CN116515675A

CN116515675A - Efficient functional microorganism suitable for petroleum and PAHs pollution remediation and preparation and application of microbial inoculum thereof

Info

Publication number: CN116515675A
Application number: CN202310194426.4A
Authority: CN
Inventors: 李继兵; 罗春玲; 戴叶亮; 张干
Original assignee: Guangzhou Institute of Geochemistry of CAS
Current assignee: Guangzhou Institute of Geochemistry of CAS
Priority date: 2023-03-02
Filing date: 2023-03-02
Publication date: 2023-08-01

Abstract

The invention discloses efficient functional microorganisms suitable for petroleum and PAHs pollution remediation and preparation and application of microbial agents thereof. The strain is Pseudocercospora diplusodonii LJD-5 with the deposit number of GDMCC No. 61905. Experiments prove that: LJD-5 can use BaP and TPH as carbon sources, after the LJD-5 is prepared into a microbial inoculum, the degradation rates of the microbial inoculum on BaP and TPH are 75.3% and 76.6%, respectively, and after the microbial inoculum is matched with Tween 80, the degradation rates of the microbial inoculum on BaP and TPH are 90.4% and 80.61%, respectively. Therefore, the strain LJD-5 can have a stronger repairing effect on BaP and TPH when being used together with Tween 80. Therefore, the microbial inoculum has better application potential in the aspect of bioremediation of petroleum soil.

Description

Efficient functional microorganism suitable for petroleum and PAHs pollution remediation and preparation and application of microbial inoculum thereof

Technical Field

The invention relates to the technical field of microorganisms, in particular to efficient functional microorganisms suitable for petroleum and PAHs pollution remediation and preparation and application of microbial agents thereof.

Background

Petroleum is an industrial blood, and is a worldwide economic proposition. However, leakage is unavoidable during the exploitation, transportation and storage of petroleum, and it is estimated that about 1X 10 is available every year worldwide ⁹ the petroleum and the products thereof enter underground water, surface water and soil through various ways, and the petroleum hydrocarbon exceeding rate of the polluted soil in China reaches 23.6 percent. The residual oil in part of petrochemical areas is up to more than 50 times of a critical value (200 mg/kg), and petroleum pollution is a problem which needs attention.

Currently, bioremediation techniques have been used to remediate petroleum hydrocarbon contaminated sites. However, due to the hydrophobicity and low water solubility of petroleum hydrocarbon contaminants, the bioavailability of the contaminants in the soil is low, and it is difficult to be bioavailable to achieve the remediation goal. The surface tension and interfacial tension can be reduced by adding the surfactant, which is helpful for desorption of adsorbed petroleum hydrocarbon pollutants and improves the solubility of non-aqueous phase liquid, thereby improving the water phase migration capacity or the microorganism contact efficiency. In the soil remediation process, the surfactant is generally used as an auxiliary means to promote migration of oil pollutants to the water phase, and is widely applied to the remediation of petroleum-polluted soil. Surfactants are naturally or synthetically made amphiphilic materials composed of both hydrophilic and hydrophobic moieties, including nonionic, anionic, cationic, amphoteric, gemini, biosurfactants, and the like. Flow enhancement and solubilization are two major mechanisms by which surfactants enhance the efficiency of petroleum hydrocarbon contaminant removal in soil and aquifers. The flow increasing function is to improve the migration capacity of petroleum hydrocarbon in the porous medium; solubilization is the increase in apparent solubility of petroleum hydrocarbons by the surfactant.

At present, the research on the degradation of Pseudocercospora diplusodonii on pollutants is less, and the related report on the degradation of petroleum hydrocarbon is not available at home and abroad.

Disclosure of Invention

The first object of the invention is to provide Pseudocercospora diplusodonii LJD-5 strain with the function of degrading polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon. The strain was deposited at the Guangdong province microbiological bacterial collection center (GDMCC) at 31, 2021, address: building 5, building 59, guangzhou City, guangdong, first, china, qinghai, china: 510070, accession number is: GDMCC No:61905.

the research reports that the strain is Pseudocercospora diplusodonii LJD-5, which is obtained by separating and identifying a soil sample from a petroleum pollution site in eastern east of Shandong, has few research on the degradation of pollutants, and has no related report on the degradation of benzo [ a ] pyrene (BaP) and petroleum hydrocarbon (TPH) at home and abroad. The research obtains 1 strain LJD-5 taking BaP as a carbon source from a soil sample obtained from a petroleum pollution site in eastern east Shandong, carries out strain identification and growth characteristic research. In addition, the microbial inoculum is prepared to explore the degradation characteristics of LJD-5 microbial inoculum on BaP and TPH, and is matched with a surfactant for use, so that a reference is provided for bioremediation of petroleum polluted soil.

A second object of the present invention is to provide a microbial agent comprising Pseudocercospora diplusodonii LJD-5 as an active ingredient.

Preferably, the microbial inoculum also comprises auxiliary materials capable of prolonging the activity time of the strain or other auxiliary materials acceptable by the microbial inoculum.

A third object of the present invention is to provide a composition comprising the microbial agent and a surfactant as described above.

Preferably, the surfactant is tween 80.

A fourth object of the present invention is to provide the use of Pseudocercospora diplusodonii LJD-5, the microbial inoculum described above or the composition described above in the bioremediation of an environment contaminated with polycyclic aromatic hydrocarbons and/or petroleum hydrocarbons.

Preferably, the polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon contaminated environment includes polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon contaminated soil and water bodies.

Preferably, the polycyclic aromatic hydrocarbon is benzo [ a ] pyrene.

A fifth object of the present invention is to provide a method for degrading polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon, wherein Pseudocercospora diplusodonii LJD-5, the microbial inoculum or the composition is applied to environment polluted by polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon to degrade polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon.

Preferably, the polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon contaminated environment includes soil and water.

According to the invention, a degradation strain LJD-5 taking BaP as a carbon source is obtained by domestication and separation from a soil sample obtained from a petroleum pollution site in eastern mountain areas, and the strain is identified as Pseudocercospora diplusodonii LJD-5 according to strain morphology, physiological characteristics, ITS gene sequencing analysis and phylogenetic analysis. The optimal environmental conditions for LJD-5 growth are: the temperature is 33 ℃ and the pH value is 5.0; the ITS gene sequencing analysis result of the strain shows that the strain most similar to LJD-5 is Pseudocercospora diplusodonii (the similarity is 99%). LJD-5 can use BaP as a carbon source at an initial concentration of 25 mg.L ^-1 After being cultured in the inorganic salt culture solution for 14d, the degradation rate can reach 73.5 percent. After the LJD-5 is prepared into a microbial inoculum, the degradation rates of the microbial inoculum on BaP and TPH are 75.3% and 76.6%, respectively, and after the microbial inoculum is matched with Tween 80, the degradation rates of the microbial inoculum on BaP and TPH are 90.4% and 80.61%, respectively. Therefore, the strain Pseudocercospora diplusodonii LJD-5 can have a stronger repairing effect on BaP and TPH when being used together with Tween 80. Therefore, the microbial inoculum has better application potential in the aspect of bioremediation of petroleum soil.

Pseudocercospora diplusodonii LJD-5, which was deposited at the Guangdong province microbiological bacterial collection center (GDMCC) at month 31 of 2021, address: building 5, building 59, guangzhou City, guangdong, first, china, qinghai, china: 510070, accession number is: GDMCC No:61905.

drawings

FIG. 1 shows the front (left) and back (right) of the strain LJD-5 grown on PDA medium for 72 h.

FIG. 2 is a phylogenetic relationship based on ITS gene sequences of strain LJD-5 and related bacteria thereof; the construction method was a contiguous method, the bootstrap setting was repeated 1000 times, only the results with bootstrap values greater than 25% are shown, and the scale bar 0.005 represents the substitution rate of each nucleotide.

FIG. 3 shows the growth of strain LJD-5 under different conditions.

FIG. 4 shows the degradation efficiency of LJD-5 bacterial agent and Tween 80 (initial concentration of 25 mg.L respectively) in inorganic salt medium containing BaP and TPH ^-1 And 500 mg.L ^-1 )。

Detailed Description

The following examples are further illustrative of the invention and are not intended to be limiting thereof.

Example 1: isolation and characterization of Pseudocercospora diplusodonii LJD-5

1. Sample source

Soil samples are obtained from a certain petroleum pollution site in eastern mountain east, high-concentration BaP is used as a carbon source for long-term domestication, and efficient BaP bacteria reduction is obtained through multiple screening, separation and purification.

2. Culture medium

2.1 inorganic salt Medium

The inorganic salt culture medium is used for enrichment culture of microorganisms in a sample, and BaP degradation experiments under the condition of pure bacteria and microbial inoculum. The formulation of the medium is shown in Table 1. The preparation method comprises adding the above materials into water, stirring, mixing, and sterilizing.

TABLE 1 inorganic salt Medium formulation

2.2 nutrient Medium

The nutrient medium is used for culturing conventional microorganisms such as fungus separation, purification, preservation, activation and the like. The liquid nutrient medium types and compositions used in this experiment are shown in Table 2. If the experiment needs to prepare a solid culture medium, 1.5-2% of agar powder is added on the basis of the original culture medium formula. If the culture conditions of the strain are not particularly specified, the pH of the medium is adjusted to 6. The preparation method comprises adding the above materials into water, stirring, mixing, and sterilizing.

TABLE 2 Potato-Dextrose broth (PDA) composition

3. Domestication, screening and isolation of strains

Adding the collected contaminated soil into enrichment medium, and adding streptomycin sulfate and penicillin (final concentration is 100 μg/mL) to inhibit bacterial growth at concentration of 100deg.C ^-1 BaP of (C) is used as a degradation substrate and placed in a 28 ℃ incubator for shake culture in dark. The strain is domesticated by using an inorganic salt culture medium with BaP as a carbon source, and 7d is a domestication period. The 10% volume fraction of inoculum was transferred to fresh enrichment medium with the same culture system and the enrichment procedure repeated three times.

The fourth generation enrichment culture sample obtained above is subjected to coating separation by a dilution plate method, and the sample is separated by a nutrient medium. Culturing the coated sample at original culture temperature for about 48 hr to form obvious single colony on the surface of the culture medium, picking different single colonies according to the shape, size, color, mycelium and other characteristics of the colony, and streaking and purifying on a nutrient medium plate for culturing. If single colonies with different characteristics can still be observed on the plate subjected to streak purification, streak separation is carried out again until only single colonies with the same characteristics can be observed on the same plate. 1 strain LJD-5 with high-efficiency degradation performance on BaP is obtained by screening in an experiment. And (3) picking the purified single colony to a corresponding solid test tube nutrient medium for culture, sealing and preserving by sterilized liquid paraffin, and standing at 4 ℃ for long-term preservation.

4. Identification of strains

And (5) carrying out preliminary identification on the strain according to morphological characteristics, physiological characteristics and hyphae of the strain.

4.1 morphological features

LJD-5 is a fungus isolated from soil samples obtained from a petroleum contaminated site in east camps, and after activation, after 72h growth on PDA plates at 28℃under aerobic conditions, a dark gray, circular colony with a diameter of 4.6mm was formed (FIG. 1). The bacteria are obligate aerobic bacteria.

4.2 molecular biological Properties

Molecular biological characterization mainly includes sequencing and phylogenetic tree construction. Before sequencing and construction of phylogenetic tree, it is necessary to extract DNA of fungus (the rapid extraction kit for fungal genomic DNA used for experiments is available from Shanghai Co., ltd.). In order to study the taxonomy of fungi, it is generally necessary to amplify ITS gene, which is a piece of DNA in the eukaryotic part encoding rRNA, and to construct phylogenetic tree, which is usually used for detecting and identifying fungi due to ITS high degree of conservation, specificity and proper sequence length.

The Polymerase Chain Reaction (PCR) is mainly used for amplifying different gene fragments, and different primers are needed for the PCR (ITS 1:5'-TCCGTAGGTGAACCTGCGG-3'; ITS4: 5'-TCCTCCGCTTATTGATATGC-3'), and the PCR amplification reaction system is that: 10 Xbuffer 2.5. Mu.L, mg ²⁺ (25 mmol/L) 1.5. Mu.L, dNTP (25 mmol/L) 0.3. Mu.L, forward primer (10 mmol/L) 0.5. Mu.L, reverse primer (10 mmol/L) 0.5. Mu.L, taq enzyme: 0.25. Mu.L, DNA set template 0.1. Mu.L, deionized water 19.35. Mu.L. PCR amplification reaction conditions: pre-denaturation at 95℃for 3min, 45s at 95℃and annealing at 56℃for 30s, extension at 72℃for 45s,30 cycles. Extending at 72deg.C for 10min, and preserving at 4deg.C. Amplifying desired gene, preparing gel block with 0.75-1% agarose and adding nucleic acid coloring agent GelRed, adding PCR product and DNA marker (maker) containing fragments of various lengths into gel block, placing into electrophoresis apparatus, and loading into electrophoresis apparatusTBE (Tris boric acid) buffer solution is used for ensuring that the electrophoresis apparatus works for 20min under a certain voltage, and then the electrophoresis apparatus is taken out and placed under an ultraviolet lamp of 300nm for observation so as to confirm that the PCR product amplification reaction is successful. And then the amplified PCR product is sent to Huada gene technology Co.Ltd for sequencing, and the sequencing primer is identical to the amplification primer.

The sequence of the fungal ITS gene obtained by the sequencing is uploaded to NCBI, and the website compares the submitted sequence with ITS gene sequences of typical strains of known species to obtain similarity information between the sequences. According to the result analysis of the sequence comparison, the corresponding typical strain can be selected as the model strain of the experimental isolated strain, meanwhile, the ITS gene sequence of the model strain can be obtained, and phylogenetic analysis is constructed to prove that the model strain is different from the experimental isolated strain, so that the isolated strain is identified. Phylogenetic tree construction using MEGA 5.05 procedure, the evolutionary tree is usually constructed using the adjacency method, the minimal evolutionary method and the maximal reduction method, with adjacency method being the most commonly used, the self-expanding value is often set to be repeated 1000 times.

The ITS gene comparison shows that the similarity of the strain and Pseudocercospora diplusodonii gene is 99%. From the above results, it was found that the fungus LJD-5 isolated in the present experiment was Pseudocercospora diplusodonii.

And (3) utilizing the ITS gene sequence of the LJD-5 (the sequence of which is shown as SEQ ID NO. 1) and the ITS gene sequence with higher similarity to prepare a phylogenetic tree, thereby obtaining a homology result between the ITS gene of the LJD-5 and the ITS gene with higher similarity. Phylogenetic tree constructed by the orthotopic approach is shown in FIG. 2.

The ITS gene sequence of LJD-5 is shown as SEQ ID NO.1, and specifically comprises the following steps:

TACTGAGTGAGGGCTCCGCCCGACCTCCACCCTTTGTGAACCAAACTTGTTGCTTCGG

GGGCGACCCTGCCGACGACTTCGTCGCCGGGCGCCCCCGGAGGTCTTCTAAACACTG

CATCTTTGCGTCGGAGTTTAAACAAATTAAACAAAACTTTCAACAACGGATCTCTTGG

TTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC

AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCC

TGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGTTTTCCG

CGCGCCTTAAAGTCTTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGGATTTTTCAATT

CGCTTCGGAGTGCGGGTGGCCGCGGCCGTTAAATCTTTATTCAAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAAGCCGGAGGAA。

the above results indicate that the isolated strain LJD-5 of the present invention is Pseudocercospora diplusodonii, which was designated Pseudocercospora diplusodonii LJD-5 and deposited at the Guangdong province microbiological bacterial deposit center (GDMCC) at month 31 of 2021, address: building 5, building 59, guangzhou City, guangdong, first, china, qinghai, china: 510070, accession number is: GDMCC No:61905.

example 2: growth conditions of Pseudocercospora diplusodonii LJD-5

1. Measurement of growth temperature: preparing liquid nutrient medium (formula shown in Table 2) required by strain growth, and sterilizing in a sterilizing pot. The activated strain LJB-5 is inoculated into a culture medium (experimental group), the culture medium without inoculating bacteria is used as a control (control group), the culture medium is put into different temperatures for culturing for 7 days, the control group and the experimental group corresponding to each temperature are repeated three times, the growth condition of the bacteria is observed every day, after 7 days, the culture medium is poured into a weighed centrifuge tube, centrifuged at 2500rpm for 30min, the supernatant is poured out, and the culture medium is put into a 60 ℃ oven for baking until the weight is constant, and the fungal mycelium dry weight is calculated by weighing. The test temperatures were as follows: 18 ℃, 23 ℃, 28 ℃, 33 ℃ and 38 ℃.

2. Determination of growth pH: preparing a liquid nutrient medium (formula shown in Table 2) required by strain growth, and regulating pH of the culture solution with the following buffer system, wherein the pH is 4.0-5.0,0.1mol/L sodium citrate and 0.1mol/L citric acid; pH 6.0-8.0,0.1mol/L NaOH and 0.1mol/L KH ₂ PO ₄ ；pH 9.0，0.1mol/L NaHCO ₃ And 0.1mol/LNa ₂ CO ₃ . Inoculating activated strain LJB-5 into culture medium, repeating each pH three times, culturing for 7d at optimal temperature for strain growth with culture medium without inoculating bacteria as control, and culturing for 7d every dayAfter 7d, pouring the culture medium into a weighed centrifuge tube, centrifuging at 2500rpm for 30min, pouring out the supernatant, putting into a 60 ℃ oven, drying to constant weight, and weighing to calculate the dry weight of fungus hyphae. The pH tested was as follows: 4.0, 5.0, 6.0, 7.0, 8.0, 9.0.

As shown in FIG. 3, LJD-5 can grow in a nutrient medium at 18-38deg.C, and the optimal growth temperature is 33 deg.C; the strain can grow under the pH condition of 4.0-9.0, and the optimal growth pH is 5.0.

Example 3: degradation experiments of BaP and TPH

1. Preparation of microbial inoculum

(1) Heating corn and water according to a mass ratio of 1:5 to form paste, adding wood dust (sieving with a 200-mesh sieve) according to a mass ratio of 125:100:10:1, and performing low-temperature kneading to form a ball. Putting the mixture of the bulk culture medium into a pill rolling machine to prepare spherical culture medium with the diameter of 8mm, sterilizing and drying for later use.

(2) The cultured LJD-5 fungus is prepared into fungus liquid with the mycelium content of 10 g/L.

(3) Adding the bacterial liquid into sodium alginate solution with the mass fraction of 3% according to the volume ratio of 1:10, fully mixing the spherical culture medium with the solution, adding sterile calcium chloride solution with the final concentration of 4% by mass after the completion of the culture, and carrying out hardening treatment for 20min to obtain the pellet-shaped encapsulated fungi.

(4) And (3) filling the encapsulated fungus pellets into a sterile culture bag, culturing for 3-7d in a culture box at the temperature of 28 ℃, and obtaining the LJD-5 microbial inoculum after the surfaces of the fungus pellets are full of white hyphae.

2. According to the experimental results of example 2, the optimal growth condition of strain LJD-5 was determined to be a temperature of 33℃and a pH of 5.0. Degradation experiments of LJD-5 microbial inoculum and LJD-5 microbial inoculum added with 0.1% of Tween 80 in mass fraction in high concentration BaP and TPH are carried out under the condition. Inoculating LJD-5 bacterial agent after 7d culture and LJD-5 bacterial agent added with Tween 80 into a culture medium containing 25 mg.L of initial concentration according to the mass ratio of 10% ^-1 BaP and 500 mg.L of (C) ^-1 In the medium of inorganic salts of TPH, shaking culture was carried out for 14 days, and each treatment was repeated 3 times. The treatment without the addition of the microbial inoculum was a control treatment.

The samples were taken for chemical analysis as follows: (1) sample pretreatment: each culture sample was extracted with methylene chloride while adding 5. Mu.L of a recovery rate indicator (BaP-d 10) at a concentration of 200mg/L, and after sufficient shaking, it was transferred to a separating funnel and allowed to stand. The organic phase was collected after delamination, the lower liquid was returned to the shake flask and repeatedly extracted with an equal volume of dichloromethane, the extracts were combined and transferred to a flat bottom flask containing a suitable amount of activated copper flakes for rotary evaporation, concentrated to about 2mL, a small amount of n-hexane (about 5 mL) was added, rotary evaporated to 2mL, washing repeated three times, and the organic solvent was replaced with n-hexane. The replaced concentrate was purified by a glass packed column (diameter: about 9 mm). The column packing was 3cm 3% deactivated neutral alumina, 3cm 3% deactivated silica gel and 1cm anhydrous sodium sulfate from bottom to top. The column was activated with an appropriate amount of n-hexane, the packed column was rinsed with 15mL of n-hexane/dichloromethane (volume ratio 1:1) mix, and the eluate was collected with a brown reagent bottle, concentrated to about 0.5mL by nitrogen blowing, and finally transferred to a 1.5mL cell bottle for cryopreservation. 5. Mu.L of hexamethylbenzene as an internal standard was added to the sample before measurement on the machine, and the concentration was 200mg/L. (2) instrumental analysis: the PAHs content of each treated sample was determined using Agilent 7890 gas chromatograph-5975 mass spectrometer in combination. The chromatographic column used was an Agilent DB 5-MS capillary chromatographic column (column length 30m, inner diameter 0.25mm, film thickness 0.25 μm). Agilent 7890 gas chromatograph-5975 mass spectrometer was used in combination to determine PAHs content. The separation analysis was carried out using Agilent DB 5-MS (column length 30m, inner diameter 0.25mm, film thickness 0.25 μm) capillary chromatography column. The resulting data were processed with an Agilent chromatography workstation and BaP quantification was performed using a 6-point calibration curve and internal standard. And the concentration of the microbial cells is measured by adopting a drying weighing method.

Petroleum Hydrocarbons (TPH) are extracted and analyzed according to the method of national standard HJ 894-2017.

The LJD-5 bacterial agent and the LJD-5 bacterial agent combined with Tween 80 can degrade BaP and TPH according to the measurement and analysis of GC and GC-MS, and respectively contain 25 mg.L ^-1 BaP and 500 mg.L ^-1 After 14 days of culture in the inorganic salt culture solution of TPH, the degradation rate can reach more than 75 percent (figure 4). Wherein the LJD-5 microbial inoculum has degradation rates to BaP and TPH respectively75.3% and 76.6%, and the degradation rate of LJD-5 bacterial agent combined with Tween 80 is 90.4% and 80.61%. The LJD-5 microbial inoculum is a powerful bacterium capable of degrading BaP and TPH, and the degradation efficiency is further improved after being combined with Tween 80.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that the above-mentioned preferred embodiment should not be construed as limiting the invention, and the scope of the invention should be defined by the appended claims. It will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the spirit and scope of the invention, and such modifications and adaptations are intended to be comprehended within the scope of the invention.

Claims

1.Pseudocercospora diplusodonii LJD-5, accession number: GDMCC No. 61905.

2. A microbial agent comprising Pseudocercospora diplusodonii LJD-5 as defined in claim 1 as an active ingredient.

3. The microbial agent of claim 2, further comprising an adjuvant that extends the activity time of the strain, or an adjuvant acceptable to other microbial agents.

4. A composition comprising the microbial agent of claim 2 and a surfactant.

5. The composition of claim 4, wherein the surfactant is tween 80.

6. Use of Pseudocercospora diplusodonii LJD-5 of claim 1, a microbial inoculum of claim 2 or a composition of claim 4 in the bioremediation of a polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon contaminated environment.

7. The use of claim 6, wherein the polyaromatic hydrocarbon and/or petroleum hydrocarbon contaminated environment comprises polyaromatic hydrocarbon and/or petroleum hydrocarbon contaminated soil and water.

8. The use according to claim 6 or 7, wherein the polycyclic aromatic hydrocarbon is benzo [ a ] pyrene.

9. A method for degrading a polycyclic aromatic hydrocarbon and/or a petroleum hydrocarbon, comprising applying Pseudocercospora diplusodonii LJD-5 of claim 1, a microbial inoculum of claim 2 or a composition of claim 4 to a polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon contaminated environment to degrade the polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon.

10. The method of claim 9, wherein the polycyclic aromatic hydrocarbon and/or petroleum hydrocarbon contaminated environment comprises soil and water.