACCCGCCGGCCTGAGGG(SEQ ID NO:368，“1”)；

GCGAGCCGCGGCGCCGCGGGGGG(SEQ ID NO:369，“3”)；

TTCTACGCGCGCTATCGCGACGG(SEQ ID NO:370，“ICP4 ml”)；

GGAGTGTTCCTCGTCGGACGAGG(SEQ ID NO:371，“ICP27 ml”)；

GTACCCGACGGCCCCCGCGTCGGAGT(SEQ ID NO:372，“ICP0-M1”)；

CTCAGGCCGCGAACCAAGAACAGAGT(SEQ ID NO:373，“ICP0-M2”)；

AATCCTAGACACGCACCGCCAGGAGT(SEQ ID NO:374，“ICP27-M1”)；

TCGCCAGCGTCATTAGCGGGGGGGGT(SEQ ID NO:375，“ICP27-M2”)；

AATCCTAGACACGCACCGCC(SEQ ID NO:376，“ICP27-M1”)；

TCGCCAGCGTCATTAGCGGG(SEQ ID NO:377，“ICP27-M2”)

Furthermore, the disclosure encompasses isolated nucleic acids (e.g., grnas) having substantial homology to the nucleic acids disclosed herein. In certain embodiments, the isolated nucleic acid has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence homology to a nucleotide sequence of a gRNA described elsewhere herein.

The guide RNA sequence may be a sense sequence or an antisense sequence. In CRISPR-Cas systems derived from streptococcus pyogenes, the target DNA is typically located before and immediately adjacent to the 5' -NGG pre-spacer adjacent motif (PAM). Other Cas9 orthologs may have different PAM specificities. For example, cas9 from streptococcus thermophilus requires 5' -NNAGAA for CRISPR1 and 5' -NGGNG for CRISPR3, and neisseria meningitidis (Neisseria meningiditis) requires 5' -NNNNGATT. The specific sequence of the guide RNA may vary, but regardless of the sequence, useful guide RNA sequences will be those that minimize off-target effects while achieving efficient mutation of the herpesvirus target sequence. The specific sequence of the guide RNA may vary, but regardless of the sequence, the guide RNA sequences that are available will be those that minimize off-target effects while achieving efficient editing of the HSV genome. The guide RNA sequence can vary in length from about 20 to about 60 or more nucleotides, for example, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 45, about 50, about 55, about 60 or more nucleotides. Available selection methods identify regions of very low homology between the foreign viral genome and the host cell genome, including bioinformatic screening using target sequences+ngg target selection criteria to exclude off-target human transcriptomes or (even rarely) untranslated genomic sites, as well as WGS, sanger sequencing and survayor assays to identify and exclude potential off-target effects. Algorithms such as CRISPR design tools (CRISPR genome engineering resources; read Institute) can be used to identify target sequences with or near the essential PAM sequence, as defined by the type of Cas peptide used (i.e., cas9 variants, cpfl).

In certain embodiments, the composition comprises a plurality of different grnas, each gRNA targeting to a different target sequence. In certain embodiments, this multiple strategy provides increased efficacy. In some embodiments, the compositions described herein utilize from about 1 gRNA to about 6 grnas. In some embodiments, the compositions described herein utilize at least about 1 gRNA. In some embodiments, the compositions described herein utilize up to about 6 grnas. In some embodiments, the compositions described herein utilize from about 1 to about 2 grnas, from about 1 to about 3 grnas, from about 1 to about 4 grnas, from about 1 to about 5 grnas, from about 1 to about 6 grnas, from about 2 to about 3 grnas, from about 2 to about 4 grnas, from about 2 to about 5 grnas, from about 2 to about 6 grnas, from about 3 to about 4 grnas, from about 3 to about 5 grnas, from about 3 to about 6 grnas, from about 4 to about 5 grnas, from about 4 to about 6 grnas, or from about 5 to about 6 grnas. In some embodiments, the compositions described herein utilize about 1 gRNA, about 2 grnas, about 3 grnas, about 4 grnas, about 5 grnas, or about 6 grnas.

In certain embodiments, the RNA (e.g., crRNA, tracrRN, gRNA) can be engineered to comprise one or more modified nucleobases. Known modifications of RNA can be found, for example, in Genes VI, chapter 9 ("Interpreting the Genetic Code"), lewis et al (1997,Oxford University Press,New York) and Modification and Editing of RNA, grosjean and Benne et al (1998,ASM Press,Washington DC). The modified RNA component included the following: 2' -O-methylcytidine; n4-methylcytidine; n4-2' -O-dimethylcytidine; n4-acetylcytidine; 5-methylcytidine; 5,2' -O-dimethylcytidine; 5-hydroxymethylcytosine; 5-formyl cytidine; 2' -O-methyl-5-formylcytidine; 3-methylcytidine; 2-thiocytidine; lai Baogan; 2' -O-methyluridine; 2-thiouridine; 2-thio-2' -O-methyluridine; 3,2' -O-dimethyluridine; 3- (3-amino-3-carboxypropyl) uridine; 4-thiouridine; ribosyl thymidine; 5,2' -O-dimethyluridine; 5-methyl-2-thiouridine; 5-hydroxyuridine; 5-methoxyuridine; uridine-5-oxyacetic acid; uridine-5-oxoacetic acid methyl ester; 5-carboxymethyl uridine; 5-methoxycarbonylmethyluridine; 5-methoxycarbonylmethyl-2' -O-methyluridine; 5-methoxycarbonylmethyl-2' -thiouridine; 5-carbamoyl methyluridine; 5-carbamoylmethyl-2' -O-methyluridine; 5- (carboxyhydroxymethyl) uridine; 5- (carboxyhydroxymethyl) uridine methyl ester; 5-aminomethyl-2-thiouridine; 5-methylaminomethyl uridine; 5-methylaminomethyl-2-thiouridine; 5-methylaminomethyl-2-selenocysteine; 5-carboxymethyl aminomethyluridine; 5-carboxymethyl aminomethyl-2' -O-methyl-uridine; 5-carboxymethyl aminomethyl-2-thiouridine; dihydrouridine; dihydroribosyl thymine; 2' -methyladenosine; 2-methyladenosine; N6N-methyladenosine; n6, N6-dimethyl adenosine; n6,2' -O-trimethyladenosine; 2-methyl-N6N-isopentenyl adenosine; n6- (cis-hydroxyisopentenyl) -adenosine; 2-methylsulfanyl-N6- (cis-hydroxyisopentenyl) -adenosine; n6-glycidylcarbamoyl) adenosine; n6-threonyl carbamoyl adenosine; N6-methyl-N6-threonyl carbamoyl adenosine; 2-methylsulfanyl-N6-methyl-N6-threonyl carbamoyl adenosine; n6-hydroxy N-valylcarbamoyladenosine; 2-methylsulfanyl-N6-hydroxy N-valylcarbamoyladenosine; 2' -O-ribosyl adenosine (phosphate); inosine; 2' o-methyl inosine; 1-methyl inosine; 1,2' -O-dimethylinosine; 2' -O-methylguanosine; 1-methylguanosine; n2-methylguanosine; n2, N2-dimethylguanosine; n2,2' -O-dimethylguanosine; n2,2' -O-trimethylguanosine; 2' -O-ribosyl guanosine (phosphate); 7-methylguanosine; n2, 7-dimethylguanosine; n2, 7-trimethylguanosine; huai Russian glycoside (wyosine); methyl huadin; an undermodified hydroxyl Huai Dinggan; huai Dinggan (wybutosine); hydroxyl Huai Dinggan; peroxy Huai Dinggan; pigtail glycoside (queuosine); epoxy braids; galactosyl-pigtail glycoside; mannosyl-pigtail glycoside; 7-cyano-7-deazaguanosine; archaurin (arahaeosine) [ also known as 7-carboxamido-7-deazaguanosine ]; and 7-aminomethyl-7-deazaguanosine. The methods of the present disclosure or other methods in the art can be used to identify additional modified RNAs.

In some embodiments, the gRNA is a synthetic oligonucleotide. In some embodiments, the synthetic nucleotide comprises a modified nucleotide. Modifications of internucleoside linkers (e.g., backbones) can be used to increase stability or pharmacodynamic properties. For example, internucleoside linker modifications prevent or reduce degradation by cellular nucleases, thereby increasing pharmacodynamics and bioavailability of gRNA. Typically, modified internucleoside linkers include any linker other than a Phosphodiester (PO) linker that covalently couples two nucleosides together. In some embodiments, the modified internucleoside linker increases nuclease resistance of the gRNA compared to the phosphodiester linker. For naturally occurring oligonucleotides, the internucleoside linker comprises a phosphate group that creates a phosphodiester linkage between adjacent nucleosides. In some embodiments, the gRNA comprises one or more internucleoside linkers modified from a natural phosphodiester. In some embodiments, all of the internucleoside linkers of the gRNA, or consecutive nucleotide sequences thereof, are modified. For example, in some embodiments, the internucleoside linkage comprises sulfur (S), such as a phosphorothioate internucleoside linkage.

Modifications to ribose sugar or nucleobases may also be used herein. Typically, the modified nucleoside includes the introduction of one or more modifications to the sugar moiety or nucleobase moiety. In some embodiments, a gRNA as described comprises one or more nucleosides that comprise a modified sugar moiety, wherein the modified sugar moiety is a modification to the sugar moiety when compared to ribose sugars found in deoxyribonucleic acid (DNA) and RNA. A variety of nucleosides with modifications of the ribose moiety can be utilized, primarily for the purpose of improving certain properties of the oligonucleotide, such as affinity and/or stability. Such modifications include those in which the ribose ring structure is modified. These modifications include substitution with: sugar rings (HNAs), bicyclic rings with a two-group bridge between the C2 carbon and the C4 carbon on the ribose ring (e.g., locked Nucleic Acids (LNAs)), or unlinked ribose rings that typically lack a bond between the C2 carbon and the C3 carbon (e.g., UNAs). Other sugar modified nucleosides include, for example, dicyclohexyl nucleic acids or tricyclic nucleic acids. Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, for example, in the case of Peptide Nucleic Acids (PNAs) or morpholino nucleic acids.

Sugar modification also includes modification by changing substituents on the ribose ring to groups other than hydrogen or the 2' -OH group found naturally in DNA and RNA nucleosides. Substituents may be introduced, for example, at the 2', 3', 4 'or 5' positions. Nucleosides having modified sugar moieties also include 2 '-modified nucleosides, such as 2' -substituted nucleosides. In fact, efforts have been directed to developing 2 '-substituted nucleosides and a number of 2' -substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity. A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or-OH (a 2' -substituted nucleoside) or comprises a 2' -linked diradical at the 2' position and includes a 2' substituted nucleoside and an LNA (2 ' -4' diradical bridged) nucleoside. Examples of 2 '-substituted modified nucleosides are 2' -O-alkyl-RNA, 2 '-O-methyl-RNA, 2' -alkoxy-RNA, 2 '-O-methoxyethyl-RNA (MOE), 2' -amino-DNA, 2 '-fluoro-RNA and 2' -F-ANA nucleosides. Further by way of example, in some embodiments, the modification in the ribose group comprises a modification at the 2' position of the ribose group. In some embodiments, the modification at the 2' position of the ribose group is selected from the group consisting of 2' -O-methyl, 2' -fluoro, 2' -deoxy, and 2' -O- (2-methoxyethyl).

In some embodiments, the RNA comprises one or more modified sugars. In some embodiments, the gRNA comprises only modified sugars. In certain embodiments, the gRNA comprises more than 10%, 25%, 50%, 75% or 90% modified sugar. In some embodiments, the modified sugar is a bicyclic sugar. In some embodiments, the modified sugar comprises 2' -O-methoxyethyl. In some embodiments, the gRNA comprises both an internucleoside linker modification and a nucleoside modification.

Target specificity may be used with reference to a guide RNA or crRNA specific for a target polynucleotide sequence or region (e.g., ICP0 or ICP27 gene of the herpesvirus genome), and further includes a nucleotide sequence of a target (sequence or region) such as DNA that is capable of selectively annealing/hybridizing to a target polynucleotide (e.g., corresponding to the target). In some embodiments, the crRNA or derivative thereof contains a target specific nucleotide region complementary to a region of the target DNA sequence. In some embodiments, the rRNA or derivative thereof contains other nucleotide sequences in addition to the target-specific nucleotide region. In some embodiments, the additional nucleotide sequence is from a tracrRNA sequence.

grnas are typically supported by a scaffold, where scaffold refers to a portion of a gRNA or crRNA molecule that comprises sequences that are substantially identical or highly conserved across a native biological species (e.g., do not confer target specificity). The scaffold includes a tracrRNA segment

The portions of the crRNA segment other than the polynucleotide targeting guide sequence located at or near the 5' end of the crRNA segment exclude any non-native portions comprising sequences that are not conserved in the native crRNA and tracrRNA. In some embodiments, the crRNA or tracrRNA comprises a modified sequence. In certain embodiments, the crRNA or tracrRNA comprises at least 1, 2, 3, 4, 5, 10, or 15 modified bases (e.g., modified native base sequences).

As used herein, complementary generally refers to polynucleotides comprising nucleotide sequences that are capable of selectively annealing to an identified region of a target polynucleotide under certain conditions. As used herein, the term "substantially complementary" and grammatical equivalents are intended to mean that a polynucleotide includes a nucleotide sequence that is capable of specifically annealing to an identified region of a target polynucleotide under certain conditions. Annealing refers to the nucleotide base pairing interaction of one nucleic acid with another nucleic acid, which results in the formation of a duplex, triplex, or other higher order structure. The primary interactions are typically nucleotide base specific, e.g., A: T, A: U and G: C, by Watson-Crick and Hoogsteen type hydrogen bonding. In some embodiments, the base stack and hydrophobic interactions may also contribute to duplex stability. The polynucleotide anneals to the complement or substantial complementarity of the target nucleic acid under conditions well known in the art, e.g., as described in Nucleic Acid Hybridization, A Practical Approach, hames and Higgins, eds., IRL Press, washington, d.c. (1985) and Wetmur and Davidson, mol. Biol.31:349 (1968). Annealing conditions will depend on the particular application and can be routinely determined by one skilled in the art without undue experimentation. Hybridization generally refers to a process in which two single-stranded polynucleotides non-covalently bind to form a stable double-stranded polynucleotide. The resulting double-stranded polynucleotide is a "hybrid" or "duplex". In some cases, hybridization does not require 100% sequence identity, and in some embodiments hybridization occurs at about greater than 70%, 75%, 80%, 85%, 90% or 95% sequence identity. In certain embodiments, sequence identity includes sequences comprising insertions and/or deletions in addition to non-identical nucleobases.

The nucleic acids of the disclosure, including RNA (e.g., crRNA, tracrRNA, gRNA) or nucleic acids encoding the RNA, can be produced by standard techniques. For example, polymerase Chain Reaction (PCR) techniques can be used to obtain an isolated nucleic acid comprising a nucleotide sequence described herein, including a nucleotide sequence encoding a polypeptide described herein. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Various PCR methods are described, for example, in PCR Primer A Laboratory Manual, 2 nd edition, code Dieffenbach and Dveksler, cold Spring Harbor Laboratory Press, 2003. Typically, sequence information from the end of the region of interest or beyond is used to design oligonucleotide primers that are identical or similar in sequence to the opposite strand of the template to be amplified. Various PCR strategies are also available by which site-specific nucleotide sequence modifications can be introduced into a template nucleic acid.

Isolated nucleic acids may also be synthesized chemically as a single nucleic acid (e.g., synthesized using the phosphoramidite technique in the 3 'to 5' direction using automated DNA synthesis) or as a series of oligonucleotides. The isolated nucleic acids of the present disclosure may also be obtained by mutagenesis of naturally occurring portions of DNA encoding, for example, crRNA, tracrRNA, RNA or Cas 9.

In certain embodiments, the isolated RNA is synthesized from an expression vector encoding an RNA molecule as described in detail elsewhere herein.

Nucleic acids and vectors

In some embodiments, the compositions of the present disclosure comprise an isolated nucleic acid encoding one or more elements of the ISPR-Cas system described herein. For example, in some embodiments, the composition comprises an isolated nucleic acid encoding at least one guide nucleic acid (e.g., RNA). In some embodiments, the composition comprises an isolated nucleic acid encoding a Cas peptide or a functional fragment or derivative thereof. In some embodiments, the composition comprises an isolated nucleic acid encoding at least one guide nucleic acid (e.g., gRNA) and encoding a Cas peptide or a functional fragment or derivative thereof. In some embodiments, the composition comprises an isolated nucleic acid encoding at least one guide nucleic acid (e.g., a gRNA), and further comprises an isolated nucleic acid encoding a Cas peptide or a functional fragment or derivative thereof.

In some embodiments, the composition comprises at least one isolated nucleic acid encoding a gRNA, wherein the gRNA is substantially complementary to a target sequence of the HSV genome, as described elsewhere herein. In some embodiments, the composition comprises at least one isolated nucleic acid encoding a gRNA, wherein the gRNA is complementary to a target sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence homology to a target sequence described herein.

In some embodiments, the composition comprises at least one isolated nucleic acid encoding a Cas peptide or a functional fragment or derivative thereof as described elsewhere herein. In some embodiments, the composition comprises at least one isolated nucleic acid encoding a Cas peptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence homology to a Cas peptide described elsewhere herein.

The isolated nucleic acid may include any type of nucleic acid including, but not limited to, DNA and RNA. For example, in some embodiments, the composition comprises isolated DNA, including, for example, isolated cDNA encoding a gRNA or peptide of the disclosure, or a functional fragment thereof. In some embodiments, the composition comprises an isolated RNA encoding a peptide of the disclosure, or a functional fragment thereof. The isolated nucleic acid may be synthesized using any method known in the art.

The disclosure may include the use of vectors having inserted therein the isolated nucleic acids described herein. The art is well within the scope of suitable carriers that can be used in the present disclosure. Vectors include, for example, viral vectors such as adenoviruses ("Ad"), adeno-associated viruses (AAV) and Vesicular Stomatitis Viruses (VSV) and retroviruses, liposomes and other lipid-containing complexes, and other macromolecular complexes capable of receiving delivery of polynucleotides to host cells. The vector may also comprise other components or functions that further regulate gene delivery and/or gene expression, or otherwise provide beneficial properties to the targeted cells. Such other components include, for example, components that affect binding or targeting to cells (including components that mediate cell type or tumor specific binding); a component that affects uptake of the vector nucleic acid by the cell; components that affect the localization of polynucleotides within cells after uptake (such as agents that mediate nuclear localization); and components that affect the expression of the polynucleotide. Such components may also include markers, such as detectable and/or selectable markers, that can be used to detect or select cells that have ingested and are expressing the nucleic acid delivered by the vector. Such components may be provided as a natural feature of the vector (such as using certain types of vectors having components or functionalities that mediate binding and uptake), or the vector may be modified to provide such functionalities. Other vectors include those described by Chen et al; bioTechniques,34:167-171 (2003). A wide variety of such vectors are known in the art and are generally available.

Briefly summarized, expression of a natural or synthetic nucleic acid encoding an RNA and/or peptide is typically achieved by operably linking the nucleic acid encoding the RNA and/or peptide, or a portion thereof, to a promoter, and incorporating the construct into an expression vector. The vector to be used is suitable for replication and optionally for integration in eukaryotic cells. Typical vectors contain transcriptional and translational terminators, promoter sequences, and promoters useful for regulating expression of the desired nucleic acid sequence.

Vectors of the present disclosure may also be used for nucleic acid immunization and gene therapy, using standard gene delivery protocols. Methods for gene delivery are known in the art. See, for example, U.S. Pat. nos. 5,399,346, 5,580,859, 5,589,466, which are incorporated herein by reference in their entireties. In another embodiment, the present disclosure provides a gene therapy vector.

The isolated nucleic acids of the present disclosure can be cloned into a variety of types of vectors. For example, the nucleic acid may be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses and cosmids. Specific targeting vectors include expression vectors, replication vectors, probe production vectors, and sequencing vectors.

Furthermore, the vector may be provided to the cells in the form of a viral vector. Viral vector techniques are well known in the art and are described, for example, in Sambrook et al (2001,Molecular Cloning:A Laboratory Manual,Cold Spring Harbor Laboratory,New York) and other virology and molecular biology manuals. Viruses that may be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. In general, suitable vectors contain an origin of replication that is functional in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selectable markers (e.g., WO 01/96584, WO 01/29058, and U.S. Pat. No. 6,326,193).

A number of viral-based vectors have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Selected genes can be inserted into vectors and packaged into retroviral particles using techniques known in the art. The recombinant virus may then be isolated and delivered to cells of the subject in vivo or ex vivo. A number of retroviral systems are known in the art. In some embodiments, an adenovirus vector is used. A large number of adenoviral vectors are known in the art. In some embodiments, lentiviral vectors are used.

For example, vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer, as they allow for long-term, stable integration of transgenes and their transmission in daughter cells. Lentiviral vectors have other advantages over vectors derived from oncogenic retroviruses such as murine leukemia virus, which can transduce non-proliferating cells such as hepatocytes. They also have the additional advantage of low immunogenicity. In some embodiments, the composition comprises a vector derived from an adeno-associated virus (AAV). Adeno-associated virus (AAV) vectors have become powerful gene delivery tools for treating a variety of disorders. AAV vectors possess a number of characteristics that make them ideally suited for use in gene therapy, including lack of pathogenicity, minimal immunogenicity, and the ability to transduce postmitotic cells in a stable and efficient manner. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more cell types by selecting an appropriate combination of AAV serotypes, promoters, and delivery methods.

Further provided are nucleic acids encoding the CRISPR-Cas systems described herein. Provided herein are adeno-associated virus (AAV) vectors comprising nucleic acids encoding CRISPR-Cas systems described herein. In certain instances, AAV vectors include any vector that comprises or is derived from a component of AAV and is suitable for infecting mammalian cells (including human cells) of any of a number of tissue types, such as brain, heart, lung, skeletal muscle, liver, kidney, spleen, or pancreas, whether in vitro or in vivo. In certain instances, the AAV vector comprises an AAV-type viral particle (or virion) comprising a nucleic acid encoding a protein of interest (e.g., a CRISPR-Cas system described herein). In some embodiments, as further described herein, an AAV disclosed herein is derived from a variety of serotypes, including combinations of serotypes (e.g., a "pseudotyped" AAV), or from a variety of genomes (e.g., single stranded or self-complementary). In some embodiments, the AAV vector is a human serotype AAV vector. In such embodiments, the human serotype AAV is derived from any known serotype, e.g., from AAV1, AAV2, AAV4, AAV6, or AAV9. In some embodiments, the serotype is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8.

In some embodiments, the composition comprises a vector derived from an adeno-associated virus (AAV). AAV vectors possess a number of characteristics that make them ideally suited for use in gene therapy, including lack of pathogenicity, minimal immunogenicity, and the ability to transduce postmitotic cells in a stable and efficient manner. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more cell types by selecting an appropriate combination of AAV serotypes, promoters, and delivery methods.

Various AAV capsids have been described and can be used, but AAV that preferentially targets the liver and/or delivers genes with high efficiency is particularly desirable. The sequence of AAV8 can be obtained from a variety of databases. Although the examples utilized AAV vectors with the same capsid, the capsids of the gene editing vector and the AAV targeting vector were the same AAV capsid. Another suitable AAV is, for example, rhlO (WO 2003/042397). Still other AAV sources include, for example, AAV9 (see, e.g., U.S. Pat. No. 7,906,111;US 2011-0236353-Al) and/or hu37 (see, e.g., U.S. Pat. No. 7,906,111;US 2011-0236353-Al), AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8 (U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199, WO 2003/042397; WO 2005/033321, WO 2006/110689; U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199; U.S. Pat. No. 7,588,772). Still other AAV may be selected, optionally taking into account the tissue preference of the AAV capsid selected.

In some embodiments, an AAV vector disclosed herein comprises a nucleic acid encoding a CRISPR-Cas system described herein. In some embodiments, the nucleic acid also includes one or more regulatory sequences that allow expression and, in some embodiments, secretion of a protein of interest, such as a promoter, enhancer, polyadenylation signal, internal ribosome entry site ("IRES"), sequence encoding a protein transduction domain ("PTD"), and the like. Thus, in some embodiments, the nucleic acid comprises a promoter region operably linked to a coding sequence to cause or improve expression of the protein of interest in an infected cell. Such promoters may be ubiquitous, cell or tissue specific, strong, weak, regulated, chimeric, etc., e.g., to allow for efficient and stable production of proteins in infected tissues. In certain embodiments, the promoter is homologous or heterologous to the encoded protein, but the promoter used in the disclosed methods is generally functional in human cells. Examples of regulated promoters include, but are not limited to, promoters containing Tet on/off elements, rapamycin inducible promoters, tamoxifen inducible promoters, and metallothionein promoters. In certain embodiments, other promoters used include promoters that are tissue specific for tissues such as kidney, spleen, and pancreas. Examples of ubiquitous promoters include viral promoters, particularly the CMV promoter, the RSV promoter, the SV40 promoter, and the like, as well as cellular promoters such as the phosphoglycerate kinase (PGK) promoter and the β0 actin promoter.

In some embodiments, the recombinant AAV vector comprises a nucleic acid encapsulated within an AAV capsid, typically comprising a 5'AAV ITR, an expression cassette described herein, and a 3' AAV ITR. In some embodiments, the expression cassettes contain regulatory elements for the open reading frame within each expression cassette, and the nucleic acid optionally contains additional regulatory elements, as described herein. In some embodiments, the AAV vector comprises a full length AAV 5 'Inverted Terminal Repeat (ITR) and a full length 3' ITR. Shorter versions of the 5' ITR, called AITR, have been described in which the D-sequence and terminal dissociation sites (trs) are deleted. The abbreviation "sc" refers to self-complementation. "self-complementary AAV" refers to a construct in which the coding region carried by the recombinant AV nucleic acid sequence has been designed to form an intramolecular double stranded DNA template. Upon infection, the two complementary halves of the scAAV will associate to form a double stranded DNA (dsDNA) unit that replicates and transcribes immediately (see, e.g., D M McCarty et al, "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", gene Therapy, (month 8 2001); see, e.g., U.S. Pat. nos. 6,596,535, 7,125,717 and 7,456,683) instead of waiting for cell-mediated synthesis of the second strand. If a pseudotyped AAV is to be produced, the ITR is selected from a source other than the AAV source of the capsid. For example, in some embodiments, AAV2 ITRs are selected for use with AAV capsids having specific efficiencies against selected cellular receptors, target tissues, or viral targets. In some embodiments, the ITR sequence from AAV2, or a deleted version thereof (AITR), is used for convenience and to speed up regulatory approval (i.e., pseudotyped). In some embodiments, single stranded AAV viral vectors are used.

Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art (see, e.g., U.S. patent No. 7,790,449; U.S. patent No. 7,282,199;WO 2003/042397; WO 2005/033321, WO 2006/110689; and U.S. patent No. 7,588,772B2, U.S. patent nos. 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065). In one system, producer cell lines are transiently transfected with constructs encoding transgenes flanked by ITRs, and one or more constructs encoding reps and caps. In the second system, the encapsulated cell lines stably feeding rep and cap are transfected (transiently or stably) with a transgene encoding an ITR flanking. In each of these systems, AAV virions are produced in response to infection with a helper or herpes virus, requiring separation of the rAAV from contaminating viruses. More recently, systems have been developed that do not require infection with helper virus to restore AAV, i.e., the required helper functions (i.e., adenovirus El, E2a, VA and E4 or herpes viruses UL5, UL8, UL52 and UL29, and herpes virus polymerase) are also supplied in trans by the system. In these new systems, the helper functions may be provided by transient transfection of the cell with a construct that encodes the desired helper function, or the cell may be engineered to stably contain a gene encoding the helper function whose expression may be controlled at the transcriptional or post-transcriptional level. In yet another system, transgenes flanked by ITR and rep/cap genes are introduced into insect cells by transfection with baculovirus-based vectors.

CRISPR-Cas systems such as Cas9, and/or any existing RNAs such as guide RNAs, may be delivered using adeno-associated virus (AAV), lentivirus, adenovirus, or other viral vector types, or combinations thereof. Cas9 and one or more guide RNAs may be packaged in one or more viral vectors. In some embodiments, the viral vector is delivered to the target tissue by, for example, intramuscular injection, while at other times, viral delivery is delivered via intravenous, transdermal, intranasal, oral, mucosal, or other delivery methods. Such delivery may be via a single dose or multiple doses. Those of skill in the art will appreciate that the actual dosage to be delivered herein may vary somewhat depending on a variety of factors, such as carrier selection, target cells, organisms or tissues, general health of the subject to be treated, the degree of transformation/modification sought, the route of administration, the type of transformation/modification sought, and the like.

Poxvirus vectors introduce genes into the cytoplasm of cells. The avipoxvirus only results in short-term expression of this nucleic acid. Adenovirus vectors, adeno-associated virus vectors, and Herpes Simplex Virus (HSV) vectors may be indicators for some embodiments. Adenovirus vectors result in shorter term expression (e.g., less than about one month) than adeno-associated viruses, and in some embodiments, may exhibit much longer expression. The particular vector selected will depend on the target cell and the processing conditions.

In certain embodiments, the vector also includes a conventional control element operably linked to the transgene in a manner that allows it to be transcribed, translated, and/or expressed in cells infected with the plasmid vector or infected with a virus produced by the present disclosure. As used herein, "operably linked" sequences include expression control sequences that are contiguous with the target gene and expression control sequences that act in trans or at a distance to control the target gene. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; effective RNA processing signals such as splice and polyadenylation (poly a) signals; a sequence that stabilizes cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., kozak consensus sequences); a sequence that enhances protein stability; and sequences that enhance secretion of the encoded product when desired. A large number of expression control sequences, including protogenic, constitutive, inducible, and/or tissue-specific promoters, are known in the art and available.

Additional promoter elements (e.g., enhancers) regulate the frequency of transcription initiation. Typically, these are located in the region 30-110bp upstream of the start site, but in recent years it has been found that a large number of promoters also contain functional elements located downstream of the start site. The spacing between promoter elements tends to be flexible so that promoter function is preserved when the elements are inverted or moved relative to each other. In the thymidine kinase (tk) promoter, the spacing between promoter elements may be up to 50bp before the activity begins to decrease. Depending on the promoter, individual elements appear to act cooperatively or independently to activate transcription.

Selection of the appropriate promoter can be readily accomplished. In certain aspects, high expression promoters may be used. One example of a suitable promoter is the immediate early cytomegalovirus CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence to which it is operably linked. Rous Sarcoma Virus (RSV) and MMT promoters may also be used. Some proteins may be expressed using their native promoters. Other elements that can enhance expression, such as enhancers or systems that result in high levels of expression, such as tat gene and tar elements, may also be included. The cassette may then be inserted into a vector, for example, a plasmid vector such as pUC19, pUC118, pBR322 or other known plasmid vector, including, for example, an E.coli replication origin.

Another example of a suitable promoter is elongation growth factor-la (EF-la). However, other constitutive promoter sequences may also be used, including, but not limited to, simian virus 40 (SV 40) early promoter, mouse Mammary Tumor Virus (MMTV), human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, moMuLV promoter, avian leukemia virus promoter, epstein barr virus immediate early promoter, rous sarcoma virus promoter, and human gene promoters such as, but not limited to, actin promoter, myosin promoter, hemoglobin promoter, and creatinine kinase promoter. Furthermore, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of inducible promoters provides a molecular switch capable of initiating expression of an operably linked polynucleotide sequence when such expression is desired, or shutting off such expression when such expression is desired. Examples of inducible promoters include, but are not limited to, metallothionein (metallothionein) promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

Promoter sequences found on the vector also regulate the expression of the genes contained therein. Typically, promoters bind to protein factors to enhance transcription of genes. Enhancers can be located upstream or downstream of the gene they regulate. Enhancers may also be tissue-specific to enhance transcription in a particular cell or tissue type. In some embodiments, the vectors of the present disclosure comprise one or more enhancers to perform robust transcription of genes present in the vector.

To assess expression of nucleic acids and/or peptides, the expression vector to be introduced into the cell may also contain a selectable marker gene or a reporter gene or both to facilitate identification and selection of expression cells from the sought cell population to be transfected or transfected by a viral vector. In other aspects, the selectable marker may be carried on separate DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Reporter genes are used to identify potentially transfected cells and assess the functionality of regulatory sequences. Typically, a reporter gene is a gene that is absent from or expressed by a recipient organism or tissue and encodes a polypeptide whose expression exhibits some readily detectable property, such as enzymatic activity. Expression of the reporter gene is determined at an appropriate time after the DNA has been introduced into the recipient cell. Suitable reporter genes may include genes encoding luciferases, beta-galactosidases, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or green fluorescent protein genes (e.g., ui-Tei et al 2000FEBS Letters 479:79-82). Suitable expression systems are well known and may be prepared using known techniques or commercially available. Typically, the construct with the smallest 5' flanking region that shows the highest level of reporter gene expression is identified as a promoter. Such promoter regions may be linked to reporter genes and used to evaluate agents for the ability to regulate promoter-driven transcription.

Methods for introducing and expressing genes into cells are known in the art. In the context of an expression vector, the vector may be readily introduced into a host cell, such as a mammalian, bacterial, yeast or insect cell, by any method known in the art. For example, the expression vector may be transferred into the host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing vectors and/or exogenous nucleic acids are well known in the art. See, e.g., sambrook et al (2012,Molecular Cloning:A Laboratory Manual,Cold Spring Harbor Laboratory,New York). A preferred method for introducing polynucleotides into host cells is calcium phosphate transfection.

Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors and in particular retroviral vectors have become the most commonly used method for inserting genes into mammalian, e.g. human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. See, for example, U.S. patent nos. 5,350,674 and 5,585,362.

Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microcapsules, beads and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles and liposomes. An exemplary colloidal system for use as an in vitro and in vivo delivery vehicle is a liposome (e.g., an artificial membrane vesicle).

In the case where a non-viral delivery system is utilized, an exemplary delivery system is a liposome. The use of lipid formulations is contemplated for introducing nucleic acids into host cells (in vitro, ex vivo, or in vivo). In another aspect, the nucleic acid can be associated with a lipid. Nucleic acids associated with a lipid can be encapsulated in the aqueous interior of the liposome, entrapped within the lipid bilayer of the liposome, attached to the liposome via a linker molecule associated with both the liposome and the oligonucleotide, entrapped within the liposome, complexed with the liposome, dispersed in a solution containing the lipid, mixed with the lipid, combined with the lipid, contained in the lipid as a dispersion, containing or complexed with a micelle, or otherwise associated with the lipid. The composition of the lipid, lipid/DNA or lipid/expression vector association is not limited to any particular structure in solution. For example, they may exist in a bilayer structure, as micelles, or have a "collapsed" structure. They may also simply be inserted into the solution, possibly forming aggregates that are uniform in size or shape. Lipids are fatty substances, which may be naturally occurring or synthetic lipids. For example, lipids include naturally occurring droplets of fat in the cytoplasm as well as a class of compounds containing long chain aliphatic hydrocarbons and derivatives thereof, such as fatty acids, alcohols, amines, amino alcohols, and anhydrides.

Lipids suitable for use are available from commercial sources. For example, dimyristoyl phosphatidylcholine ("DMPC") is available from Sigma, st.louis, MO; dicetyl phosphate ("DCP") is available from K & K Laboratories (Plainview, N.Y.); cholesterol ("Choi") is available from Calbiochem-Behring; dimyristoyl phosphatidylglycerol ("DMPG") and other lipids are available from Avanti Polar Lipids, inc (Birmingham, AL). The stock solution of lipids in chloroform or chloroform/methanol can be stored at about-20 ℃. Chloroform is used as the only solvent because it evaporates more readily than methanol. "liposomes" is a generic term that encompasses a variety of unilamellar and multilamellar lipid vehicles formed by the formation of a closed lipid bilayer or aggregate. Liposomes can be characterized as having a vesicle structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by an aqueous medium. They spontaneously form when phospholipids are suspended in excess aqueous solution. The lipid components self-rearrange before forming a closed structure and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al 1991Glycobiology 5:505-10). However, compositions having structures in solution that differ from normal vesicle structures are also contemplated. For example, lipids may be assumed to be of micellar structure or merely present as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.

Regardless of the method used to introduce exogenous nucleic acid into a host cell, various assays can be performed in order to confirm the presence of the recombinant nucleic acid sequence in the host cell. Such assays include, for example, "molecular biology" assays such as southern and northern blots, RT-PCR, and PCR, which are well known to those skilled in the art; "biochemical" assays, such as detecting the presence or absence of a particular peptide, for example, by immunological means (ELISA and western blot methods) or by assays described herein, identify agents that fall within the scope of the present disclosure.

In certain embodiments, the composition comprises a cell genetically modified to express one or more isolated nucleic acids and/or peptides described herein. For example, the cell can be transfected or transformed with one or more vectors comprising an isolated nucleic acid sequence encoding a gRNA and/or Cas peptide. The cells may be cells of the subject, or they may be haplotype matched or cell lines. Cells may be irradiated to prevent replication. In some embodiments, the cell is a Human Leukocyte Antigen (HLA) -matched cell line, an autologous cell line, or a combination thereof. In other embodiments, the cell may be a stem cell. For example, embryonic stem cells or artificial pluripotent stem cells (induced pluripotent stem cells (iPS cells)). Embryonic stem cells (ES cells) and artificial pluripotent stem cells (induced pluripotent stem cells, iPS cells) have been established from a number of animal species, including humans. These types of pluripotent stem cells would be the most useful source for regenerative medicine because these cells can differentiate into almost all organs by properly inducing their differentiation, and retain their ability to actively divide while maintaining their pluripotency. iPS cells can be established from autologous somatic cells, especially compared to ES cells produced by destroying embryos, and thus are unlikely to cause ethical and social problems. Furthermore, iPS cells, as autologous cells, make it possible to avoid rejection, which is the biggest obstacle to regenerative medicine or transplantation therapy.

Pharmaceutical composition

The compositions described herein are suitable for use in the various drug delivery systems described above. In addition, to enhance the serum half-life of the administered compound in vivo, the composition may be encapsulated, introduced into the lumen of a liposome, prepared as a colloid, or other conventional techniques that provide an extended half-life of the composition may be employed. Various methods may be used to prepare liposomes, as described, for example, in U.S. Pat. nos. 4,235,871, 4,501,728, and 4,837,028 to Szoka et al, each of which is incorporated herein by reference. Furthermore, the administration may be in a targeted drug delivery system, for example, in liposomes coated with tissue specific antibodies. Liposomes will be targeted to and selectively taken up by the organ.

The present disclosure also provides pharmaceutical compositions comprising one or more of the compositions described herein. The formulations may be used in admixture with conventional excipients (i.e., pharmaceutically acceptable organic or inorganic carrier materials suitable for administration to a wound or treatment site). The pharmaceutical composition may be sterilized and, if desired, mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring and/or aromatic substances, and the like. If desired, they may also be combined with other active agents, such as other analgesics.

Administration of the compositions of the present disclosure may be performed, for example, by parenteral, by intravenous, intratumoral, subcutaneous, intramuscular, or intraperitoneal injection, or by infusion, or by any other acceptable systemic method. Formulations for administration of the composition include those suitable for rectal, nasal, oral, topical (including buccal and sublingual), vaginal or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration. The formulations may conveniently be presented in unit dosage form, for example, tablets and sustained release capsules, and may be prepared by any of the methods well known in the pharmaceutical arts.

As used herein, "additional ingredients" include, but are not limited to, one or more of the following: an excipient; a surfactant; a dispersing agent; an inert diluent; granulating agents and disintegrating agents; an adhesive; a lubricant; a colorant; a preservative; physiologically degradable compositions such as gels; an aqueous vehicle and a solvent; an oily vehicle and a solvent; a suspending agent; a dispersing or wetting agent; emulsifying agent and emollient; a buffering agent; a salt; a thickener; a filler; an emulsifying agent; an antioxidant; an antibiotic; an antifungal agent; a stabilizer; and a pharmaceutically acceptable polymeric or hydrophobic material. Other "additional ingredients" that may be included in the pharmaceutical compositions of the present disclosure are known in the art and are described, for example, in Genaro, et al (1985,Remington's Pharmaceutical Sciences,Mack Publishing Co, easton, PA), incorporated herein by reference.

The compositions of the present disclosure may comprise, by total weight of the composition, from about 0.005% to 2.0% preservative. Preservatives are used to prevent spoilage in the event of exposure to environmental contaminants. Examples of preservatives useful in accordance with the present disclosure include, but are not limited to, those selected from the group consisting of: benzyl alcohol, sorbic acid, carbamates, imidazolidinyl urea (imidurea), and combinations thereof. Particularly preferred preservatives are combinations of about 0.5% to 2.0% benzyl alcohol with 0.05% to 0.5% sorbic acid.

In one embodiment, the composition includes an antioxidant and a chelating agent that inhibits degradation of one or more components of the composition. Preferred antioxidants for some compounds are BHT, BHA, alpha-tocopherol and ascorbic acid, the antioxidants preferably being in the range of about 0.01% to 0.3%, and more preferably in the range of 0.03% to 0.1% BHT, by total weight of the composition. Preferably, the chelating agent is present in an amount of 0.01% to 0.5% by total weight of the composition. Particularly preferred chelating agents include EDTA salts (e.g., disodium EDTA) and citric acid, with the chelating agent ranging from about 0.01% to 0.20%, preferably from 0.02% to 0.10%, by total weight of the composition. Chelating agents can be used to sequester metal ions in the composition that may be detrimental to the shelf life of the formulation. Although BHT and disodium EDTA are the preferred antioxidants and chelating agents for some compounds, respectively, other suitable and equivalent antioxidants and chelating agents may be substituted as will be appreciated by those skilled in the art.

Suspensions may be prepared using conventional methods to achieve suspension of the compositions of the present disclosure in aqueous or oily vehicles. Aqueous vehicles include, for example, water and isotonic saline. Oily vehicles include, for example, almond oil; oily esters; ethanol; vegetable oils such as peanut oil, olive oil, sesame oil or coconut oil; fractionating the vegetable oil; and mineral oils such as liquid paraffin. The suspension may further comprise one or more additional ingredients including, but not limited to, dispersing or wetting agents, emulsifiers, emollients, preservatives, buffers, salts, fragrances, colorants, and sweeteners. The oily suspensions may further contain a thickening agent. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, tragacanth, acacia, and cellulose derivatives such as sodium carboxymethyl cellulose, methyl cellulose, and hydroxypropyl methyl cellulose. Known dispersing or wetting agents include, but are not limited to, naturally occurring phospholipids such as lecithins; condensation products of an oxyalkane with a fatty acid, with a long chain fatty alcohol, with half esters derived from fatty acids and hexitols, or with fatty acids and hexitols anhydride (e.g., polyoxyethylene stearate, heptadecaethylene oxycetyl alcohol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifiers include, but are not limited to, lecithin and acacia. Known preservatives include, but are not limited to, methyl, ethyl or n-propyl p-hydroxybenzoate; ascorbic acid and sorbic acid.

Therapeutic method

The present disclosure provides a method of treating or preventing a herpes virus mediated infection. In some embodiments, the method comprises administering to a subject in need thereof an effective amount of a composition comprising at least one of a guide nucleic acid and a Cas peptide or a functional fragment or derivative thereof. In some cases, the method comprises administering a composition comprising an isolated nucleic acid encoding at least one of the guide nucleic acid and Cas peptide or a functional fragment or derivative thereof. In certain embodiments, the method comprises administering a composition described herein to a subject diagnosed as having a herpes virus infection, at risk of developing a herpes virus infection, a subject having a potential herpes virus infection, and the like.

In certain embodiments, provided herein is a method of modifying and/or editing a herpesvirus sequence in the genome of a cell (e.g., host cell) using a CRISPR-Cas system or composition described herein. Typically, modifying and/or editing a herpesvirus sequence in the genome of a cell (e.g., host cell) includes contacting the cell or providing the cell with a CRISPR-Cas system or composition that targets one or more regions in the UL56, ICP0, ICP4, or ICP27 genes. In some embodiments, the method comprises removing or excision sequences from the genome of the cell. In some embodiments, the method results in excision of at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or more than 9000 base pairs of the HSV genome.

In certain embodiments, provided herein are methods comprising administering a composition comprising: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases or nucleic acid sequences encoding the CRISPR-associated endonucleases; b) A first guide nucleic acid or a nucleic acid sequence encoding the first guide nucleic acid, the first guide nucleic acid being complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and d) a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. In some embodiments, the method further comprises administering the fourth guide nucleic acid or a nucleic acid sequence encoding a fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome. In some embodiments, the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence.

In certain embodiments, provided herein are methods comprising administering a composition comprising: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases or nucleic acid sequences encoding the CRISPR-associated endonucleases; b) A first guide nucleic acid or a nucleic acid sequence encoding the first guide nucleic acid, the first guide nucleic acid being complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and d) a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

In certain embodiments, provided herein are methods comprising administering a CRISPR-Cas system comprising: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; b) A first pilot nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 or 7 or the complement thereof; and c) a second nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 376 or 377 or the complement thereof. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 2. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 7. In some embodiments, the second nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 376. In some embodiments, the second nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 377. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 2, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 376. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 2, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 377. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 7, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 376. In some embodiments, the first nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 7, and the second nucleic acid vector comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO. 377.

In certain embodiments, provided herein are methods comprising administering an adeno-associated virus (AAV) vector comprising nucleic acids encoding: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; b) A first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and d) a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. In some embodiments, the method further comprises administering a fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome.

In certain embodiments, provided herein are methods comprising administering an adeno-associated virus (AAV) vector comprising nucleic acids encoding: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; b) A first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and d) a third nucleic acid guide complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

In some embodiments, the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375. In some embodiments, the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOS 363, 371, or 374 to 377. In some embodiments of the present invention, in some embodiments,

The first target nucleic acid sequence comprises a sequence according to SEQ ID NO. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID NO. 7 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID NO. 378 or a complement thereof. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the fourth target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

In some embodiments, the methods of the present disclosure are employed to treat or prevent diseases and disorders associated with herpes virus infections including, but not limited to, herpes labialis, genital herpes, herpetic encephalitis, fowl pox, shingles, bell's palsy, vestibular neuritis, and herpetic neuralgia.

Subjects to which the pharmaceutical compositions of the present disclosure are administered are contemplated to include, but are not limited to, humans and other primates; mammals, including commercially relevant mammals, such as non-human primates, cows, pigs, horses, sheep, cats, and dogs. The therapeutic agent may be administered under a rhythmic regimen. As used herein, "rhythmic" therapy refers to the administration of a continuous low dose therapeutic agent.

The composition may be administered in conjunction with (e.g., before, simultaneously with, or after) one or more therapies. For example, in certain embodiments, the methods comprise co-administering a composition of the present disclosure with additional anti-herpes therapies including, but not limited to, TK inhibitors, UL30 inhibitors, acyclovir, foscarnet (foskamet), cidofovir, and derivatives thereof.

The dosage, toxicity and therapeutic efficacy of the present compositions can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining LD ₅₀ (dose lethal to 50% of population) and ED ₅₀ (50% of the population is at a therapeutically effective dose). The dose ratio between toxic and therapeutic effects is the therapeutic index, and it can be expressed as the ratio LD ₅₀ /ED ₅₀ . Cas9/gRNA compositions that exhibit high therapeutic indices are preferred. While Cas9/gRNA compositions exhibiting toxic side effects can be used, care should be taken to consider a delivery system that targets such compositions to the site of affected tissue in order to minimize potential damage to uninfected cells, thereby reducing side effects.

The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compositions is preferably within a circulating concentration range that includes having a low or non-toxic ED50. The dosage may vary within this range depending upon the dosage form employed and the route of administration employed. For any composition used in the methods of the present disclosure, a therapeutically effective dose may be initially estimated from a cell culture assay. The dose can be formulated in animal models to achieve a formulation including IC as determined in cell culture ₅₀ (i.e., the concentration of test compound that achieves half-maximal inhibition of symptoms). Such information may be used to more accurately determine the available dose in humans. For example, blood can be measured by high performance liquid chromatography Pulp level.

As defined herein, a therapeutically effective amount (i.e., an effective dose) of a composition means an amount sufficient to produce a therapeutically (e.g., clinically) desired result. The frequency of administration of the composition may range from one or more times per day to one or more times per week, including once every two days. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or condition, past treatments, the general health and/or age of the subject, and other diseases present. Furthermore, treating a subject with a therapeutically effective amount of a composition of the present disclosure may include a single treatment or a series of treatments.

The gRNA expression cassette can be delivered to a subject by methods known in the art. In some aspects, the Cas can be a fragment, including the active domain of the Cas molecule, thereby cleaving at molecular size. Thus, cas/gRNA molecules can be used clinically, similar to the approach taken by current gene therapies. In some embodiments, the method comprises genetically modifying the cell to express the guide nucleic acid and/or Cas peptide. For example, in some embodiments, the method comprises contacting the cell with an isolated nucleic acid encoding the guide nucleic acid and/or Cas peptide.

In some embodiments, for vector-mediated delivery, the dose comprises at least 1x l0 ⁵ From particles to about l x10 ¹⁵ And (3) particles. In some embodiments, delivery is via adenovirus such as containing at least 1x 10 ⁵ Single doses of individual particles (also referred to as particle units, pu) of the adenoviral vector are performed. In some embodiments, the dose is at least about 1x 10 ⁶ Individual particles (e.g., about lxl0 ⁶ To 1x l0 ¹² Individual particles), at least about l x10 ⁷ Individual particles, at least about l x10 ⁸ Individual particles (e.g., about 1x l0 ⁸ To 1x 10 ¹¹ Individual particles or about 1x 10 ⁸ To 1x 10 ¹² Individual particles), at least about 1x 10 ⁹ Individual particles (e.g., about 1x 10 ⁹ To 1x 10 ¹⁰ Individual particles or about 1x l0 ⁹ To 1x 10 ¹² Individual particles) or at least about 1x 10 ¹⁰ Individual particles(e.g., about 1X 10 to 1X 10) ¹² Individual particles). Alternatively, the dosage comprises no more than about 1x 10 ¹⁴ Particles of no more than about 1x 10 ¹³ Particles of no more than about 1x 10 ¹² Particles of no more than about 1x 10 ¹¹ Individual particles, and not more than about 1x 10 ¹⁰ Particles (e.g. not more than about 1x l0 ⁹ Individual particles). Thus, in some embodiments, the dose contains a single dose of adenovirus vector, e.g., about 1x l0 ⁶ Particle unit (pu), about 2x l0 ⁶ pu, about 4x l0 ⁶ pu, about l x l0 ⁷ pu, about 2x l0 ⁷ pu, about 4x 10 ⁷ pu, about 1x l0 ⁸ pu, about 2x10 ⁸ pu, about 4x 10 ⁸ pu, about 1x10 ⁹ pu, about 2x10 ⁹ pu, about 4x 10 ⁹ pu, about 1x10 ¹ 0pu, about 2x10 ¹⁰ pu, about 4x 10 ¹⁰ pu, about l x l0 ¹¹ pu, about 2x10 ¹ pu, about 4x 10 ¹¹ pu, about l x l0 ¹² pu, about 2x10 ¹² pu, or about 4x l0 ¹² pu adenovirus vector. In some embodiments, the adenovirus is delivered via multiple doses.

In some embodiments, the delivery is via AAV. Therapeutically effective doses for in vivo delivery of AAV to humans are believed to contain about 1x10 ¹⁰ Up to about 1x10 ¹⁰ The individual functional AAV/ml solutions range from about 20 to about 50ml saline solution. Dosages may be adjusted to balance therapeutic benefit with any side effects. In some embodiments, the AAV dose is typically about 1x10 ⁵ To 1x l0 ⁵⁰ Genomic AAV, about 1X10 ⁸ To 1x10 ²⁰ Genomic AAV, about lxl0 ¹⁰ To about 1x l0 ¹⁶ Locus, or about 1x10 ¹¹ Up to about x10 ¹⁶ The concentration of genomic AAV is within a range. In some embodiments, the human dose is about 1x10 ¹³ Individual genome AAV. In some embodiments, such concentrations are delivered in about 0.001ml to about 100ml, about 0.05 to about 50ml, or about 10 to about 25ml of carrier solution. Other effective dosages can be readily established by one of ordinary skill in the art through routine experimentation to establish a dose response curve (see For example, U.S. patent No. 8,404,658).

In some embodiments, the cell is genetically modified in vivo in a subject for whom the therapy is intended. In certain aspects, for in vivo delivery, the nucleic acid is injected directly into the subject. For example, in some embodiments, the nucleic acid is delivered to a site where the composition is desired. In vivo nucleic acid transfer techniques include, but are not limited to, transfection with viral vectors (such as adenovirus, herpes simplex virus I, adeno-associated virus), lipid-based systems (available lipids for lipid-mediated gene transfer are, for example, DOTMA, DOPE, and DC-Chol), naked DNA, and transposon-based expression systems. Exemplary gene therapy protocols are described in Anderson et al, science 256:808-813 (1992). See also WO 93/25673 and the references cited therein. In certain embodiments, the method comprises administering RNA (e.g., mRNA) directly into a subject (see, e.g., zangi et al, 2013Nature Biotechnology,31:898-907).

For ex vivo treatment, the isolated cells are modified in an ex vivo or in vitro environment. In some embodiments, the cell is autologous to the subject for whom the therapy is intended. Alternatively, the cells may be allogeneic, syngeneic or xenogeneic. The modified cells can then be administered directly to a subject.

Those skilled in the art are aware of different delivery methods that can be used to administer the isolated nucleic acid into a cell. Examples include: (1) Methods using physical means such as electroporation (electricity), gene gun (physical force) or application of large volumes of liquid (pressure); and (2) methods wherein the nucleic acid or vector is complexed with another entity, such as a liposome, an aggregated protein, or a transporter molecule.

The amount of carrier to be added per cell will likely vary with the length and stability of the therapeutic agent inserted into the carrier and the nature of the sequence, and in particular the parameters that need to be determined empirically, and may vary due to factors that do not infect the methods of the present disclosure (e.g., costs associated with synthesis). Any necessary adjustments may be readily made by those skilled in the art depending on the emergency situation of a particular situation.

Genetically modified cells may also contain suicide genes, i.e., genes encoding products that can be used to destroy the cell. In many gene therapy contexts, it is desirable to be able to express genes for therapeutic purposes in a host cell, but it is also desirable to have the ability to destroy the host cell at will. The therapeutic agent may be linked to a suicide gene whose expression is not activated in the absence of the activator compound. When it is desired that the cell (into which both the agent and the suicide gene have been introduced) die, the cell is administered with an activator compound, thereby activating expression of the suicide gene and killing the cell. Examples of suicide gene/prodrug combinations that can be used are herpes simplex virus-thymidine kinase (HSV-tk) and ganciclovir, acyclovir; oxidoreductases and cycloheximides; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidylate kinase (Tdk:: tmk) and AZT; deoxycytidine kinase and cytosine arabinoside.

The present disclosure is further described in detail by the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Thus, the present disclosure should not be construed as being limited in any way to the following embodiments, but rather should be construed to cover any and all variations that become apparent from the teachings provided herein.

Description of the embodiments

Embodiment 1 includes a composition comprising: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases or nucleic acid sequences encoding the CRISPR-associated endonucleases; b) A first guide nucleic acid or a nucleic acid sequence encoding the first guide nucleic acid, the first guide nucleic acid being complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and d) a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

Embodiment 2 includes the composition of embodiment 1 further comprising a fourth guide nucleic acid or a nucleic acid sequence encoding the fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome.

Embodiment 3 includes the composition of any of embodiments 1-2, wherein the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence.

Embodiment 4 includes the composition of any of embodiments 1 to 3, wherein the CRISPR-associated endonuclease is a type I, type II or type III Cas endonuclease.

Embodiment 5 includes the composition of any of embodiments 1 to 4, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

Embodiment 6 includes the composition of any of embodiments 1 to 5, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

Embodiment 7 includes the composition of any one of embodiments 1 to 6, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

Embodiment 8 includes the composition of any one of embodiments 1 to 7, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

Embodiment 9 includes the composition of any one of embodiments 1 to 8, wherein the guide nucleic acid is RNA.

Embodiment 10 includes the composition of any one of embodiments 1 to 9, wherein the guide nucleic acid includes crRNA and tracrRNA.

Embodiment 11 includes the composition of any of embodiments 1 to 10 wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any of SEQ ID NOs 1 to 96 or 372 to 375 or a complement of any of SEQ ID NOs 1 to 96 or 372 to 375.

Embodiment 12 includes the composition of any of embodiments 1 to 11, wherein the first target nucleic acid sequence comprises a sequence according to any of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any of SEQ ID NOs 1 to 96 or 372 to 375.

Embodiment 13 includes the composition of any of embodiments 1 to 12, wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any of SEQ ID NOs 1 to 96 or 372 to 375.

Embodiment 14 includes the composition of any of embodiments 1 to 13, wherein the second target nucleic acid sequence comprises a sequence according to any of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any of SEQ ID NOs 1 to 96 or 372 to 375.

Embodiment 15 includes the composition of any of embodiments 1 to 14, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 16 includes the composition of any of embodiments 1 to 15, wherein the second target nucleic acid sequence comprises a sequence according to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 17 includes the composition of any of embodiments 1 to 16, wherein the fourth target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 18 includes the composition of any of embodiments 1 to 17, wherein the fourth target nucleic acid sequence comprises a sequence according to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 19 includes the composition of any of embodiments 1 to 18, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof.

Embodiment 20 includes the composition of any of embodiments 1 to 19, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the fourth target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

Embodiment 21 includes the composition of any one of embodiments 1 to 20 wherein the herpes virus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; eb virus (EBV)), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7) and human herpes virus 8 (HHV-8; kaposi sarcoma-associated herpes virus (KSHV)).

Embodiment 22 includes a composition comprising: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases or nucleic acid sequences encoding the CRISPR-associated endonucleases; b) A first guide nucleic acid or a nucleic acid sequence encoding the first guide nucleic acid, the first guide nucleic acid being complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and d) a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

Embodiment 23 includes the composition of any of embodiments 1 to 22, wherein the CRISPR-associated endonuclease is a type I, type II or type III Cas endonuclease.

Embodiment 24 includes the composition of any one of embodiments 1 to 23, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

Embodiment 25 includes the composition of any one of embodiments 1 to 24, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

Embodiment 26 includes the composition of any one of embodiments 1 to 25, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

Embodiment 27 includes the composition of any one of embodiments 1 to 26, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

Embodiment 28 includes the composition of any one of embodiments 1 to 27, wherein the guide nucleic acid is RNA.

Embodiment 29 includes the composition of any one of embodiments 1 to 28, wherein the guide nucleic acid comprises crRNA and tracrRNA.

Embodiment 30 includes the composition of any of embodiments 1 to 29, wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any of SEQ ID NOs 1 to 96 or 372 to 375.

Embodiment 31 includes the composition of any of embodiments 1 to 30, wherein the first target nucleic acid sequence comprises a sequence according to any of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any of SEQ ID NOs 1 to 96 or 372 to 375.

Embodiment 32 includes the composition of any of embodiments 1 to 31 wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 33 includes the composition of any of embodiments 1 to 32, wherein the second target nucleic acid sequence comprises a sequence according to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 34 includes the composition of any of embodiments 1 to 33, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 35 includes the composition of any of embodiments 1 to 34, wherein the second target nucleic acid sequence comprises a sequence according to any of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 36 includes the composition of any of embodiments 1 to 35, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

Embodiment 37 includes the composition of any one of embodiments 1 to 36 wherein the herpes virus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; eb virus (EBV)), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7) and human herpes virus 8 (HHV-8; kaposi sarcoma-associated herpes virus (KSHV)).

Embodiment 38 includes a CRISPR-Cas system comprising: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; b) A first pilot nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 or 7 or the complement thereof; and c) a second nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 376 or 377 or the complement thereof.

Embodiment 39 includes the CRISPR-Cas system of any of embodiments 1 to 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2.

Embodiment 40 includes the CRISPR-Cas system of any of embodiments 1 to 39, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 7.

Embodiment 41 includes the CRISPR-Cas system of any of embodiments 1 to 40, wherein the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 376.

Embodiment 42 includes the CRISPR-Cas system of any of embodiments 1 to 41, wherein the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 377.

Embodiment 43 includes the CRISPR-Cas system of any of embodiments 1 to 42, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 376.

Embodiment 44 includes the CRISPR-Cas system of any of embodiments 1 to 43, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 377.

Embodiment 45 includes the CRISPR-Cas system of any of embodiments 1 to 44, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 7 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 376.

Embodiment 46 includes the CRISPR-Cas system of any of embodiments 1 to 45, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 7 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 377.

Embodiment 47 comprises a nucleic acid encoding the CRISPR-Cas system of any one of embodiments 1 to 46.

Embodiment 48 includes an adeno-associated virus (AAV) vector comprising nucleic acids encoding: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; b) A first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and d) a third nucleic acid or nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

Embodiment 49 includes the AAV vector of any one of embodiments 1-48, further comprising a fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome.

Embodiment 50 includes the AAV vector of any one of embodiments 1 to 49, wherein the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence.

Embodiment 51 includes the AAV vector of any one of embodiments 1 to 50, wherein the CRISPR-associated endonuclease is a type I, type II or type III Cas endonuclease.

Embodiment 52 includes the AAV vector of any one of embodiments 1 to 51, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

Embodiment 53 includes the AAV vector of any one of embodiments 1 to 52, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

Embodiment 54 includes the AAV vector of any one of embodiments 1 to 53, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

Embodiment 55 includes the AAV vector of any one of embodiments 1 to 54, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

Embodiment 56 includes the AAV vector of any one of embodiments 1-55, wherein the guide nucleic acid is RNA.

Embodiment 57 includes the AAV vector of any one of embodiments 1-56, wherein the guide nucleic acid comprises crRNA and tracrRNA.

Embodiment 58 includes the AAV vector of any one of embodiments 1-57, wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1-96 or 372-375, or a complement of any one of SEQ ID NOs 1-96 or 372-375.

Embodiment 59 includes the AAV vector of any one of embodiments 1-58, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1-96, 372-375, or a complement of any one of SEQ ID NOs 1-96 or 372-375.

Embodiment 60 includes the AAV vector of any one of embodiments 1-59, wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1-96 or 372-375, or a complement of any one of SEQ ID NOs 1-96 or 372-375.

Embodiment 61 includes the AAV vector of any one of embodiments 1-60, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1-96, 372-375, or a complement of any one of SEQ ID NOs 1-96 or 372-375.

Embodiment 62 includes the AAV vector of any one of embodiments 1-61, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 63 includes the AAV vector of any one of embodiments 1-62, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 64 includes the AAV vector of any one of embodiments 1-63, wherein the fourth target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 65 includes the AAV vector of any one of embodiments 1-64, wherein the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 66 includes the AAV vector of any one of embodiments 1-65, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof.

Embodiment 67 includes the AAV vector of any one of embodiments 1-66, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the fourth target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

Embodiment 68 includes the AAV vector of any one of embodiments 1-67, wherein the nucleic acid further comprises a promoter.

Embodiment 69 includes the AAV vector of any one of embodiments 1-68, wherein the promoter is a ubiquitous promoter.

Embodiment 70 includes the AAV vector of any one of embodiments 1-69, wherein the promoter is a tissue specific promoter.

Embodiment 71 includes the AAV vector of any one of embodiments 1-70, wherein the promoter is a constitutive promoter.

Embodiment 72 includes the AAV vector of any one of embodiments 1-71, wherein the promoter is a human cytomegalovirus promoter.

Embodiment 73 includes the AAV vector of any one of embodiments 1-72, wherein the nucleic acid further comprises an enhancer element.

Embodiment 74 includes the AAV vector of any one of embodiments 1-73, wherein the enhancer element is a human cytomegalovirus enhancer element.

Embodiment 75 includes the AAV vector of any one of embodiments 1-74, wherein the nucleic acid further comprises a 5'itr element and a 3' itr element.

Embodiment 76 includes the AAV vector of any one of embodiments 1 to 75, wherein the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9.

Embodiment 77 includes the AAV vector of any one of embodiments 1 to 76, wherein the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8.

Embodiment 78 includes the AAV vector of any one of embodiments 1-77, wherein the herpes virus is selected from the group consisting of herpes simplex virus type I (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; eb virus (EBV)), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi's sarcoma-associated herpes virus (KSHV)).

Embodiment 79 includes an adeno-associated virus (AAV) vector comprising nucleic acid encoding: a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases; b) A first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) A second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and d) a third nucleic acid guide complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

Embodiment 80 includes the AAV vector of any one of embodiments 1 to 79, wherein the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease.

Embodiment 81 includes the AAV vector of any of embodiments 1-80, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

Embodiment 82 includes the AAV vector of any one of embodiments 1 to 81, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

Embodiment 83 includes the AAV vector of any one of embodiments 1 to 82, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

Embodiment 84 includes the AAV vector of any one of embodiments 1 to 83, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

Embodiment 85 includes the AAV vector of any one of embodiments 1-84, wherein the guide nucleic acid is RNA.

Embodiment 86 includes the AAV vector of any one of embodiments 1-85, wherein the guide nucleic acid comprises crRNA and tracrRNA.

Embodiment 87 includes the AAV vector of any one of embodiments 1-86, wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1-96 or 372-375, or a complement of any one of SEQ ID NOs 1-96 or 372-375.

Embodiment 88 includes the AAV vector of any one of embodiments 1-87, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1-96 or 372-375, or a complement of any one of SEQ ID NOs 1-96 or 372-375.

Embodiment 89 includes the AAV vector of any one of embodiments 1-88, wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 90 includes the AAV vector of any one of embodiments 1-89, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 91 includes the AAV vector of any one of embodiments 1-90, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 92 includes the AAV vector of any one of embodiments 1-91, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

Embodiment 93 includes the AAV vector of any one of embodiments 1-92, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or 7 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

Embodiment 94 includes the composition of any one of embodiments 1 to 20 wherein the herpes virus is selected from the group consisting of herpes simplex virus type I (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; eb virus (EBV)), human herpes virus 5 (HHV-5; cellular virus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7) and human herpes virus 8 (HHV-8; kaposi sarcoma-associated herpes virus (KSHV)).

Embodiment 95 includes the AAV vector of any one of embodiments 1-94, wherein the nucleic acid further comprises a promoter.

Embodiment 96 includes the AAV vector of any one of embodiments 1 to 95, wherein the promoter is a ubiquitous promoter.

Embodiment 97 includes the AAV vector of any one of embodiments 1-96, wherein the promoter is a tissue specific promoter.

Embodiment 98 includes the AAV vector of any one of embodiments 1-97, wherein the promoter is a constitutive promoter.

Embodiment 99 includes the AAV vector of any one of embodiments 1-98, wherein the promoter is a human cytomegalovirus promoter.

Embodiment 100 includes the AAV vector of any one of embodiments 1-99, wherein the nucleic acid further comprises an enhancer element.

Embodiment 101 includes the AAV vector of any one of embodiments 1 to 100, wherein the enhancer element is a human cytomegalovirus enhancer element.

Embodiment 102 includes the AAV vector of any one of embodiments 1 to 101, wherein the nucleic acid further comprises a 5'itr element and a 3' itr element.

Embodiment 103 includes the AAV vector of any one of embodiments 1 to 102, wherein the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9.

Embodiment 104 includes the AAV vector of any one of embodiments 1 to 103, wherein the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8.

Embodiment 105 includes a method of excision of a portion or all of a herpesvirus sequence from a cell comprising providing to the cell the composition of any one of embodiments 1 to 104, the CRISPR-Cas system of any one of embodiments 1 to 104, or the AAV vector of any one of embodiments 1 to 104.

Embodiment 106 includes a method of inhibiting or reducing herpes virus replication in a cell, the method comprising providing to the cell the composition of any one of embodiments 1 to 104, the CRISPR-Cas system of any one of embodiments 1 to 104, or the AAV vector of any one of embodiments 1 to 104.

Embodiment 107 includes the method of any one of embodiments 1 to 106, wherein the cell is in a subject.

Embodiment 108 includes the method of any one of embodiments 1 to 107, wherein the subject is a human.

Examples

Example 1: gRNA targeting HSV genes.

TABLE 1 gRNA targeting HSV UL 56.

* Selected for cloning and testing in cell culture

TABLE 2 off-target for 110

TABLE 3 off-target for 417

/>

Table 4. GRNA targeting HSV ICP 0.

/>

* Selected for cloning and testing in cell culture

Table 5.

/>

Example 2 inhibition of HSV-1 replication in vitro by Gene editing

Herpes simplex virus type 1 (HSV-1) is a human neurotropic virus that infects a large portion of the population worldwide, with a serum prevalence of 90% in normal asymptomatic individuals. Current treatments for primary HSV-1 infection and disease reactivation are currently non-selective, do not prevent the establishment of potential infection or viral reactivation, and have adverse side effects. Environmental factors including UV light stimulation, high temperature, social stress, and pharmacological agents can trigger reactivation of the latent HSV-1 genome, which leads to disease progression. Current anti-HSV drugs may limit the spread of HSV-1 infection but fail to inhibit latency establishment or HSV reactivation.

Given the limitations of current therapies, there is a need for new therapeutic approaches that are effective in not only blocking viral replication but also eradicating the latent viral genome. Thus, as described and provided herein, CRISPR/Cas9 systems can be used to inhibit HSV-1 replication, which specifically target the HSV-1 genome and aim to make indel mutations or to remove large segments of the viral DNA sequence that are important for viral replication. Note that the ICP0 and ICP27 genes targeting HSV-1 significantly reduced ICP0 and ICP27 expression levels, resulting in repression of HSV-1 infection. As provided herein, the specificity of targeting strategies (e.g., ICP0 and ICP 27) for gene mutation/ablation within the HSV-1 genome has been verified by genetic analysis of in vitro cell culture models. Furthermore, expression of HSV-1-guided Cas9/gRNA in the cell protects the cell from HSV-1 infection.

FIG. 1A demonstrates a graphical representation of the HSV-1 genome and the ICP0 and ICP27 genes. In the study, viral genes ICP0 and ICP27 genes were targeted by the CRISPR Cas9 gene editing system. The positions and nucleotide compositions of gRNAs including PAM are shown (SEQ ID NOS: 372 to 375). Nucleotide positions refer to RefSeq nc_001806.2. FIG. 1B provides

Graphical representation of plasmid P31. This plasmid contains 4 grnas, 2 grnas targeting ICP0 (ml and m 2), 2 grnas targeting ICP27 (ml and m 2), cloned downstream U6 promoter, and 2 copies of the SaCas9 gene. P31 has been encapsulated in AAV2 particles and becomes an AAV2-HSV construct, further using px601 ("px 601" or "px601saCas 9") without ICP0 and ICP27 gRNA as a control.

Targeting ICPO and ICP27 effectively inhibited HSV-1 replication. FIG. 2 shows a graphical representation of the transient transfection of px 601P 31 of the TC620 cell line infected with the HSV-1NS1 clinical strain and the HSV-1GFP Pattern strain in order to confirm the expression of SaCas9, ICP 0-related gRNA and ICP 27-related gRNA and the excision activity for genes ICP0 and ICP 27. Reduction of ICP0 and ICP27 was further demonstrated by western blot analysis of ICP0 and ICP27 in TC620 human oligodendroglioma cell lines infected with clinical strains HSV-1NS1 (left panel) and HSV-1GFP (right panel) for detection of transient transfection by plasmid P31. Expression of the SaCas9 and housekeeping GAPDH proteins is also shown. Targeting ICP0 and ICP27 effectively results in editing of ICP0 and ICP 27. FIG. 3 shows data from DNA excision assay on agarose gel, illustrating amplicons obtained by ICP0 and ICP27 specific primers in TC620 cell lines infected with HSV-1NS1 (left panel) and HSV-1GFP (right panel) after transient transfection with the P31 plasmid. DNA sequencing identified specific excision induced by specific gRNA and SaCas9 at each target gene (lower panel).

FIG. 4 data for immunofluorescence assessment of HSV-1GFP replication in TC620 cell line transfected with P31 plasmid in cis. Representative plaque assays using supernatants from HSV-1NS1 and HSV-1 GFP-infected TC620 cell lines showed a dramatic decrease in plaque numbers due to ICPO and ICP27 repression by SaCas9 and gRNA editing of the infected cells. Reverse Transcriptase (RT) assay (FIG. 5) was used to confirm gRNA expression after transient transfection of TC620 cells by plasmid and infection by HSV-1NS1 (right panel) and HSV-1GFP (left panel).

Inhibition of HSV-1 replication by targeting ICP0 and ICP27 was further demonstrated in VERO (African green monkey kidney) cells. FIG. 6 shows a graphical representation of AAV2-HSV construct transduction of HSV-1NS1 clinical strain and HSV-1GFP Pattern strain-infected VERO cell lines in order to confirm expression of SaCas9, ICP 0-related gRNA and ICP 27-related gRNA and excision activity for genes ICP0 and ICP 27. ICP0 and ICP27 were effectively repressed as shown by Western blot analysis of ICP0 and ICP27 in VERO dye cell lines transduced with AAV2-HSV constructs for detection of clinical strains HSV-1NS1 (left panel) and HSV-1GFP (right panel). Expression of the SaCas9 and housekeeping GAPDH proteins is also shown. Targeting ICP0 and ICP27 effectively resulted in editing of ICP0 and ICP27 in VERO cells. FIG. 7 shows data from DNA excision assay on agarose gel, illustrating amplicons obtained by ICP0 and ICP27 specific primers in HSV-1NS1 and HSV-1GFP infected VERO cell lines after transduction by AAV2-HSV constructs. To confirm the gRNA expression after transfection of VERO cells with AAV2-HSV construct (right panel), reverse Transcriptase (RT) assay was performed. DNA sequencing identified specific excision induced by specific gRNA and SaCas9 at each target gene (lower panel).

Figure 8 shows representative plaque assays from supernatants using VERO cell lines from HSV-1NS1 (left panel) and HSV-1GFP (right panel) infection show a dramatic decrease in plaque numbers due to ICPO and ICP27 repression by SaCas9 and gRNA editing of infected cells.

Claims

1. A composition comprising:

a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases or nucleic acid sequences encoding the CRISPR-associated endonucleases;

b) A first leader nucleic acid or a nucleic acid sequence encoding the first leader nucleic acid, the first leader nucleic acid being complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome;

c) A second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and

d) A third nucleic acid or a nucleic acid sequence encoding the third nucleic acid, the third nucleic acid being complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome;

wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

2. The composition of claim 1, further comprising a fourth guide nucleic acid or a nucleic acid sequence encoding the fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome.

3. The composition of claim 2, wherein the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence.

4. The composition of any one of claims 1 to 3, wherein the CRISPR-associated endonuclease is a type I, type II or type III Cas endonuclease.

5. The composition of any one of claims 1 to 3, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

6. The composition of any one of claims 1 to 3, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

7. The composition of claim 6, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

8. The composition of any one of claims 1 to 7, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

9. The composition of any one of claims 1 to 8, wherein the guide nucleic acid is RNA.

10. The composition of any one of claims 1 to 9, wherein the guide nucleic acid comprises crRNA and tracrRNA.

11. The composition of claim 1, wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

12. The composition of claim 1, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

13. The composition of claim 1, wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96, 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

14. The composition of claim 1, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

15. The composition of claim 1, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

16. The composition of claim 1, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

17. The composition of claim 2, wherein the fourth target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

18. The composition of claim 2, wherein the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

19. The composition of claim 1, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof.

20. The composition of claim 2, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the fourth target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

21. The composition of any one of claims 1 to 20, wherein the herpes virus is selected from the group consisting of herpes simplex virus type I (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; eb virus (EBV)), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7) and human herpes virus 8 (HHV-8; kaposi sarcoma-associated herpes virus (KSHV)).

22. A composition comprising:

c) A second nucleic acid or a nucleic acid sequence encoding the second nucleic acid, the second nucleic acid being complementary to a second target nucleic acid sequence within or near an ICP27 gene of a herpesvirus genome; and

23. The composition of claim 22, wherein the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease.

24. The composition of claim 22, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

25. The composition of claim 22, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

26. The composition of claim 25, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

27. The composition of any one of claims 22 to 26, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

28. The composition of any one of claims 22-27, wherein the guide nucleic acid is RNA.

29. The composition of any one of claims 22 to 28, wherein the guide nucleic acid comprises crRNA and tracrRNA.

30. The composition of claim 22, wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

31. The composition of claim 22, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

32. The composition of claim 22, wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

33. The composition of claim 22, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

34. The composition of claim 22, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

35. The composition of claim 22, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

36. The composition of claim 22, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or 7 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

37. The composition of any one of claims 22 to 36, wherein the herpes virus is selected from the group consisting of herpes simplex virus type I (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; eb virus (EBV)), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7) and human herpes virus 8 (HHV-8; kaposi sarcoma-associated herpes virus (KSHV)).

38. A CRISPR-Cas system, comprising:

a) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated endonucleases;

b) A first guide nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 or 7 or the complement thereof; and

c) A second nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO 376 or 377 or the complement thereof.

39. The CRISPR-Cas system according to claim 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2.

40. The CRISPR-Cas system according to claim 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 7.

41. The CRISPR-Cas system of claim 38, wherein the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 376.

42. The CRISPR-Cas system of claim 38, wherein the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 377.

43. The CRISPR-Cas system of claim 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 376.

44. The CRISPR-Cas system of claim 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 2 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 377.

45. The CRISPR-Cas system of claim 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 7 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 376.

46. The CRISPR-Cas system of claim 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 7 and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID No. 377.

47. A nucleic acid encoding the CRISPR-Cas system of any one of claims 38 to 46.

48. An adeno-associated virus (AAV) vector comprising a nucleic acid encoding:

b) A first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome;

c) A second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; and

49. The AAV vector of claim 48, further comprising a fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome.

50. The AAV vector of claim 49, wherein the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence.

51. The AAV vector of any one of claims 48 to 50, wherein the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease.

52. The AAV vector of any one of claims 48 to 50, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

53. The AAV vector of any one of claims 48 to 50, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

54. The AAV vector of claim 53, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

55. The AAV vector of any one of claims 48-54, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

56. The AAV vector of any one of claims 48-55, wherein the guide nucleic acid is RNA.

57. The AAV vector of any one of claims 48-56, wherein the guide nucleic acid comprises crRNA and tracrRNA.

58. The AAV vector of claim 48, wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

59. The AAV vector of claim 48, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

60. The AAV vector of claim 48, wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

61. The AAV vector of claim 48, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

62. The AAV vector of claim 48, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

63. The AAV vector of claim 48, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

64. The AAV vector of claim 49, wherein the fourth target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

65. The AAV vector of claim 49, wherein the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

66. The AAV vector of claim 48, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 7 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof.

67. The AAV vector of claim 49 wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID NO. 2 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID NO. 7 or a complement thereof, wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID NO. 376 or a complement thereof, and wherein the fourth target nucleic acid sequence comprises a sequence according to SEQ ID NO. 377 or a complement thereof.

68. The AAV vector of any one of claims 48-67, wherein the nucleic acid further comprises a promoter.

69. The AAV vector of claim 68, wherein the promoter is a ubiquitous promoter.

70. The AAV vector of claim 68, wherein the promoter is a tissue specific promoter.

71. The AAV vector of claim 68, wherein the promoter is a constitutive promoter.

72. The AAV vector of claim 68, wherein the promoter is a human cytomegalovirus promoter.

73. The AAV vector of any one of claims 48-72, wherein the nucleic acid further comprises an enhancer element.

74. The AAV vector of claim 95, wherein the enhancer element is a human cytomegalovirus enhancer element.

75. The AAV vector of any one of claims 49-96, wherein the nucleic acid further comprises a 5'itr element and a 3' itr element.

76. The AAV vector of any one of claims 48-75, wherein the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9.

77. The AAV vector of any one of claims 48-75, wherein the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8.

78. The AAV vector of any one of claims 48-77, wherein the herpes virus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpes virus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpes virus 4 (HHV-4; eb virus (EBV)), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roses herpes virus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; kaposi sarcoma-associated herpes virus (KSHV)).

79. An adeno-associated virus (AAV) vector comprising a nucleic acid encoding:

c) A second nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and

d) A third nucleic acid guide complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome;

80. The AAV vector of claim 79, wherein the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease.

81. The AAV vector of claim 79, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.

82. The AAV vector of claim 79, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

83. The AAV vector of claim 82, wherein the Cas9 nuclease is a staphylococcus aureus Cas9 nuclease.

84. The AAV vector of any one of claims 79 to 83, wherein the CRISPR-associated endonuclease is optimized for expression in a human cell.

85. The AAV vector of any one of claims 79-84, wherein the guide nucleic acid is RNA.

86. The AAV vector of any one of claims 79-84, wherein the guide nucleic acid comprises crRNA and tracrRNA.

87. The AAV vector of claim 79, wherein the first target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

88. The AAV vector of claim 79, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs 1 to 96 or 372 to 375.

89. The AAV vector of claim 79, wherein the second target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

90. The AAV vector of claim 79, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

91. The AAV vector of claim 79, wherein the third target nucleic acid sequence comprises a sequence having at least about 90% sequence identity to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

92. The AAV vector of claim 79, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs 363, 371, or 374 to 377, or a complement of any one of SEQ ID NOs 363, 371, or 374 to 377.

93. The AAV vector of claim 79, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID No. 2 or 7 or a complement thereof, wherein the second target nucleic acid sequence comprises a sequence according to SEQ ID No. 376 or a complement thereof, and wherein the third target nucleic acid sequence comprises a sequence according to SEQ ID No. 377 or a complement thereof.

94. The AAV vector of any one of claims 79-93, wherein the herpesvirus is selected from the group consisting of type I herpes simplex virus (HSV 1), herpes simplex virus 2 (HSV 2), human herpesvirus 3 (HHV-3; varicella Zoster Virus (VZV)), human herpesvirus 4 (HHV-4; eb virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roses herpesvirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; kaposi sarcoma-associated herpesvirus (KSHV)).

95. The AAV vector of any one of claims 79-94, wherein the nucleic acid further comprises a promoter.

96. The AAV vector of claim 95, wherein the promoter is a ubiquitous promoter.

97. The AAV vector of claim 9568, wherein the promoter is a tissue specific promoter.

98. The AAV vector of claim 95, wherein the promoter is a constitutive promoter.

99. The AAV vector of claim 95, wherein the promoter is a human cytomegalovirus promoter.

100. The AAV vector of any one of claims 79-99, wherein the nucleic acid further comprises an enhancer element.

101. The AAV vector of claim 100, wherein the enhancer element is a human cytomegalovirus enhancer element.

102. The AAV vector of any one of claims 79-101, wherein the nucleic acid further comprises a 5'itr element and a 3' itr element.

103. The AAV vector of any one of claims 79-102, wherein the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9.

104. The AAV vector of any one of claims 79-102, wherein the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ/8.

105. A method of excision of part or all of a herpesvirus sequence from a cell, the method comprising providing to the cell the composition of any one of claims 1 to 37, the CRISPR-Cas system of any one of claims 38 to 46, or the AAV vector of any one of claims 48 to 104.

106. A method of inhibiting or reducing herpes virus replication in a cell, the method comprising providing to the cell the composition of any one of claims 1-37, the CRISPR-Cas system of any one of claims 38-46, or the AAV vector of any one of claims 48-104.

107. The method of any one of claims 105-106, wherein the cell is in a subject.

108. The method of claim 107, wherein the subject is a human.