CN116507722A - DNA-containing polynucleotides and guides for CRISPR V-type systems and methods of making and using the same - Google Patents

Abstract

The present disclosure provides a guide for a V-type CRISPR system, wherein such guide contains a ribonucleotide base and at least one deoxyribonucleotide base. CRISPR Cas12 guides containing at least one deoxyribonucleotide base are also described, as well as V-type CRISPR-Cas12 proteins and nucleoprotein complexes of such guides. Methods for making and using deoxyribonucleotide-containing polynucleotides and guides, and methods for making and using the nucleoprotein complexes are also disclosed. Also disclosed are methods of engineering cells to produce CAR-expressing cells using the Cast 2chRDNA guide/nucleoprotein complex; and the use of such CAR-expressing cells in adoptive cell therapy.

Description

DNA-containing polynucleotides and guides for CRISPR V-type systems and methods of making and using the same

Cross Reference to Related Applications

The present application claims priority from U.S. provisional application serial No. 63/229,870, filed 8/5/2021, U.S. provisional application serial No. 63/127,648, filed 12/18/2020, and U.S. provisional application serial No. 63/093,459, filed 10/19/2020, which are all incorporated herein by reference.

Statement regarding federally sponsored research or development

Is not applicable.

Sequence listing

The present application contains a sequence listing, which has been electronically submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy created at 10 and 15 of 2021 is named CBI039.30_st25.txt and is 165 kilobytes in size.

Technical Field

The present disclosure relates generally to Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems. In particular, the present disclosure relates to CRISPR polynucleotides and guides for CRISPR-Cas12 systems, wherein the CRISPR polynucleotides and Cas12 guides are designed to include a ribonucleotide base and one or more deoxyribonucleotide bases. The present disclosure also relates to Cas12 guide/nucleoprotein complexes comprising engineered CRISPR Cas12 guides and CRISPR-Cas12 proteins, and to the use of such Cas12 guide/nucleoprotein complexes to produce modified cells. The disclosure also relates to compositions containing CRISPR polynucleotides, cas12 guides, and Cas12 guide/nucleoprotein complexes, and methods of making and using the compositions. Furthermore, the present disclosure also relates to the production and therapeutic use of cells modified using Cas12 guide/nucleoprotein complexes of the disclosure, and for example in producing Chimeric Antigen Receptor (CAR) -expressing cells for the treatment of cancer.

Background

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) protein systems are found in the genomes of many prokaryotes (bacteria and archaebacteria). These systems provide adaptive immunity to external invaders (e.g., viruses, phages) in prokaryotes. In this way, the CRISPR system functions as a type of immune system to help prokaryotes defend against foreign intruders. See, e.g., barrangou et al (Science, 2007, 315:1709-1712); makarova et al (Nature Reviews Microbiology,2011, 9:467-477); garneau et al (Nature, 2010, 468:67-71); sapranauseas et al (Nucleic Acids Research,2011, 39:9275-9282); koonin et al (Curr. Opin. Microbiol.,2017, 37:67-78); shmakov et al (Nat. Rev. Microbiol.,. 2017,15 (3): 169-182); makarova et al (Nat. Rev. Microbiol.,2020, 18:67-83).

There are three main phases of the CRISPR-Cas immune system: (1) obtaining, (2) expression, and (3) interference. The genome comprising the cut invasive virus and plasmid is obtained and a segment of genomic DNA, known as a protospacer (protospacer), is integrated into the CRISPR locus of the host organism. The segment integrated into the host genome is called a spacer, which mediates protection from subsequent attacks by the same (or sufficiently related) virus or plasmid. Expression involves transcription of the CRISPR locus and subsequent enzymatic processing to produce short mature CRISPR RNA, each containing a single spacer sequence. After CRISPR RNA associates with the Cas protein to form an effector complex (effector complex), interference is induced, and then the effector complex targets the complementing proto-spacer in the exogenous genetic element to induce nucleic acid degradation.

Various CRISPR-Cas systems in their natural hosts are capable of DNA targeting (type I; type II and type V), RNA targeting (type 2 VI), and common DNA and RNA targeting (type 1 III). See, e.g., makarova et al (Nat. Rev. Microbiol.,2015, 13:722-736); shmakov et al (Nat. Rev. Microbiol.,2017, 15:169-182); abudayyeh et al (Science, 2016, 353:1-17); and Makarova et al (The CRISPR Journal,2018, 1:325-336).

The V-type system is divided into several different subtypes, including, for example, V-A, V-B, V-C, V-D, V-E, V-F, V-G, V-H, V-I, V-J, V-K and V-U. See, for example, makarova et al (Nat. Rev. Microbiol.,2020, 18:67-83) and Pausch et al (Science, 2020,369 (6501):333-337). The V-Sup>A subtype encodes Cas12 Sup>A protein (previously referred to as Cpf 1). Cas12a has a RuvC-like nuclease domain that is homologous to the corresponding domain of Cas9, but lacks the HNH nuclease domain present in the Cas9 protein.

Among several bacteria, a V-type system has been identified, including total bacteria of the genus galbanum (Parcubacteria bacterium) gwc2_44_17 (PbCpf 1), bacteria of the family trichomonadaceae (Lachnospiraceae bacterium) MC2017 (Lb 3 Cpf 1), vibrio proteolyticus (Butyrivibrio proteoclasticus) (BpCpf 1), bacteria of the family heteromycotina (Peregrinibacteria bacterium) GW2011_gwa_33_10 (pepcf 1), amino acid cocci (acidococcus sp) BV3L6 (asccf 1), porphyromonas kii (Porphyromonas macacae) (PmCpf 1), bacteria of the family trichosporogenes ND2006 (LbCpf 1), porphyromonas canis (Porphyromonas crevioricanis) (PcCpf 1), prasugrel peptone (Prevotella disiens) (PdCpf 1), moraxella bullosa (Moraxella bovoculi) 237 (mbf 1), smithla (smithlla) sc_k08D17 (SsCpf 1), leptospira (Cpf 2) (PmCpf 1), ralstonia crispa (fcca (fcf) and (fcco) 24) and (fcco) of the family trichotheca (fceridae) bacteria (fcf 1).

CRISPR-Cas systems provide powerful tools for site-directed genome editing by deleting, inserting, mutating or substituting specific nucleic acid sequences. Alterations may be gene-specific or site-specific. Genome editing can cleave target nucleic acids using a site-directed nuclease, such as Cas proteins and their cognate polynucleotides, resulting in altered sites. In some cases, cleavage may introduce Double Strand Breaks (DSBs) in the target DNA sequence. DSBs may be repaired, for example, by non-homologous end joining (NHEJ), micro-homologous mediated end joining (MMEJ), or Homology Directed Repair (HDR). HDR relies on the presence of templates for repair. In some examples of such genome editing, the donor polynucleotide or portion thereof may be inserted into the break.

Disclosure of Invention

The present disclosure is based on the discovery of novel polynucleotides and guides for a V-type CRISPR-Cas system, comprising a ribonucleotide base and one or more deoxyribonucleotide bases. The disclosed guides, when complexed with a V-type CRISPR-Cas protein such as Cas12a, enable robust on-target editing and reduced off-target genome editing.

This method of genome editing is particularly useful for generating genetically modified cells for therapeutic applications. For example, immune cells (e.g., T cells) can be genetically modified to express a CAR by such genomic editing methods. Such CAR-expressing cells can be used, for example, in adoptive immunotherapy, in which CAR-expressing immune cells, such as T cells (CAR-T cells), can be infused into a patient to target cells that express a target antigen (e.g., a foreign antigen or a cancer-related antigen) recognized by the CAR.

Non-limiting embodiments of the present disclosure include the following.

[1] A CRISPR guide molecule comprising: a targeting region capable of binding to a target nucleic acid sequence; and an activation region capable of forming a nucleoprotein complex with a Cas12 protein, wherein the CRISPR guide molecule comprises a ribonucleotide base and at least one deoxyribonucleotide base.

[2] The CRISPR guide molecule of [1], wherein said CRISPR guide molecule comprises at least one deoxyribonucleotide base in said activation region, said targeting region, or both.

[3] The CRISPR guide molecule of [1], wherein said CRISPR guide molecule further comprises one or more base analogues selected from the group consisting of: inosine, deoxyinosine, deoxyuracil, xanthosine, C3 spacer, 5-methyl dC, 5-hydroxybutyyne-2' -deoxyuridine, 5-nitroindole, 5-methylisodeoxycytosine, isodeoxyguanosine, deoxyuridine, isodeoxycytidine.

[4] The CRISPR guide molecule of [1], wherein said CRISPR guide molecule further comprises one or more abasic sites.

[5] The CRISPR guide molecule of [1], wherein said CRISPR guide molecule is selected from the group consisting of: a CRISPR guide molecule comprising an RNA sequence UAAUUUCUACUCUUGUAGAUGAGUCUCUCAGCUGGUACAC, wherein at least one base in said sequence is replaced with a corresponding deoxyribonucleotide base, and optionally at least one base in said sequence is replaced with a base analogue or abasic site; and a CRISPR guide molecule comprising an RNA sequence UAAUUUCUACUCUUGUAGAUAGUGGGGGUGAAUUCAGUGU, wherein at least one base in said sequence is replaced with a corresponding deoxyribonucleotide base, and optionally at least one base in said sequence is replaced with a base analogue or abasic site.

[6] The CRISPR guide molecule of [5], wherein the amount of deoxyribonucleotide bases in the CRISPR guide molecule is 50% or less of the total size of the CRISPR guide molecule.

[7] The CRISPR guide molecule of [6], wherein the amount of deoxyribonucleotide bases in the CRISPR guide molecule is 25% or less of the total size of the guide molecule.

[8] The CRISPR guide molecule of [5] wherein the amount of deoxyribonucleotide bases in the targeting region is 25% or less of the total size of the targeting region.

[9] The CRISPR guide molecule of [8], wherein the amount of deoxyribonucleotide bases in the targeting region is 5% or less of the total size of the targeting region.

[10] The CRISPR guide molecule of [5] wherein the amount of deoxyribonucleotide bases in the activating region is 50% or less of the total size of the activating region.

[11] The CRISPR guide molecule of [10] wherein the amount of deoxyribonucleotide bases in the activating region is 25% or less of the total size of the activating region.

[12] The CRISPR guide molecule of [5], wherein the CRISPR guide molecule has reduced off-target activity compared to an RNA-only CRISPR guide molecule that binds the target nucleic acid sequence and is capable of forming a nucleoprotein complex with the Cas12 protein.

[13] The CRISPR guide molecule of [5] wherein one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39 and 40 in the sequence comprises deoxyribonucleotide bases.

[14] The CRISPR guide molecule of [13], wherein fifteen or less of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39 and 40 in the sequence comprise deoxyribonucleotide bases.

[15] The CRISPR guide molecule of [14] wherein twelve or fewer of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39 and 40 in the sequence comprise deoxyribonucleotide bases.

[16] The CRISPR guide molecule of [2], wherein said CRISPR guide molecule comprises an activating region comprising an RNA sequence UAAUUUCUACUCUUGUAGAU, wherein at least one base in said sequence is replaced with a corresponding deoxyribonucleotide base, and optionally at least one base in said sequence is replaced with a base analog or abasic site.

[17] The CRISPR guide molecule of [16] wherein one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in the sequence comprises a deoxyribonucleotide base.

[18] The CRISPR guide molecule of [17], wherein ten or less of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in said sequence comprise deoxyribonucleotide bases.

[19] The CRISPR guide molecule of [18], wherein eight or less of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in the sequence comprise deoxyribonucleotide bases.

[20] The CRISPR guide molecule of [2], wherein said CRISPR guide molecule comprises a targeting region comprising an RNA sequence GAGUCUCUCAGCUGGUACAC, wherein at least one base in said sequence is replaced with a corresponding deoxyribonucleotide base, and optionally at least one base in said sequence is replaced with a base analogue or abasic site.

[21] The CRISPR guide molecule of [20], wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in said sequence comprises a deoxyribonucleotide base.

[22] The CRISPR guide molecule of [21], wherein five or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in the sequence comprise deoxyribonucleotide bases.

[23] The CRISPR guide molecule of [22], wherein three or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in said sequence comprise deoxyribonucleotide bases.

[24] The CRISPR guide molecule of [2], wherein said CRISPR guide molecule comprises a targeting region comprising an RNA sequence AGUGGGGGUGAAUUCAGUGU, wherein at least one base in said sequence is replaced with a corresponding deoxyribonucleotide base, and optionally at least one base in said sequence is replaced with a base analogue or abasic site.

[25] The CRISPR guide molecule of [24], wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in said sequence comprises a deoxyribonucleotide base.

[26] The CRISPR guide molecule of [25] wherein five or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in the sequence comprise deoxyribonucleotide bases.

[27] The CRISPR guide molecule of [26], wherein three or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in said sequence comprise deoxyribonucleotide bases.

[28] The CRISPR guide molecule of [5], wherein the CRISPR guide molecule comprises a sequence TAAUUUCUACUCUTGUAGAUGAGUCUCUCAGCUGGUACAC, wherein positions 2, 4, 5, 6, 8, 9, 11, 13, 16, 17, 18, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 38 and 39 in the sequence comprise ribonucleotide bases, and wherein positions 1, 3, 7, 10, 12, 14, 15, 19, 21, 31 and 40 in the sequence comprise deoxyribonucleotide bases.

[29] The CRISPR guide molecule of [5], wherein the CRISPR guide molecule comprises a sequence TAAUUUCUACUCUTGUAGAUAGUGGGGGUGAAUUCAGUGT, wherein positions 2, 4, 5, 6, 8, 9, 11, 13, 16, 17, 18, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 38 and 39 in the sequence comprise ribonucleotide bases, and wherein positions 1, 3, 7, 10, 12, 14, 15, 19, 21, 31 and 40 in the sequence comprise deoxyribonucleotide bases.

[30] The CRISPR guide molecule of [2], wherein the activating region is 20 bases in length, and wherein one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in the 20 nucleotide activating region sequence comprises deoxyribonucleotide bases.

[31] The CRISPR guide molecule of [30], wherein ten or less of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in said sequence comprise deoxyribonucleotide bases.

[32] The CRISPR guide molecule of [31], wherein eight or less of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in said sequence comprise deoxyribonucleotide bases.

[33] The CRISPR guide molecule of [2], wherein the targeting region is 20 bases in length, and wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in the 20 nucleotide targeting region sequence comprises deoxyribonucleotide bases.

[34] The CRISPR guide molecule of [33], wherein five or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in said sequence comprise deoxyribonucleotide bases.

[35] The CRISPR guide molecule of [34], wherein three or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in said sequence comprise deoxyribonucleotide bases.

[36] A CRISPR nucleic acid/protein composition comprising the CRISPR guide molecule of any of [1] to [35] and a Cas12 protein.

[37] The CRISPR nucleic acid/protein composition of [36], wherein said CRISPR guide molecule is in complex with said Cas12 protein.

[38] The CRISPR nucleic acid/protein composition of [36], wherein said Cas12 protein is a Cas12a protein.

[39] The CRISPR nucleic acid/protein composition of any of [36] to [38], wherein said Cas12 protein comprises at the C-terminus a sequence comprising a linker and an NLS having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs 479-490.

[40] The CRISPR nucleic acid/protein composition of claim 39, wherein said linker and NLS containing sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 483. 485, 487 and 489.

[41] A cell comprising the CRISPR guide molecule of any of [1] to [35 ].

[42] The cell of [41], further comprising a Cas12 protein.

[43] The cell of [42], wherein the Cas12 protein is a Cas12a protein.

[44] The cell of [42] or [43], wherein the Cas12 protein comprises at the C-terminus a sequence comprising a linker and an NLS that has at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 479-490.

[45] The cell of [44], wherein the linker and NLS-containing sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 483, 485, 487 and 489.

[46] The cell of any one of [42] to [45], wherein the CRISPR guide molecule is in complex with the Cas12 protein.

[47] The cell of any one of [41] to [46], wherein the cell is a prokaryotic cell or a eukaryotic cell.

[48] The cell of [47], wherein the cell is a eukaryotic cell selected from the group consisting of: unicellular eukaryotic organisms, cells of eukaryotic organisms, protozoan cells, cells from plants, algal cells, fungal cells, animal cells, cells from invertebrates, cells from vertebrates, cells from mammals, stem cells and progenitor cells.

[49] The cell of [48], wherein the cell is a lymphocyte, a Chimeric Antigen Receptor (CAR) T cell, a T Cell Receptor (TCR) cell, a TCR-engineered CAR-T cell, a tumor-infiltrating lymphocyte (TIL), a CAR TIL, a Dendritic Cell (DC), a CAR-DC, a macrophage, a CAR-macrophage (CAR-M), a Natural Killer (NK) cell, or a CAR-NK cell.

[50] The cell of [49], wherein the cell is a CAR-T cell.

[51] The cell of any one of [41] to [50], further comprising a donor polynucleotide.

[52] A method of cleaving a target nucleic acid sequence, the method comprising: contacting a first target nucleic acid sequence with a nucleoprotein complex comprising a catalytically active Cas12 protein and a first CRISPR guide molecule, wherein the first CRISPR guide molecule comprises the CRISPR guide molecule of any of [1] to [35], wherein a targeting region of the first CRISPR guide molecule is capable of hybridizing to the first target nucleic acid sequence, and the nucleoprotein complex is capable of cleaving the first target nucleic acid sequence.

[53] The method of [52], further comprising providing a donor polynucleotide.

[54] The method of [53], wherein the target nucleic acid sequence is cleaved to provide a cleavage site, and the method further comprises modifying the target nucleic acid sequence.

[55] The method of [54], wherein the modification comprises inserting at least a portion of the donor polynucleotide at the cleavage site.

[56] The method of [54], wherein the modification comprises deletion of one or more nucleotides at the cleavage site.

[57] The method of [55], wherein the target nucleic acid sequence is in a cell.

[58] The method of [57], wherein the cell comprises a eukaryotic cell.

[59] The method of [58], wherein the donor polynucleotide comprises a CAR expression vector.

[60] The method of [59], further comprising introducing the CAR expression vector into the cell using a viral vector.

[61] The method of [60], wherein the introducing comprises transduction.

[62] The method of any one of [57] to [61], wherein the resulting cell comprises a lymphocyte, a CAR-T cell, a TCR-engineered CAR-T cell, a TIL, a CAR-TIL, a dendritic cell, a CAR-DC, a macrophage, a CAR-M, NK cell, or a CAR-NK cell.

[63] The method of any one of [52] to [62], wherein the first target nucleic acid sequence is within a target gene encoding a protein selected from the group consisting of: TRAC; TRBV; beta-2 microglobulin (B2M); PD1; PD-L1; CTLA-4; LAG-3; TIGIT; TIM3; HLA-E; HLA-A; HLA-B; HLA-C; HLA-DRA; ADAM17; BTLA; CD160; SIGLEC10;2B4; LAIR1; CD52; CD96; VSIR; VISTA; KIR2DL1; KIR2DL2; KIR2DL3; CEACAM1; CBLB; CISH; IL-1R8; AHR; an adenosine 2A receptor; GMCSF; VISTA; CII2A and NKG2A.

[64] The method of any one of [59] to [61], wherein the CAR expression vector encodes a CAR comprising an extracellular ligand binding domain.

[65] The method of [64], wherein the CAR expression vector further encodes a hinge region, a transmembrane region, and one or more intracellular signaling regions.

[66] The method of [64] or [65], wherein the extracellular ligand-binding domain comprises an immunoglobulin single chain variable fragment (scFv).

[67] The method of [66], wherein the scFv is capable of binding to a cellular target selected from the group consisting of: CD37, CD38, CD47, CD73, CD4, CS1, PD-L1, NGFR, ENPP3, PSCA, CD79B, TACI, VEGFR2, B7-H3, B7-H6, B Cell Maturation Antigen (BCMA), CD123, CD138, CD171/L1CAM, CD19, CD20, CD22, CD30, CD33, CD70, CD371, CEA, sealing protein 18.1, sealing protein 18.2, CSPG4, EFGRvIII, epCAM, ephA2, epidermal growth factor receptor, erbB2 (HER 2), FAP, FR alpha, GD2, GD3, glypican 3, IL-11 Ralpha, IL-13 Ralpha 2, IL13 receptor alpha, lewis Y/LeY, mesothelin, MUC1, MUC16, NKG2D ligand, PD1, PSMA, ROR-1, SLAMF7, TAG72, ULBP and MICA/B proteins, VEGF2 and WT1.

[68] The method of claim 67, wherein the scFv is capable of binding to a cellular target selected from the group consisting of: BCMA, CD19, CD20, CD22, CD47, CD371, ROR-1, ephA2, MUC16, glypican 3, PSCA and sealing protein 18.2.

[69] The method of [68], wherein the scFv is capable of binding BCMA.

[70] The method of [68], wherein the scFv is capable of binding to CD371.

[71] The method of any one of [57] to [62] and [64] to [70], wherein the method further comprises contacting a second target nucleic acid sequence in the cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a second CRISPR guide molecule, wherein the second CRISPR guide molecule comprises a CRISPR guide molecule of any one of [1] to [35] that is capable of binding to a different target nucleic acid sequence than the first CRISPR guide molecule, wherein a targeting region of the second CRISPR guide molecule is capable of hybridizing to the second target nucleic acid sequence, and the nucleoprotein complex is capable of cleaving the second target nucleic acid sequence.

[72] The method of claim 71, wherein the first and second target nucleic acid sequences are each independently within a target gene encoding a protein selected from the group consisting of: TRAC; TRBV protein; beta-2 microglobulin (B2M); PD1; PD-L1; CTLA-4; LAG-3; TIGIT; TIM3; HLA-E; HLA-A; HLA-B; HLA-C; HLA-DRA; ADAM17; BTLA; CD160; SIGLEC10;2B4; LAIR1; CD52; CD96; VSIR; VISTA; KIR2DL1; KIR2DL2; KIR2DL3; CEACAM1; CBLB; CISH; IL-1R8; AHR; an adenosine 2A receptor; GMCSF; VISTA; CII2A and NKG2A.

[73] The method of [71] or [72], wherein the donor polynucleotide comprises a CAR expression vector, wherein the CAR comprises an extracellular ligand-binding domain, and wherein the extracellular ligand-binding domain comprises an scFv.

[74] The method of [73], wherein the scFv is capable of binding BCMA.

[75] The method of [73], wherein the scFv is capable of binding to CD371.

[76] The method of [72], wherein the first target nucleic acid sequence is within a gene encoding TRAC protein, and wherein the second target nucleic acid sequence is within a gene encoding PD1 protein.

[77] The method of [72], wherein the first target nucleic acid sequence is within a gene encoding TRAC protein, and wherein the second target nucleic acid sequence is within a gene encoding B2M protein.

[78] The method of [77], further comprising providing a second donor polynucleotide comprising a B2M-HLA-E fusion construct to the cell, wherein at least a portion of the second donor polynucleotide comprising the B2M-HLA-E fusion construct is inserted at a cleavage site of the second target nucleic acid sequence; and the B2M-HLA-E fusion construct encodes a fusion protein comprising, from N-terminus to C-terminus, a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence.

[79] The method of [69] or [74], wherein the anti-BCMA scFv comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID No. 474; and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO. 475.

[80] The method of [79], wherein the scFv further comprises a linker between the VH and the VL.

[81] The method of [80], wherein the linker comprises the amino acid sequence of SEQ ID NO:476, and a sequence of amino acids.

[82] The method of [81], wherein the scFv comprises the sequence of SEQ ID NO: 477.

[83] The method of [64] or [73], wherein the CAR comprises: scFv comprising VH and VL; a transmembrane domain; a costimulatory domain and an activation domain.

[84] The method of [83], wherein the transmembrane domain is a transmembrane domain derived from: t cell receptor alpha chain, T cell receptor beta chain, CD3 zeta chain, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or GITR.

[85] The method of [84], wherein the transmembrane domain comprises a transmembrane domain derived from CD 8.

[86] The method of [83], wherein the co-stimulatory domain is a co-stimulatory domain derived from: CD28, 4-1BB, GITR, ICOS-1, CD27, OX-40 or DAP10.

[87] The method of [86], wherein the costimulatory domain comprises the 4-1BB costimulatory domain.

[88] The method of [83], wherein the activation domain comprises a cd3ζ activation domain.

[89] The method of [83], wherein the transmembrane domain comprises a transmembrane domain derived from CD8, the costimulatory domain comprises a 4-1BB costimulatory domain, and the activation domain comprises a cd3ζ activation domain.

[90] The method of [83], wherein the VH comprises the amino acid sequence of SEQ ID NO:474 and the VL comprises the amino acid sequence of SEQ ID NO: 475.

[91] The method of any one of [59] - [62], [64] - [70], [73] - [75] and [78] - [90], wherein the polynucleotide sequence encoding the CAR in the CAR expression vector has a leader sequence at the 5' end.

[92] The method of [91], wherein the leader sequence comprises SEQ ID NO:478 nucleic acid sequence.

[93] The method of [91], wherein the CAR expression vector comprises a promoter.

[94] The method of [93], wherein the promoter comprises an MND promoter.

[95] The method of any one of [52] to [94], wherein the Cas12 protein comprises at the C-terminus a sequence comprising a linker and an NLS that has at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs 479-490.

[96] The method of [95], wherein the linker and NLS-containing sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 483. 485, 487 and 489.

[97] A cell produced by the method of any one of [57] to [96 ].

[98] A CAR-T cell produced by the method of any one of [59] to [96 ].

[99] The CAR-T cell of [98], wherein the CAR-T cell is an allogeneic CAR-T cell.

[100] The CAR-T cell of [98], wherein the CAR-T cell is an autologous CAR-T cell.

[101] A method of producing a CAR-T cell comprising performing the method of any one of [59] to [96] using a T lymphocyte as the cell.

[102] A method of adoptive cell therapy comprising administering to a subject in need thereof a cell produced by the method of any one of [57] to [96 ].

[103] A method of adoptive cell therapy comprising administering to a subject in need thereof a CAR-T cell produced by the method of any one of [59] - [96 ].

[104] A method of killing BCMA positive cancer cells, wherein the method comprises contacting BCMA positive cancer cells with CAR-T cells produced by the method of any one of [69], [74], and [90 ].

[105] The method of [104], wherein the BCMA positive cancer cells comprise multiple myeloma cancer cells.

[106] The method of [105], wherein the multiple myeloma cancer cells comprise human cells.

[107] The method of [104], wherein the contacting is intratumoral.

[108] A method for producing a CAR-expressing cell, the method comprising: contacting a first target nucleic acid sequence in a cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a first CRISPR guide molecule, wherein the first CRISPR guide molecule comprises the CRISPR guide molecule of any of [1] to [35], wherein a targeting region of the first CRISPR guide molecule is capable of hybridizing to the first target nucleic acid sequence and the nucleoprotein complex is capable of cleaving the first target nucleic acid sequence; contacting a second target nucleic acid sequence in the cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a second CRISPR guide molecule, wherein the second CRISPR guide molecule comprises any of [1] to [35] capable of binding to a target nucleic acid sequence different from the first CRISPR guide molecule, wherein a targeting region of the second CRISPR guide molecule is capable of hybridizing to the second target nucleic acid sequence, and the nucleoprotein complex is capable of cleaving the second target nucleic acid sequence; and providing to the cell a donor polynucleotide comprising a CAR expression vector, wherein at least a portion of the donor polynucleotide comprising the CAR expression vector is capable of being inserted at a cleavage site in the first target nucleic acid sequence, and wherein the CAR comprises an extracellular ligand binding domain.

[109] The method of [108], wherein a donor polynucleotide comprising the CAR expression vector is introduced into the cell using a viral vector.

[110] The method of [108], wherein the CAR expression vector further encodes a hinge region, a transmembrane region, and one or more intracellular signaling regions.

[111] The method of any one of [108] to [110], wherein the first target nucleic acid sequence is within a gene encoding a TRAC protein, and wherein the second target nucleic acid sequence is within a gene encoding a PD1 protein.

[112] The method of any one of [108] to [110], wherein the first target nucleic acid sequence is within a gene encoding a TRAC protein, and wherein the second target nucleic acid sequence is within a gene encoding a B2M protein.

[113] The method of any one of [108] to [112], wherein the extracellular ligand-binding domain comprises an immunoglobulin single chain variable fragment (scFv).

[114] The method of [113], wherein the scFv is capable of binding BCMA.

[115] The method of [113], wherein the scFv is capable of binding to CD371.

[116] The method of [114], wherein the anti-BCMA scFv comprises a polypeptide comprising the amino acid sequence of SEQ ID NO:474 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO. 475.

[117] The method of [116], wherein the scFv further comprises a linker between the VH and the VL.

[118] The method of [117], wherein the linker comprises SEQ ID NO:476, and a sequence of amino acids.

[119] The method of [114], wherein the scFv comprises the sequence of SEQ ID NO: 477.

[120] The method of any one of [108] to [119], further comprising providing a second donor polynucleotide comprising a B2M-HLA-E fusion construct to the cell, wherein at least a portion of the second donor polynucleotide comprising a B2M-HLA-E fusion construct is capable of being inserted at a cleavage site of the second target nucleic acid sequence; and the B2M-HLA-E fusion construct encodes a fusion protein comprising, from N-terminus to C-terminus, a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence.

[121] The method of any one of [108] to [120], wherein the CAR comprises a scFv comprising a VH and a VL; a transmembrane domain; a costimulatory domain and an activation domain.

[122] The method of [121], wherein the transmembrane domain comprises a transmembrane domain derived from: t cell receptor alpha chain, T cell receptor beta chain, CD3 zeta chain, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or aG ITR.

[123] The method of [122], wherein the transmembrane domain comprises a transmembrane domain derived from CD 8.

[124] The method of [121], wherein the co-stimulatory domain comprises a co-stimulatory domain derived from: CD28, 4-1BB, GITR, ICOS-1, CD27, OX-40 or DAP10.

[125] The method of [124], wherein the costimulatory domain comprises the 4-1BB costimulatory domain.

[126] The method of [121], wherein the activation domain comprises a cd3ζ activation domain.

[127] The method of [121], wherein the transmembrane domain comprises a transmembrane domain derived from CD8, the costimulatory domain comprises a 4-1BB costimulatory domain, and the activation domain comprises a cd3ζ activation domain.

[128] The method of any one of [108] to [127], wherein the CAR-expressing cell is a CAR-T cell.

[129] The method of [128], wherein the CAR-T cell is an allogeneic CAR-T cell.

[130] The method of [128], wherein the CAR-T cell is an autologous CAR-T cell.

[131] The method of any one of [108] to [130], wherein the Cas12 protein complexed with the first CRISPR guide molecule and/or the Cas12 protein complexed with the second CRISPR guide molecule comprises at the C-terminus a sequence comprising a linker and an NLS having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs 479-490.

[132] The method of [131], wherein the Cas12 protein complexed with the first CRISPR guide molecule and/or the Cas12 protein complexed with the second CRISPR guide molecule comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 483, 485, 487 and 489.

[133] The method of [78], wherein the second donor polynucleotide further comprises a P2A sequence at the N-terminus of the B2M-HLA-E fusion construct.

[134] The method of [120], wherein the second donor polynucleotide further comprises a P2A sequence at the N-terminus of the B2M-HLA-E fusion construct sequence.

In some embodiments, the invention is a CRISPR guide molecule comprising a targeting region capable of binding to a target nucleic acid sequence and an activation region comprising an RNA sequence UAAUUUCUACUCUUGUAGAU comprising at least one deoxyribonucleotide instead of a ribonucleotide, wherein the activation region is capable of forming a nucleoprotein complex with a Cas12 protein. In some embodiments, one or more (e.g., ten or less) of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the activation region comprises a deoxyribonucleotide base. In some embodiments, the molecule comprises one or more chemical modifications selected from the group consisting of: base modifications including inosine, deoxyinosine, deoxyuracil, xanthosine, C3 spacer, 5-methyl dC, 5-hydroxybutyyne-2' -deoxyuridine, 5-nitroindole, 5-methylisodeoxycytosine, isodeoxyguanosine, deoxyuridine, isodeoxycytidine, and abasic sites; and backbone modifications, including phosphorothioate modifications.

In some embodiments, the targeting region of the CRISPR guide targets the B2M gene and comprises the RNA sequence AGUGGGGGUGAAUUCAGUGU, wherein optionally at least one base in the sequence is replaced with a base analog or abasic site. In some embodiments, one or more (e.g., five or less) of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region comprises a deoxyribonucleotide base. In some embodiments, the targeting region is capable of hybridizing to a sequence selected from the group consisting of SEQ ID NOS: 51-133. In some embodiments, the CRISPR guide comprises a sequence selected from the group consisting of SEQ ID NOS 212-231, 275-315 and 331-350. In some embodiments, the CRISPR guide comprises the sequence of SEQ ID NO. 416.

In some embodiments, the targeting region of the CRISPR primer targets the TRAC gene and comprises RNA sequence GAGUCUCUCAGCUGGUACAC, wherein optionally at least one base in said sequence is replaced with a base analogue or abasic site. In some embodiments, one or more (e.g., five or less) of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region comprises a deoxyribonucleotide base. In some embodiments, the targeting region is capable of hybridizing to a sequence selected from SEQ ID NOS: 15-20. In some embodiments, the CRISPR guide comprises a sequence selected from the group consisting of SEQ ID NOS 233-252, 317-329, 491-492 and 508. In some embodiments, the CRISPR guide molecule further comprises a chemical modification and comprises a sequence selected from the group consisting of SEQ ID NOS: 512-517. In some embodiments, the CRISPR guide molecule comprises the sequence of SEQ ID NO: 415.

In some embodiments, the targeting region targets the CISH gene and is capable of hybridizing to a sequence selected from SEQ ID NOS.157-165. In some embodiments, the CRISPR guide comprises a sequence selected from the group consisting of SEQ ID NOS 509 and 519-529.

In some embodiments, the targeting region targets the PDCD1 gene and is capable of hybridizing to a sequence selected from SEQ ID NOS: 135-155.

In some embodiments, the targeting region targets the CBLB gene and is capable of hybridizing to a sequence selected from SEQ ID NOS 167-189. In some embodiments, the CRISPR guide comprises the sequence of SEQ ID NO: 510.

In some embodiments, the invention is a CRISPR nucleic acid/protein composition comprising a CRISPR guide molecule as described above and a Cas12 protein. In some embodiments, the Cas12 protein is a Cas12a protein comprising at the C-terminus a sequence comprising a linker and a Nuclear Localization Signal (NLS) that has at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs 479-490.

In some embodiments, the invention is a cell comprising the above CRISPR nucleic acid/protein composition, wherein the cell is a lymphocyte, a Chimeric Antigen Receptor (CAR) T cell, a T Cell Receptor (TCR) cell, a TCR-engineered CAR-T cell, a Tumor Infiltrating Lymphocyte (TIL), a CAR TIL, a Dendritic Cell (DC), a CAR-DC, a macrophage, a CAR-macrophage (CAR-M), a Natural Killer (NK) cell, an Induced Pluripotent Stem Cell (iPSC), a cell differentiated from an iPSC cell, or a CAR-NK cell.

In some embodiments, the invention is a method for producing a cell expressing a Chimeric Antigen Receptor (CAR), the method comprising contacting a first target nucleic acid comprising a TRAC sequence in a cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a first CRISPR guide molecule having a targeting region capable of binding to the first target nucleic acid sequence and an activation region capable of forming a nucleoprotein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises a ribonucleotide base and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the nucleoprotein complex is capable of cleaving the first target nucleic acid sequence; contacting a second target nucleic acid sequence comprising a B2M sequence in the same cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a second CRISPR guide molecule having a targeting region capable of binding to the second target nucleic acid sequence and an activation region capable of forming a nucleoprotein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises a ribonucleotide base and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the nucleoprotein complex is capable of cleaving the second target nucleic acid sequence; providing a first donor polynucleotide encoding a CAR, the CAR comprising an scFv, a transmembrane domain, a costimulatory domain, and an activation domain, wherein the CAR is capable of being inserted into a cleavage site in the first target nucleic acid sequence; providing a second donor polynucleotide encoding a B2M-HLA-E fusion construct comprising a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence, wherein the B2M-HLA-E fusion construct is capable of being inserted into a cleavage site in the second target nucleic acid sequence; cleaving the first target nucleic acid sequence and inserting at least a portion of the first donor polynucleotide into the cleavage site; and cleaving the second target nucleic acid sequence and inserting at least a portion of the second donor polynucleotide into the cleavage site. In some embodiments, the second donor polynucleotide further comprises a P2A sequence at the 5' end of the B2M-HLA-E fusion construct. In some embodiments, the first donor polynucleotide comprises SEQ ID NO. 413. In some embodiments, the second donor polynucleotide comprises SEQ ID NO. 414.

In some embodiments, the scFv in the CAR is capable of binding to a cellular target selected from the group consisting of: CD37, CD38, CD47, CD73, CD4, CS1, PD-L1, NGFR, ENPP3, PSCA, CD79B, TACI, VEGFR2, B7-H3, B7-H6, B Cell Maturation Antigen (BCMA), CD123, CD138, CD171/L1CAM, CD19, CD20, CD22, CD30, CD33, CD70, CD371, CEA, sealing protein 18.1, sealing protein 18.2, CSPG4, EFGRvIII, epCAM, ephA2, epidermal growth factor receptor, erbB2 (HER 2), FAP, FR alpha, GD2, GD3, glypican 3, IL-11 Ralpha, IL-13 Ralpha 2, IL13 receptor alpha, lewis Y/LeY, mesothelin, MUC1, MUC16, NKG2D ligand, PD1, PSMA, ROR-1, SLAMF7, TAG72, ULBP and MICA/B proteins, VEGF2 and WT1. In some embodiments, the scFv is capable of binding to BCMA and comprises a first variable region comprising the amino acid sequence of SEQ ID NO:474, a second variable region comprising the amino acid sequence of SEQ ID NO:475, and a linker between the first and second variable regions comprising the amino acid sequence of SEQ ID NO: 476. In some embodiments, the scFv comprises the amino acid sequence of SEQ ID NO. 477.

In some embodiments, the transmembrane domain of the CAR is derived from the T cell receptor alpha chain, T cell receptor beta chain, CD3 zeta chain, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or GITR. In some embodiments, the co-stimulatory domain of the CAR is derived from CD28, 4-1BB, GITR, ICOS-1, CD27, OX-40 or DAP10. In some embodiments, the CAR comprises a transmembrane domain derived from CD8, a 4-1BB costimulatory domain, and a cd3ζ activation domain. In some embodiments, the vector comprising the CAR sequence comprises a leader sequence having the nucleic acid sequence of SEQ ID NO: 478.

In some embodiments, the catalytically active Cas12 protein used in the methods comprises a sequence comprising a linker and a Nuclear Localization Signal (NLS) at the C-terminus that has at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs 479-490.

In some embodiments, the method further comprises contacting a third target nucleic acid sequence in the same cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a third CRISPR guide molecule having a targeting region capable of binding to the third target nucleic acid sequence and an activation region capable of forming a nucleoprotein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises a ribonucleotide base and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the nucleoprotein complex is capable of cleaving the third target nucleic acid sequence; cleaving the third target nucleic acid sequence and deleting one or more nucleotides from the third target nucleic acid sequence at the cleavage site, wherein the third target nucleic acid sequence is selected from the group consisting of a PDCD gene, a CISH gene, and a CBLB gene.

In some embodiments, the CAR-expressing cells are allogeneic or autologous CAR-T cells produced by T lymphocytes.

In some embodiments, the invention is a CAR-expressing cell produced by the above method, wherein the cell is selected from the group consisting of a lymphocyte, a CAR-T cell, a TCR-engineered CAR-T cell, a TIL, a CAR-TIL, a dendritic cell, a CAR-DC, a macrophage, a CAR-M, iPSC cell, a cell differentiated from an iPSC cell, an NK cell, or a CAR-NK cell.

In some embodiments, the invention is a method of adoptive cell therapy comprising administering to a subject in need thereof a CAR-expressing cell as described above. In some embodiments, the adoptive cell therapy includes killing BCMA positive cancer cells, such as multiple myeloma cancer cells.

Incorporated by reference

All patents, publications, and patent applications cited in this specification are herein incorporated by reference as if each individual patent, publication, or patent application were specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

Brief Description of Drawings

The features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings. The figures are not drawn to scale and are not drawn to scale. The location of the indicator is approximate.

Fig. 1A, 1B and 1C illustrate examples of V-type CRISPR-Cas12a guide RNAs.

FIG. 2 illustrates Cas12a chRDNA guide/nucleoprotein complex cleavage of a target polynucleotide.

Figures 3A-3I illustrate various canonical and non-canonical nucleotides for Cas12 chRDNA guides.

FIG. 4 illustrates Cas12a chRDNA guide/nucleoprotein complex cleavage of a target polynucleotide.

Figure 5 illustrates Cas12a crRNA guides.

Figure 6 illustrates a Cas12a chRDNA guide comprising DNA bases and target-binding sequences in the activation region.

Figure 7 illustrates a Cas12a chRDNA guide comprising DNA bases and chemically modified nucleic acids in the activation region, as well as a target binding sequence.

Figure 8 illustrates the formation of Cas12 chRDNA guide/nucleoprotein complexes and binding of target polynucleotides.

Figure 9 illustrates the creation of an insertion or deletion (indel) in a target polynucleotide by a Cas12 chRDNA guide/nucleoprotein complex.

Figure 10 illustrates insertion of a donor polynucleotide sequence into a target polynucleotide by Cas12 chRDNA guide/nucleoprotein complex.

FIG. 11 illustrates nicking of a target polynucleotide by a Cas12 chRDNA guide/nucleoprotein complex.

Figure 12 illustrates the creation of tandem nicks to a target polynucleotide with two Cas12 chRDNA guide/nucleoprotein complexes and the insertion of a donor polynucleotide sequence into the target polynucleotide.

Figure 13 illustrates the average normalized edit rate of Cas12a chRDNA guide/nucleoprotein complexes with individual DNA bases in the target-binding sequence.

Figure 14 illustrates the normalized edit rate of Cas12a chRDNA guide/nucleoprotein complexes with individual DNA bases in the activation region.

Fig. 15A and 15B illustrate the phenotype and cytotoxicity profile of CAR-T cells produced using Cas12a chRDNA guide/nucleoprotein complexes.

Fig. 16A and 16B illustrate the editing activity of Cas12a guide/nucleoprotein complexes with different polypeptide linkers and Nuclear Localization Sequence (NLS) configurations.

Figure 17 illustrates the editing activity of Cas12a chRDNA guide/nucleoprotein complexes when multiple genes are simultaneously targeted with different polypeptide linkers and Nuclear Localization Sequence (NLS) configurations.

Detailed Description

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes one or more polynucleotides, and reference to "a vector" includes one or more vectors.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although other methods and materials similar or equivalent to those described herein can be used in the present disclosure, the preferred materials and methods are described herein.

TerminologyAnd->Assay "refers to a biochemical method of identifying the sequence of an endonuclease site within genomic DNA generated using Cas9 programmed with a single guide RNA (sgRNA). This assay is fully described in Cameron, P.et al, (2017) Mapping the genomic landscape of CRISPR-Cas9 clean. Nature Methods,14 (6), 600-606.Https:// doi.org/10.1038/nmeth.4284).

Given the teachings of the present specification, one of ordinary skill in the art can apply conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant polynucleotides, as taught, for example, by the following standard texts: abbas et al (Cellular and Molecular Immunology,2017,9th Edition,Elsevier,ISBN 978-0323479783); butterfield et al (Cancer Immunotherapy Principles and Practice,2017,1st Edition,Demos Medical,ISBN 978-1620700976); kenneth Murphy (Janeway's Immunobiology,2016,9th Edition,Garland Science,ISBN 978-0815345053); stevens et al (Clinical Immunology and Serology: A Laboratory Perspective,2016,4th Edition,Davis Company,ISBN 978-0803644663); greenfield (Antibodies: A Laboratory Manual,2014,Second edition,Cold Spring Harbor Laboratory Press,ISBN 978-1-936113-81-1); freshney (Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications,2016,7th Edition,Wiley-Blackwell, ISBN 978-1118873656); pinkert (Transgenic Animal Technology, third Edition: A Laboratory Handbook,2014,Elsevier,ISBN 978-0124104907); h.herdrich (The Laboratory Mouse,2012,Second Edition,Academic Press,ISBN 978-0123820082); behringer et al (Manipulating the Mouse Embryo: A Laboratory Manual,2013,Fourth Edition,Cold Spring Harbor Laboratory Press,ISBN 978-1936113019); mcPherson et al (PCR 2:A Practical Approach,1995,IRL Press,ISBN 978-0199634248); m. walker (Methods in Molecular Biology (Series), humana Press, ISSN 1064-3745); rio et al (RNA: A Laboratory Manual,2010,Cold Spring Harbor Laboratory Press,ISBN 978-0879698911); methods in Enzymology (Series), academic Press; green et al (Molecular Cloning: A Laboratory Manual,2012,Fourth Edition,Cold Spring Harbor Laboratory Press,ISBN 978-1605500560); t. Hermanson (Bioconjugate Techniques,2013,Third Edition,Academic Press,ISBN 978-0123822390).

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and related CRISPR-associated proteins (Cas proteins) constitute a CRISPR-Cas system. Classification of CRISPR-Cas systems has been iterated for many times. Makarova et al (Nat. Rev. Microbiol.,2020, 18:67-83) propose a classification system that considers the signature Cas gene specific for individual types and subtypes of the CRISPR-Cas system. The classification also considers sequence similarity between multiple consensus Cas proteins, phylogenetic development of optimally conserved Cas proteins, genetic organization, and structure of CRISPR arrays. The method provides a classification scheme that classifies CRISPR-Cas systems into two distinct categories: class 1 and class 2.

In a class 2V system, crRNA and target binding involves Cas12, as does target nucleic acid cleavage. For example, the RuvC-like nuclease domain of Cas12a cleaves both strands of the target nucleic acid in a staggered configuration, creating a 5' overhang, as opposed to a blunt end created by Cas9 cleavage. These 5' overhangs can facilitate insertion of the DNA by homologous recombination methods.

Other proteins associated with V-type crRNA and target binding and cleavage include Cas12b (formerly C2C 1) and Cas12C (formerly C2C 3). Cas12b and Cas12c proteins are similar in length to CRISPR class 2 type II Cas9 and CRISPR class 2 type V Cas12a proteins, ranging from about 1,100 amino acids to about 1,500 amino acids. The C2C1 and C2C3 proteins also contain RuvC-like nuclease domains and have a structure similar to Cas12 a. The C2C1 protein is similar to Cas9 protein in that it requires crRNA and tracrRNA for target binding and cleavage, but has an optimal cleavage temperature of 50 ℃. The C2C1 protein targets AT-rich PAM, similar to Cas12a, 5' of the target sequence. See, e.g., shmakov et al (Molecular Cell,2015,60 (3): 385-397).

CRISPR type V subtypes include Cas12 proteins and exhibit a wide variety of sequences and sizes; however, cas12 subtype shares a common evolutionary origin with the TnpB nuclease encoded by IS 605-like transposon. Because of low sequence similarity, and the evolution of multiple independent recombination events through Cas12 proteins, classification of Cas12 proteins into their respective subtypes has led to multiple naming conventions. Table 1 presents the classification and names of V-type Cas12 proteins, their approximate size, guide requirements, preferred target polynucleotides, and representative source organisms.

/>

Cas12 homologs may be identified using sequence similarity search methods known to those skilled in the art. Typically, the Cas12 protein is capable of interacting with a cognate Cas12 guide to form a Cas12 guide/nucleoprotein complex capable of binding to a target nucleic acid sequence. In some embodiments of the disclosure, the Cas12 protein or the homolog thereof is a Cas12a protein or a homolog thereof.

Cas12a proteins include, but are not limited to, cas12a from the following: the total bacteria of the genus Geofacia, GWC2011_GWC2_44_17 (PbCpf 1), the bacteria of the family Maanospiraceae MC2017 (Lb 3 Cpf 1), the bacteria of the family Proteus, proteus proteolyticus (BpCpf 1), the bacteria of the family Deuteromycotina GW2011_GWA_33_10 (PeCpf 1), the bacteria of the family Proteus BV3L6 (AsCpf 1), the bacteria of the family Porphyromonas kii (PCpf 1), the bacteria of the family Maanospiraceae ND2006 (LbCPf 1), the bacteria of the family Proteus Klebsieboldii (PdCPf 1), the bacteria of the family Mortierella jenkinii 237 (Mbpf 1), the bacteria of the family Schmidrib SC_K08D17 (Spcpf 1), the bacteria of the family Pachyspira (Licpf 1), the bacteria of the family Maanomyceliaceae MA (Lb 2Cpf 1), the bacteria of the family Floridontopsis, candidatus methanoplasma termitum (CMtCpf 1) and the species Eecpf 1.

In a V-type system, nucleic acid target sequence binding typically involves Cas12 protein and crRNA, as does nucleic acid target sequence cleavage. In the type V system, the RuvC-like nuclease domain of the Cas12 protein cleaves both strands of the nucleic acid target sequence in a sequential manner, see Swarts et al (mol. Cell,2017, 66:221-233), resulting in a 5' overhang, in contrast to the blunt end resulting from cleavage of the Cas9 protein.

Cas12 protein cleavage activity of Sup>A V-type system may be independent of tracrRNA (e.g., V-Sup>A type); and some V-shaped systems require only a single crRNA with a stem-loop structure that forms an internal duplex. Cas12 protein binds crRNA in a sequence and structure specific manner by recognizing the stem loop and the sequence adjacent to the stem loop, most notably nucleotide 5' of the spacer sequence that hybridizes to the nucleic acid target sequence. The stem-loop structure typically ranges from 15 to 22 nucleotides in length. Substitutions that disrupt the stem-loop duplex eliminate the cleavage activity, while other substitutions that do not disrupt the stem-loop duplex do not eliminate the cleavage activity. Some V-type systems require hybridization between crRNA and tracrrRNA, such as V-F1, V-G, V-C, V-E (CasX), V-K, and V-B. See, for example, yan et al (Science, 2019,363 (6422):88-91).

As used herein, "guide" and "guide polynucleotide" refer to one or more polynucleotides that form a nucleoprotein complex with a Cas protein, wherein the nucleoprotein complex preferentially binds to a nucleic acid target sequence in the polynucleotide (relative to a polynucleotide that does not comprise the nucleic acid target sequence). Such a primer can include ribonucleotide bases (e.g., RNA), deoxyribonucleotide bases (e.g., DNA), combinations of ribonucleotide bases and deoxyribonucleotide bases (e.g., RNA/DNA), nucleotide analogs, modified nucleotides, and the like, as well as synthetic, naturally occurring, and non-naturally occurring modified backbone residues or linkages. Many such guides are known, such as but not limited to single guide RNAs (including mini and truncated single guide RNAs), crrnas, double guide RNAs, including but not limited to crRNA/tracrRNA molecules, and the like, the use of which depends on the particular Cas protein. For example, a "V-type CRISPR-Cas 12-associated guide" is a guide that specifically associates with a cognate Cas12 protein to form a nucleoprotein complex.

As used herein, a "CRISPR polynucleotide" is a polynucleotide sequence comprising a portion of a guide molecule. In some embodiments, the CRISPR polynucleotide comprises a targeting region and/or an activating region.

As used herein, with respect to a targeting molecule, "spacer", "spacer sequence", "spacer element" or "targeting region" refers to a polynucleotide sequence capable of specifically hybridizing to a target nucleic acid sequence. The targeting region interacts with the target nucleic acid sequence through hydrogen bonding between complementary base pairs (i.e., paired bases). The targeting region binds to a selected nucleic acid target sequence. In some embodiments, the target sequence is a sequence within the genome of the cell in vitro, ex vivo (e.g., in the production of CAR-T cells), or in vivo (e.g., where the composition is administered directly to a subject). The targeting molecule may comprise or consist of any sequence selected to target any target sequence. Exemplary target sequences include those that are unique in the target genome. Thus, the targeting region is a nucleic acid target binding sequence. The targeting region determines the location of site-specific binding and nucleolytic cleavage of the Cas12 protein. Variability in the functional length of the targeting region is known in the art.

As used herein, the term "activation region" refers to a portion of a polynucleotide capable of associating or binding with a Cas12 polypeptide, such as a Cas12a polypeptide.

As used herein, the terms "abasic", "abasic site", "abasic nucleotide", "apurinic/apyrimidinic site" and "AP site" are used interchangeably and refer to sites in a nucleotide sequence that lack a purine or pyrimidine base. In certain embodiments, the abasic site comprises a deoxyribose site. In other embodiments, the abasic site comprises a ribose site. In further embodiments, the abasic site comprises a modified backbone, such as a phosphorothioate backbone or a morpholino backbone. The abasic site cannot form a hydrogen base pair bond with the complementary nitrogen base of a DNA or RNA nucleotide because it does not contain a nitrogen base.

As used herein, the terms "base analog," "non-canonical base," and "chemically modified base" refer to a compound that has structural similarity to canonical purine or pyrimidine bases found in DNA or RNA. Base analogs can contain modified sugar and/or modified nucleobases as compared to naturally occurring purine or pyrimidine bases in DNA or RNA. In some embodiments, the base analog is inosine or deoxyinosine, such as 2' -deoxyinosine. In other embodiments, the base analog is a 2' -deoxyribonucleoside, 2' -ribonucleoside, 2' -deoxyribonucleotide, or 2' -ribonucleotide, wherein the nucleobase comprises a modified base such as, for example, xanthine, uridine, oxanine (oxanine), 7-methylguanosine, dihydrouridine, 5-methylcytidine, C3 spacer, 5-methyldC, 5-hydroxybutylkyne-2 ' -deoxyuridine, 5-nitroindole, 5-methylisodeoxycytosine, isodeoxyguanosine, deoxyuridine, isodeoxycytidine, other 0-1 purine analogs, N-6-hydroxyaminopurine, hydromuscarinic (nebulonine), 7-deammoxyxanthine, other 7-deazapurines, and 2-methylpurine. In some embodiments, the base analog may be selected from 7-deaza-2 ' -deoxyinosine, 2' -aza-2 ' -deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidite-inosine, 2' -O-methoxyethyl-inosine, and 2' -OMe-inosine. The term "base analogue" also includes, for example, 2 '-deoxyribonucleosides, 2' -ribonucleosides, 2 '-deoxyribonucleotides or 2' -ribonucleotides wherein the nucleobase is a substituted hypoxanthine. For example, substituted hypoxanthines can be substituted with a halogen, such as fluorine or chlorine. In some embodiments, the base analog may be fluoroinosine or chloroainosine, such as 2-chloroainosine, 6-chloroainosine, 8-chloroainosine, 2-fluoroinosine, 6-fluoroinosine, or 8-fluoroinosine. In other embodiments, the base analog is deoxyuridine. In other embodiments, the base analog is a nucleic acid mimetic (such as, for example, an artificial nucleic acid and a heterologous nucleic acid (XNA)).

As used herein, the term "CRISPR hybrid RNA/DNA guide" (chRDNA) refers to a polynucleotide guide molecule comprising a targeting region, wherein the polynucleotide comprises RNA and DNA designed into the polynucleotide. In embodiments herein, the crRNA component of the Cas12a guide is chRDNA.

As used herein, the term "Cas12 chRDNA guide/nucleoprotein complex" refers to a chRDNA guide molecule that complexes with a Cas12 protein to form a nucleoprotein complex, wherein the nucleoprotein complex is capable of site-specific binding to a nucleic acid target sequence that is complementary to a nucleic acid target binding sequence present in the chRDNA guide molecule. As used herein, the term "Cas12a chRDNA guide/nucleoprotein complex" refers to a chRDNA guide molecule that complexes with a Cas12a protein to form a nucleoprotein complex, wherein the nucleoprotein complex is capable of site-specific binding to a nucleic acid target sequence that is complementary to a nucleic acid target binding sequence present in the chRDNA guide molecule.

As used herein, "stem element" or "stem structure" refers to two strands of nucleic acid that form a double-stranded region ("stem element"). "stem-loop element" or "stem-loop structure" refers to a stem structure in which the 3 'end sequence of one strand is covalently bonded to the 5' end sequence of the second strand through a nucleotide sequence, typically a single-stranded nucleotide ("stem-loop element nucleotide sequence"). In some embodiments, the loop element comprises a loop element nucleotide sequence of about 3 to about 20 nucleotides in length, preferably about 4 to about 10 nucleotides in length. In some embodiments, the loop element nucleotide sequence is a single-stranded nucleotide sequence of unpaired nucleobases that do not interact through hydrogen bonding to create a stem element within the loop element nucleotide sequence. The term "hairpin element" is also used herein to refer to a stem-loop structure. Such structures are well known in the art. Base pairing can be precise; however, as known in the art, stem elements do not require precise base pairing. Thus, a stem element may include one or more base mismatches or unpaired bases. The stem-loop element may also include a pseudo-knot (pseudo-knot) structure.

"linker element nucleotide sequence", "linker nucleotide sequence" and "linker polynucleotide" are used interchangeably herein and refer to a sequence of one or more nucleotides covalently linked to a first nucleic acid sequence (5 '-linker nucleotide sequence-first nucleic acid sequence-3'). In some embodiments, the linker nucleotide sequence links two separate nucleic acid sequences to form a single polynucleotide (e.g., 5 '-first nucleic acid sequence-linker nucleotide sequence-second nucleic acid sequence-3'). Other examples of linker sequences include, but are not limited to, 5 '-first nucleic acid sequence-linker nucleotide sequence-3' and 5 '-linker nucleotide sequence-first nucleic acid sequence-linker nucleotide sequence-3'. In some embodiments, the linker element nucleotide sequence may be a single-stranded nucleotide sequence of unpaired nucleobases that do not interact with each other through hydrogen bonding to create a secondary structure (e.g., a stem-loop structure) within the linker element nucleotide sequence. In some embodiments, two single-stranded linker element nucleotide sequences may interact through hydrogen bonding between the two linker element nucleotide sequences. In some embodiments, the linker element nucleotide sequence may be about 1 to about 50 nucleotides in length, preferably about 1 to about 15 nucleotides in length.

As used herein, the term "homologous" generally refers to a Cas12 protein (e.g., cas12 a) and one or more V-type CRISPR-Cas 12-associated guides (e.g., cas12chRDNA guides) that are capable of forming a nucleoprotein complex capable of site-specific binding to a nucleic acid target sequence that is complementary to a nucleic acid target binding sequence present in the one or more guides.

The terms "wild-type", "naturally occurring" and "unmodified" are used herein to mean a typical (or most common) form, appearance, phenotype or strain that occurs naturally; for example, typical forms of cells, organisms, polynucleotides, proteins, macromolecular complexes, genes, RNAs, DNAs or genomes are as they occur in nature and may be isolated from natural sources. The wild-type form, appearance, phenotype or strain is used as the original parent prior to deliberate modification. Thus, mutant, variant, engineered, recombinant, and modified forms are not wild-type forms.

By "isolated" in reference to a polypeptide is meant that the molecule is separate and discontinuous from the whole organism in which it is found in nature, or in the substantial absence of other biological macromolecules of the same type. The term "isolated" with respect to a polynucleotide is a nucleic acid molecule that lacks, in whole or in part, sequences normally associated therewith in nature; or a sequence that occurs naturally but has a heterologous sequence associated therewith; or a molecule isolated from a chromosome.

The term "purified" as used herein preferably means that at least 75 wt%, more preferably at least 85 wt%, more preferably at least 95 wt%, and most preferably at least 98 wt% of the same molecule is present.

The terms "engineered", "genetically modified", "recombinant", "modified", "non-naturally occurring" and "non-natural" refer to the genome of an intended human-manipulated organism or cell. The term encompasses methods of genome modification, which include genome editing as defined herein, as well as techniques that alter gene expression or inactivation, enzyme engineering, directed evolution, knowledge-based design, random mutagenesis methods, gene shuffling, codon optimization, and the like. Methods for genetic engineering are known in the art.

"covalent bond," "covalently attached," "covalently bound," "covalently linked," and "molecular bond" are used interchangeably herein and refer to a chemical bond involving the sharing of electron pairs between atoms. Examples of covalent bonds include, but are not limited to, phosphodiester bonds and phosphorothioate bonds.

"non-covalent bond", "non-covalently attached", "non-covalently bound", "non-covalently linked", "non-covalent interaction" and "non-covalently linked" are used interchangeably herein and refer to any relatively weak chemical bond that does not involve sharing a pair of electrons. Multiple non-covalent bonds generally stabilize the conformation of macromolecules and mediate specific interactions between molecules. Examples of non-covalent bonds include, but are not limited to, hydrogen bonding, ionic interactions (e.g., na ⁺ Cl ^- ) Van der waals interactions and hydrophobic bonds.

As used herein, "hydrogen bonding," "hydrogen base pairing," and "hydrogen bonding" are used interchangeably and refer to both canonical hydrogen bonding and non-canonical hydrogen bonding, including but not limited to "watson-crick-hydrogen bonding base pairs" (W-C-hydrogen bonding base pairs or W-C hydrogen bonding); "Hoogsteen-hydrogen bonded base pairs" (Hoogsteen hydrogen bonding); and "wobble-hydrogen bonding base pairs" (wobble hydrogen bonding). W-C hydrogen bonding (including reverse W-C hydrogen bonding) refers to purine-pyrimidine base pairing, i.e., adenine: thymine, guanine: cytosine and uracil: adenine. Hoogsteen hydrogen bonding (including reverse Hoogsteen hydrogen bonding) refers to a change in base pairing in a nucleic acid, where two nucleobases (one on each strand) are held together by hydrogen bonding in the major groove. This non-W-C hydrogen bonding may allow the third strand to wrap around the duplex and form a triple helix. Wobble hydrogen bonding (including reverse wobble hydrogen bonding) refers to pairing between two nucleotides in an RNA molecule that does not follow the watson-crick base pair rule. There are four major wobble base pairs: guanine: uracil, inosine (hypoxanthine): uracil, inosine: adenine and inosine: cytosine. Known in inosine: thymine and inosine: wobble base interactions also occur between guanines. Inosine bases and deoxyinosine bases can be referred to as "universal pairing bases" because they are capable of hydrogen bonding with canonical DNA and RNA bases. See, e.g., watkins et al (Nucleic Acid Research,2005,33 (19): 6258-67). Rules for canonical hydrogen bonding and non-canonical hydrogen bonding are known to those of ordinary skill in the art. See, e.g., r.f. gesteland (The RNA World, third Edition (Cold Spring Harbor Monograph Series), 2005,Cold Spring Harbor Laboratory Press,ISBN 978-0879697396); gesteland (The RNA World, second Edition (Cold Spring Harbor Monograph Series), 1999,Cold Spring Harbor Laboratory Press,ISBN 978-0879695613); gesteland (The RNA World, first Edition (Cold Spring Harbor Monograph Series), 1993,Cold Spring Harbor Laboratory Press,978-0879694562) (see, e.g., appendix 1:Structures of Base Pairs Involving at Least Two Hydrogen Bonds,I.Tinoco); saenger (Principles of Nucleic Acid Structure,1988,Springer International Publishing AG,ISBN 978-0-387-90761-1); neidle (Principles of Nucleic Acid Structure,2007,First Edition,Academic Press,ISBN 978-01236950791).

"ligation," "linked," and "ligation" are used interchangeably herein and refer to a covalent or non-covalent bond between two macromolecules (e.g., polynucleotides, proteins, etc.).

As used herein, the terms "nucleic acid sequence", "nucleotide sequence" and "oligonucleotide" are interchangeable and refer to polymeric forms of nucleotides. As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides that has one 5 'end and one 3' end and may comprise one or more nucleic acid sequences. The nucleotides may be Deoxyribonucleotides (DNA), ribonucleotides (RNA), analogs thereof, or combinations thereof, and may be any length. Polynucleotides may perform any function and may have a variety of secondary and tertiary structures. The term encompasses natural nucleotides and known analogues of nucleotides that are modified in the base, sugar and/or phosphate moieties. Analogs of a particular nucleotide have the same base pairing specificity (e.g., analogs of AT base pairs). A polynucleotide may comprise one modified nucleotide or a plurality of modified nucleotides. Examples of modified nucleotides include fluorinated nucleotides, methylated nucleotides, chemically modified sugars and nucleotide analogs. Nucleotide structure can be To modify the polymer either before or after assembly. After polymerization, the polynucleotide may be further modified via conjugation, for example, with a labeling component or a target binding component. The nucleotide sequence may incorporate non-nucleotide components. The term also encompasses nucleic acids comprising modified backbone residues or linkages, which are synthetic, naturally occurring, and/or non-naturally occurring, and which have similar binding properties as a reference polynucleotide (e.g., DNA or RNA). Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidites, methylphosphonates, chiral-methylphosphonates, 2-O-methylribonucleotides, peptide-nucleic acids (PNA), locked Nucleic Acids (LNA) ^TM ) (Exiqon, woburn, MA) nucleosides, diol nucleic acids (glycol nucleic acid), bridging nucleic acids, and morpholino structures.

Peptide-nucleic acids (PNAs) are synthetic homologs of nucleic acids in which the polynucleotide phospho-sugar backbone is replaced by a flexible pseudopeptide polymer. The nucleobases are linked to a polymer. PNAs have the ability to hybridize with high affinity and specificity to complementary sequences of RNA and DNA.

In phosphorothioate nucleic acids, phosphorothioate (PS) linkages replace non-bridging oxygens in the phosphate backbone of the polynucleotide with sulfur atoms. Such modifications render the internucleotide linkages resistant to nuclease degradation. In some embodiments, phosphorothioate linkages are introduced between the 5 'end of the polynucleotide sequence or the last 3 to 5 nucleotides of the 3' end sequence to inhibit exonuclease degradation. The placement of phosphorothioate linkages throughout the oligonucleotide also helps to reduce endonuclease degradation.

Threose Nucleic Acid (TNA) is an artificial gene polymer. The backbone structure of TNA comprises repeated threose linked by phosphodiester bonds. TNA polymers are resistant to nuclease degradation. TNA can self-assemble into duplex structures through base pair hydrogen bonding.

Linkage inversion (linkage inversions) can be introduced into the polynucleotide by using "reverse phosphoramidite" (see, e.g., www.ucalgary.ca/dnalab/synthosis/-modifications/linkages). The 3'-3' linkage at the ends of the polynucleotide stabilizes the polynucleotide against exonuclease degradation by generating oligonucleotides with two 5'-OH ends but lacking a 3' -OH end. Typically, such polynucleotides have a phosphoramidite group at the 5'-OH position and a Dimethoxytrityl (DMT) protecting group at the 3' -OH position. Typically, the DMT protecting group is on the 5'-OH and the phosphoramidite is on the 3' -OH.

Unless otherwise indicated, polynucleotide sequences are shown herein in the conventional 5 'to 3' orientation.

As used herein, "sequence identity" generally refers to the percentage of nucleotide bases or amino acids that are compared to a second polynucleotide or polypeptide, respectively, using an algorithm with various weighting parameters. Sequence identity between two polynucleotides or two polypeptides may be determined by a variety of methods and computer programs (e.g., BLAST, CS-BLAST, FASTA, HMMER, L-ALIGN, etc.) available via the world Wide Web at websites including, but not limited to, GENBANK (www.ncbi.nlm.nih.gov/GENBANK /) and EMBL-EBI (www.ebi.ac.uk.). Sequence identity between two polynucleotide or two polypeptide sequences is typically calculated using standard default parameters of various methods or computer programs. The high degree of sequence identity between two polynucleotides or two polypeptides is typically about 90% to 100% identical over the length of the reference polypeptide, e.g., about 90% identical or greater, preferably about 95% identical or greater, more preferably about 98% identical or greater. The intermediate degree of sequence identity between two polynucleotides or polypeptides is typically about 80% to about 85% identity over the length of the reference polypeptide, e.g., about 80% identity or greater, preferably about 85% identity. The low degree of sequence identity between two polynucleotides or polypeptides is typically about 50% to 75% identical, e.g., about 50% identical, preferably about 60% identical, more preferably about 75% identical, over the length of the reference polypeptide. For example, a Cas12 protein (e.g., cas12 comprising an amino acid substitution) may have a low degree of sequence identity, a medium degree of sequence identity, or a high degree of sequence identity over its length as compared to a reference Cas12 protein (e.g., wild-type Cas 12) over its length. As another example, the guide molecule may have a low degree of sequence identity, a moderate degree of sequence identity, or a high degree of sequence identity over its length as compared to a reference wild-type guide molecule complexed with a reference Cas12 protein over its length (e.g., a polynucleotide that forms a complex with Cas 12).

As used herein, "hybridization" or "hybridization" is the process of combining two complementary single-stranded nucleic acid (e.g., DNA or RNA) molecules to form a single double-stranded molecule (e.g., DNA/DNA, DNA/RNA, RNA/RNA) by hydrogen base pairing. Hybridization stringency is generally determined by the hybridization temperature and salt concentration of the hybridization buffer; for example, high temperature and low salt provide high stringency hybridization conditions. Examples of salt concentration ranges and temperature ranges for different hybridization conditions are as follows: high stringency, about 0.01M to about 0.05M salt, hybridization temperature below T _m 5 ℃ to 10 ℃; moderate stringency, about 0.16M to about 0.33M salt, hybridization temperature below T _m 20 ℃ to 29 ℃; and low stringency, about 0.33M to about 0.82M salt, hybridization temperature below T _m 40 ℃ to 48 ℃. Calculation of T for duplex nucleic acid sequences by standard methods well known in the art _m . See, e.g., maniatis et al (Molecular Cloning: A Laboratory Manual,1982,Cold Spring Harbor Laboratory Press:New York); casey et al (Nucleic Acids Research,1977, 4:1539-1552); bodkin et al (Journal of Virological Methods,1985,10 (1): 45-52); wallace et al (Nucleic Acids Research,1981,9 (4): 879-894). Estimating T _m Algorithmic prediction tools of (c) are also widely available. High stringency conditions for hybridization generally refer to conditions under which a polynucleotide complementary to a target sequence hybridizes primarily to the target sequence and does not substantially hybridize to non-target sequences. Generally, hybridization conditions are moderately stringent, preferably high stringency.

As used herein, "complementarity" refers to the ability of a nucleic acid sequence to form hydrogen bonds with another nucleic acid sequence (e.g., by canonical watson-crick base pairing). Percent complementarity refers to the percentage of residues in a nucleic acid sequence that are capable of forming hydrogen bonds with a second nucleic acid sequence. If two nucleic acid sequences have 100% complementarity, the two sequences are fully complementary, i.e., all consecutive residues of the first polynucleotide form hydrogen bonds with the same number of consecutive residues in the second polynucleotide.

As used herein, with respect to ribonucleotide bases, the term "corresponding deoxyribonucleotide base" refers to a deoxyribonucleotide base that binds to the same base as that to which a ribonucleotide base binds by complementary (watson-crick) base pairing (including, for example, modified or variant forms of canonical deoxyribonucleotide bases). For example, for ribonucleotide bases A, C and G, the corresponding deoxyribonucleotide bases can be A, C and G, respectively. For ribonucleotide base U, the corresponding deoxyribonucleotide base can be, for example, T.

As used herein, "binding" refers to non-covalent interactions between macromolecules (e.g., between proteins and polynucleotides, between polynucleotides and polynucleotides, or between proteins and proteins, etc.). Such non-covalent interactions are also referred to as "associations" or "interactions" (e.g., if a first macromolecule interacts with a second macromolecule, the first macromolecule associates with the second macromolecule in a non-covalent manner). Some portions of the binding interactions may be sequence-specific (the terms "sequence-specific binding," "site-specific binding," and "site-specific binding" are used interchangeably herein). Sequence-specific binding generally refers to the ability of one or more guide molecules to form a complex with a protein (e.g., cas 12) relative to a second nucleic acid sequence (e.g., a second DNA sequence) that does not have a nucleic acid target binding sequence (e.g., a DNA target binding sequence) such that the protein preferentially binds to a nucleic acid sequence (e.g., a DNA sequence) that comprises the nucleic acid target sequence (e.g., the target DNA sequence). All components of the binding interactions need not be sequence specific, such as the contact of the protein with phosphate residues in the DNA backbone. The binding interactions can be characterized by dissociation constants (Kd). "binding affinity" refers to the strength of a binding interaction. Increased binding affinity correlates with lower Kd.

As used herein, a Cas12 protein is referred to as a "targeting" polynucleotide if the Cas12 guide/nucleoprotein complex binds to or cleaves a polynucleotide at a nucleic acid target sequence within the polynucleotide.

As used herein, "protospacer adjacent motif" or "PAM" refers to a double-stranded nucleic acid sequence comprising a Cas12 protein binding recognition sequence, wherein the amino acids of the Cas12 protein interact directly with the recognition sequence (e.g., cas12a protein interacts with PAM 5'-TTTN-3' or PAM 5 '-TTTV-3'). The PAM sequence is on the non-target strand and can be 5' or 3' of the target complement (e.g., in a CRISPR-Cas12a system, PAM 5' -TTTN-3' or PAM 5' -TTTV-3' sequence is on the non-target strand and 5' of the target complement). PAM is recognized by a Cas12 effector protein (e.g., cas12a protein) prior to target sequence unwinding and hydrogen base pair bonding between the target sequence and the nucleic acid target binding sequence.

"target," "target sequence," "nucleic acid target sequence," "target nucleic acid sequence," and "intermediate target sequence" are used interchangeably herein to refer to a nucleic acid sequence that is fully or partially complementary to a nucleic acid target binding sequence of a Cas12 polynucleotide (e.g., a targeting region). Typically, a nucleic acid target binding sequence is selected that is 100% complementary to the nucleic acid target sequence for which Cas12 nucleoprotein complex binds; however, to attenuate binding to a nucleic acid target sequence, a lower percentage of complementarity may be used.

A target sequence is said to be "mid-target" when the nucleic acid target binding sequence is 100% complementary to the target sequence (excluding abasic sites included in the nucleic acid target binding sequence). Mid-target sequence binding refers to the binding of the Cas12 guide/nucleoprotein complex to a nucleic acid sequence that is 100% complementary to the non-abasic site portion of the nucleic acid target binding sequence (spacer). A target sequence may be referred to as "off-target" when the nucleic acid target binding sequence (spacer) has less than 100% complementarity to the target sequence (excluding abasic sites included in the nucleic acid target binding sequence). Off-target sequence binding refers to binding of the Cas12 guide/nucleoprotein complex to a nucleic acid sequence that has less than 100% complementarity to the non-abasic site portion of the nucleic acid target binding sequence (spacer). The nucleic acid target sequence may be a double-stranded or single-stranded DNA molecule. The target sequence may be a double-stranded or single-stranded RNA molecule. The target sequence may be an RNA-DNA hybrid molecule. The target sequences may be present on opposite strands of the PAM sequence.

As used herein, "double strand break" (DSB) refers to the cleavage of both strands of a double-stranded segment of DNA. In some cases, if such a break occurs, one strand can be said to have a "sticky end" in which the nucleotide is exposed rather than hydrogen bonded to the nucleotide on the other strand. In other cases, a "blunt end" may occur in which the two strands remain fully base paired with each other.

"donor polynucleotide", "donor oligonucleotide", "donor template", "non-viral donor" and "non-viral template" are used interchangeably herein and may be double stranded polynucleotides (e.g., DNA), single stranded polynucleotides (e.g., DNA or RNA), or combinations thereof. The donor polynucleotide may comprise homology arms flanking the insertion sequence (e.g., DSBs in DNA). The length of the homology arms on each side can vary. Parameters for designing and constructing donor polynucleotides are well known in the art. See, e.g., ran et al (Nature Protocols,2013,8 (11): 2281-2308); smithies et al (Nature, 1985, 317:230-234); thomas et al (Cell, 1986, 44:419-428); wu et al (Nature Protocols,2008, 3:1056-1076); singer et al (Cell, 1982, 31:25-33); shen et al (Genetics, 1986, 112:441-457); watt et al (PNAS, 1985, 82:4768-4772); sugawara et al (Journal of Molecular Cell Biology,1992,12 (2): 563-575); rubnitz et al (Journal of Molecular Cell Biology,1984,4 (11): 2253-2258); ayares et al (PNAS, 1986,83 (14): 5199-5203); liskay et al (Genetics, 1987,115 (1): 161-167). In some embodiments, the donor polynucleotide comprises a Chimeric Antigen Receptor (CAR).

As used herein, "homology directed repair" (HDR) refers to DNA repair that occurs in a cell, for example, during repair of a DSB in DNA. HDR requires nucleotide sequence homology and uses a donor polynucleotide to repair sequences in which DSBs occur (e.g., within a target DNA sequence). The donor polynucleotide typically has the requisite sequence homology to the DSB flanking sequences so that the donor polynucleotide can be used as a suitable template for repair. HDR results in transfer of genetic information from, for example, a donor polynucleotide to a target DNA sequence. HDR can result in a change (e.g., an insertion, deletion, or mutation) in a target DNA sequence if the donor polynucleotide sequence is different from the target DNA sequence and some or all of the donor polynucleotide is incorporated into the target DNA sequence. In some embodiments, the entire donor polynucleotide, a portion of the donor polynucleotide, or a copy of the donor polynucleotide is integrated at the site of the target DNA sequence. For example, the donor polynucleotide may be used to repair a break in a target DNA sequence, wherein the repair results in transfer of genetic information (e.g., a polynucleotide sequence) from the donor polynucleotide to or in close proximity to the site of the DNA break. Thus, new genetic information (e.g., polynucleotide sequences) can be inserted or replicated at the target DNA sequence.

As used herein, "homologous independent target integration" (HITI) refers to DNA repair that occurs in a cell, for example, during repair of a DSB in DNA. Unlike HDR, HITI does not require nucleotide sequence homology, and uses a donor polynucleotide to repair sequences in which DSBs occur (e.g., within a target DNA sequence). HITIs result in the transfer of genetic information from, for example, a donor polynucleotide to a target DNA sequence. The HITI may result in an alteration (e.g., an insertion, deletion, or mutation) of a target DNA sequence if the donor polynucleotide sequence is different from the target DNA sequence and some or all of the donor polynucleotide is incorporated into the target DNA sequence. In some embodiments, the entire donor polynucleotide, a portion of the donor polynucleotide, or a copy of the donor polynucleotide is integrated at the site of the target DNA sequence. For example, the donor polynucleotide may be used to repair a break in a target DNA sequence, wherein the repair results in transfer of genetic information (e.g., a polynucleotide sequence) from the donor polynucleotide to or in close proximity to the site of the DNA break. Thus, new genetic information (e.g., polynucleotide sequences) can be inserted or replicated at the target DNA sequence.

A "genomic region" is a segment of a chromosome in the genome of a host cell that is present on either side of, or alternatively also includes a portion of, a nucleic acid target sequence site. The homology arms of the donor polynucleotide have sufficient homology to allow homologous recombination with the corresponding genomic region. In some embodiments, the homology arm of the donor polynucleotide shares significant sequence homology with a genomic region directly flanking the target sequence site of the nucleic acid; it will be appreciated that the homology arms may be designed to have sufficient homology to genomic regions remote from the target sequence site of the nucleic acid.

As used herein, "non-homologous end joining" (NHEJ) refers to repairing a DSB in DNA by directly joining one end of a break to the other end of the break without the need for a donor polynucleotide. NHEJ is a DNA repair pathway available to cells to repair DNA without the use of repair templates. NHEJ in the absence of donor polynucleotide typically results in random insertion or deletion of nucleotides at the site of DSB.

"micro-homology mediated end ligation" (MMEJ) is a pathway to repair DSB in DNA. MMEJ involves deletion of the DSB flanking and alignment of micro-homologous sequences inside the cleavage site prior to ligation. MMEJ is genetically defined and requires, for example, ctIP, poly (ADP-ribose) polymerase 1 (PARP 1), DNA polymerase θ (Pol θ), DNA ligase 1 (Lig 1) or DNA ligase 3 (Lig 3) activities. Additional genetic components are known in the art. See, e.g., sfeir et al (Trends in Biochemical Sciences,2015, 40:701-714).

As used herein, "DNA repair" encompasses any process by which cellular mechanisms repair damage to DNA molecules contained in cells. Repaired lesions may include single strand breaks or Double Strand Breaks (DSBs). There are at least three mechanisms to repair DSBs: HDR, NHEJ and MMEJ. "DNA repair" is also used herein to refer to DNA repair resulting from human manipulation, wherein the target locus is modified, e.g., by insertion, deletion or substitution of nucleotides, all of which represent forms of genome editing.

As used herein, "recombination" refers to the process of exchanging genetic information between two polynucleotides.

The terms "regulatory sequence," "regulatory element," and "control element" are used interchangeably herein and refer to a polynucleotide sequence upstream (5 'non-coding sequence), internal, or downstream (3' non-translated sequence) of a polynucleotide target to be expressed. Regulatory sequences affect, for example, the time of transcription, the amount or level of transcription, RNA processing or stability, and/or translation of the relevant structural nucleotide sequence. Regulatory sequences may include activator binding sequences, enhancers, introns, polyadenylation recognition sequences, promoters, transcription initiation sites, repressor binding sequences, stem-loop structures, translation initiation sequences, internal Ribosome Entry Sites (IRES), translation leader sequences, transcription termination sequences (e.g., polyadenylation signals and poly-U sequences), translation termination sequences, primer binding sites, and the like.

Regulatory elements include those that direct constitutive, inducible or repressible expression of a nucleotide sequence in many types of host cells, and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). In some embodiments, the vector comprises one or more pol III promoters, one or more pol II promoters, one or more pol I promoters, or a combination thereof. Examples of pol III promoters include, but are not limited to, U6 and H1 promoters. Examples of pol II promoters include, but are not limited to, the retrovirus Rous Sarcoma Virus (RSV) LTR promoter (optionally with the RSV enhancer), the Cytomegalovirus (CMV) promoter (optionally with the CMV enhancer; see, e.g., bosharp et al (Cell, 1985, 41:521-530)), the SV40 promoter, the dihydrofolate reductase promoter, the beta-actin promoter, the phosphoglycerate kinase (PGK) promoter, and the EF1 alpha promoter. Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of host cell to be transformed, the desired level of expression, and the like. The vector may be introduced into a host cell to produce transcripts, proteins or peptides, including fusion proteins or peptides, encoded by the nucleic acid sequences described herein.

As used herein, "gene" refers to a polynucleotide sequence comprising exons and associated regulatory sequences. Genes may also contain introns and/or untranslated regions (UTRs).

As used herein, the term "operably linked" refers to a polynucleotide sequence or an amino acid sequence in a functional relationship with each other. For example, a regulatory sequence (e.g., a promoter or enhancer) is "operably linked" to a polynucleotide encoding a gene product if the regulatory sequence modulates or facilitates the regulation of transcription of the polynucleotide. Operably linked regulatory elements are typically adjacent to the coding sequence. However, enhancers may function if separated from the promoter by up to several kilobases or more. Thus, some regulatory elements may be operably linked to a polynucleotide sequence but not adjacent to the polynucleotide sequence. Similarly, translational regulatory elements help regulate the protein expression of polynucleotides.

As used herein, "expression" refers to transcription of a polynucleotide from a DNA template, resulting in, for example, messenger RNA (mRNA) or other RNA transcripts (e.g., non-coding, such as structural or scaffold RNAs). The term also refers to a process by which transcribed mRNA is translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products". If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

A "coding sequence" or a sequence "encoding" a polypeptide of choice is a nucleic acid molecule that, when placed under the control of appropriate regulatory sequences, transcribes (in the case of DNA) and translates (in the case of mRNA) into the polypeptide in vitro or in vivo. The boundaries of the coding sequence are determined by the start codon at the 5 'end and the translation stop codon at the 3' end. The transcription termination sequence may be located 3' to the coding sequence.

As used herein, the term "modulate" refers to a change in the amount, degree, or quantity of a function. For example, cas12 guide/nucleoprotein complexes as disclosed herein can modulate the activity of a promoter sequence by binding to a nucleic acid target sequence at or near the promoter. Depending on the effect that occurs after binding, the Cas12 guide/nucleoprotein complex can induce, enhance, repress or inhibit transcription of a gene operably linked to a promoter sequence. Thus, "modulation" of gene expression includes gene activation and gene repression.

Modulation can be determined by assaying any characteristic that is directly or indirectly affected by the expression of the target gene. These characteristics include, for example, changes in RNA or protein levels, protein activity, product levels, gene expression, or activity levels of a reporter gene. Thus, the terms "modulating expression," "inhibiting expression," and "activating expression" of a gene can refer to the ability of the Cas12 guide/nucleoprotein complex to alter, activate, or inhibit transcription of the gene.

As used herein, "vector" and "plasmid" refer to polynucleotide vectors that introduce genetic material into cells. The carrier may be linear or circular. The vector may contain replication sequences (e.g., origins of replication) capable of effecting replication of the vector in a suitable host cell. In transforming a suitable host, the vector may replicate and function independently of the host genome or may be integrated into the host genome. The design of the vector depends inter alia on the intended use of the vector and the host cell, and the design of the vector for a specific use and host cell is within the state of the art. Four major types of vectors are plasmids, viral vectors, cosmids, and artificial chromosomes. Typically, the vector comprises an origin of replication, a multiple cloning site and/or a selectable marker. Expression vectors typically comprise an expression cassette. "recombinant virus" means a virus that has been genetically altered, for example, by the addition or insertion of a heterologous nucleic acid construct into the viral genome or a portion thereof.

As used herein, an "expression cassette" refers to a polynucleotide construct that is produced using recombinant methods or by synthetic means and that comprises regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequences may facilitate transcription of the selected polynucleotide in a host cell or transcription and translation of the selected polynucleotide in a host cell. The expression cassette may, for example, be integrated into the genome of the host cell or present in a vector to form an expression vector.

As used herein, a "targeting vector" is a recombinant DNA construct that generally comprises custom DNA arms that are homologous to genomic DNA flanked by elements (e.g., DSBs) of a target gene or nucleic acid target sequence. The targeting vector comprises a donor polynucleotide. The elements of the target gene may be modified in a variety of ways, including deletions and/or insertions. The defective target gene may be replaced by a functional target gene or, in the alternative, the functional gene may be knocked out. Optionally, the donor polynucleotide of the targeting vector comprises a selection cassette comprising a selectable marker introduced into the target gene. Targeting regions near or within the target gene may be used to affect modulation of gene expression.

"Gene editing" or "genome editing" as used herein means a type of genetic engineering that results in a nucleotide sequence or even a single base genetic modification, such as an insertion, deletion or substitution, at a particular site in the genome of a cell. The term includes, but is not limited to, heterologous gene expression, gene or promoter insertions or deletions, nucleic acid mutations, and destructive gene modifications as defined herein.

As used herein, the term "between … …" includes endpoints within a given range (e.g., between about 1 to about 50 nucleotides in length includes 1 nucleotide and 50 nucleotides).

As used herein, the term "amino acid" refers to natural and synthetic (non-natural) amino acids, including amino acid analogs, modified amino acids, peptidomimetics, glycine, and D or L optical isomers.

The terms "peptide", "polypeptide" and "protein" as used herein are interchangeable and refer to a polymer of amino acids. The polypeptide may be of any length. It may be branched or straight chain, it may be interrupted by non-amino acids, and it may comprise modified amino acids. The term also refers to amino acid polymers that have been modified (e.g., with a labeling component or ligand) by, for example, acetylation, disulfide bond formation, glycosylation, lipidation, phosphorylation, pegylation, biotinylation, crosslinking, and/or conjugation. Unless otherwise indicated, polypeptide sequences are shown herein in a conventional N-terminal to C-terminal orientation. Polypeptides and polynucleotides may be prepared using conventional techniques in the field of molecular biology. In addition, essentially any polypeptide or polynucleotide may be obtained from commercial sources.

The terms "fusion protein" and "chimeric protein" as used herein refer to a single protein produced by joining two or more proteins, protein domains, or protein fragments that do not naturally occur together in a single protein.

The fusion protein may also comprise a tableA bit tag (e.g., a histidine tag,(Sigma Aldrich, st.louis, MO), myc tags), reporter sequences (e.g., glutathione-S-transferase, β -galactosidase, luciferase, green fluorescent protein, cyan fluorescent protein, yellow fluorescent protein) and/or nucleic acid sequence binding domains (e.g., DNA binding domains or RNA binding domains). The fusion protein may comprise at least one Nuclear Localization Sequence (NLS), such as a Simian Virus 40 (SV 40) NLS or a nucleoplasmin NLS. The fusion protein may also comprise an activator domain (e.g., heat shock transcription factor, NFKB activator) or a repressor domain (e.g., KRAB domain). As described by Lupo et al (Current Genomics,2013,14 (4): 268-278), the KRAB domain is a potent transcriptional repressor module and is located in the amino terminal sequence of most C2H2 zinc finger proteins. See, for example, margolin et al (PNAS, 1994, 91:4509-4513); and Witzgall et al (PNAS, 1994,91:4514-4518 (1994)) KRAB domains bind to co-repressor proteins and/or transcription factors, usually via protein-protein interactions, causing transcriptional repression of Genes to which KRAB zinc finger proteins (KRAB-ZFP) bind see, e.g., friedman et al (Genes &Development,1996, 10:2067-2678). In some embodiments, the linker nucleic acid sequence is used to join two or more proteins, protein domains, or protein fragments.

As used herein, the term "nuclear localization sequence" (NLS) or "nuclear localization signal" refers to a polypeptide sequence of a protein that preferentially increases subcellular localization of the protein to the nucleus. The NLS sequence is typically an amino acid (or combination thereof) located at the amino terminus ("N-terminus"), carboxy terminus ("C-terminus") or within the protein that is positively altered, i.e., one or more NLS at the N-terminus and one or more NLS at the C-terminus. The NLS sequence may be directly covalently linked to the protein or may be linked via a linker polypeptide. The length of the linker sequence may be optimized based on the structural characteristics of the protein (e.g., solvent accessibility of the end, presence of other critical functional peptide sequences at the end, etc.) to ensure accessibility of the NLS sequence to homologous import protein binding and transport. In addition, the optimal linker length can be empirically screened (see, e.g., example 11). NLS sequences may be fully synthetic or derived from endogenous or exogenous protein sequences. Computational tools can be used to predict NLS sequences in proteins (see, e.g., moselab. Csb. Utoronto. Ca/NLStradamus/NLS-Mapper. Iab. Key. Ac. Jp/cgi-bin/NLS_mapper_form. Cgi). Examples of NLS sequences are presented in Table 2.

As used herein, "moiety" refers to a portion of a molecule. The moiety may be a functional group or describe a portion of a molecule having multiple functional groups (e.g., that share a common structural aspect). The terms "moiety" and "functional group" are generally used interchangeably; however, a "functional group" may more particularly refer to a portion of a molecule that comprises some common chemical behavior. "part" is generally used as a structural description. In some embodiments, the 5 'end, the 3' end, or both the 5 'end and the 3' end (e.g., the non-natural 5 'end and/or the non-natural 3' end in the first stem element) may comprise one or more moieties.

The terms "modified protein," "mutant protein," "protein variant," and "engineered protein" as used herein generally refer to a protein that has been modified such that it comprises a non-native sequence (i.e., the modified protein has a unique sequence compared to the unmodified protein).

"transformation" as used herein refers to the insertion of an exogenous polynucleotide into a host cell, regardless of the method used for the insertion. For example, transformation may be performed by direct uptake, transfection, infection, and the like. The exogenous polynucleotide may remain as a non-integrating vector, e.g., episome, or alternatively may be integrated into the host genome.

"host cell" is alreadyA cell transformed with or capable of being transformed with an exogenous DNA sequence. The host cell may be derived from any organism having one or more cells. Examples of host cells include, but are not limited to, prokaryotic cells, eukaryotic cells, bacterial cells, archaebacterial cells, cells of unicellular eukaryotic organisms, protozoal cells, cells from plants, algal cells, fungal cells (e.g., yeast cells, cells from mushrooms), animal cells, cells from invertebrates, cells from vertebrates, such as cells from mammals (e.g., pigs, cows, goats, sheep, rodents, rats, mice, non-human primates, humans, etc.). Furthermore, the host cell may be a stem cell or a progenitor cell, or a cell of the immune system, such as any cell of the immune system described herein. The host cell may be a human cell. For example, the host cell may be a lymphocyte or a stem cell, such as a hematopoietic stem cell. Lymphocytes include T cells, such as CD4, for cell-mediated cytotoxic adaptive immunity ⁺ And/or CD8 ⁺ Cytotoxic T cells; natural Killer (NK) cells that function in cell-mediated cytotoxic innate immunity; and antibody-driven adaptive immune B cells for use in body fluids. Hematopoietic stem cells that produce lymphoid cells are also included. In addition, CAR-T cells, T-cell receptor (TCR) cells (including TCR-engineered CAR-T cells), tumor Infiltrating Lymphocytes (TILs), CAR TILs, CAR-NK cells, and the like can be modified using the techniques herein. In some embodiments, the human cells are outside the human body. In some embodiments, the body cells of a living organism (e.g., a human body) are manipulated in vitro (i.e., ex vivo). Ex vivo generally refers to medical procedures in which an organ, cell or tissue is removed from a living body (e.g., a human body) for treatment or procedure and then returned to the living body. In vivo generally refers to medical procedures in which an organ, cell or tissue within a living body (e.g., a human body) is subjected to a treatment or procedure.

The terms "subject," "individual," or "patient" are used interchangeably herein and refer to any member of the phylum chordata, including, but not limited to, humans and other primates, including non-human primates, such as rhesus, chimpanzees, and other monkey and ape species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rabbits, mice, rats, and guinea pigs; birds, including poultry, wild and game birds, such as chickens, turkeys and other gallinaceous chickens, ducks and geese; etc. The term does not denote a particular age or gender. Thus, the term includes adult, young and neonatal individuals, as well as males and females. In some embodiments, the host cell is derived from a subject (e.g., a lymphocyte, stem cell, progenitor cell, or tissue-specific cell). In some embodiments, the subject is a non-human subject.

The term "effective amount" or "therapeutically effective amount" of a composition or agent (e.g., genetically engineered adoptive cell) as provided herein refers to a sufficient amount of the composition or agent to provide a desired response. Preferably, an effective amount will prevent, avoid or eliminate one or more deleterious side effects. This response will depend on the particular disease in question. For example, in a patient treated for cancer using adoptive cell therapy, the desired response may include preventing, avoiding, or eliminating one or more of the following: treating or preventing graft versus host disease (GvHD), host versus graft rejection, cytokine Release Syndrome (CRS), cytokine storm and reducing oncogenic transformation of the administered genetically modified cells. The exact amount of treatment required will vary from subject to subject, depending on the species, age and general condition of the subject, the severity of the condition being treated, and the particular modified lymphocytes used, the mode of administration, and the like. In any individual case, an appropriate "effective" amount can be determined by one of ordinary skill in the art using routine experimentation.

"treatment" or "treatment" of a particular disease, such as a cancerous condition or GvHD, includes: preventing a disease, e.g., preventing the progression of a disease or causing a disease to occur at a lower intensity in a subject who may be susceptible to the disease but has not yet experienced or displayed symptoms of the disease; inhibiting a disease, e.g., reducing the rate of progression, preventing progression or reversing a disease state; and/or alleviating symptoms of the disease, e.g., reducing the number of symptoms experienced by the subject.

Cas12 guides

The Cas12 chRDNA guide molecules of the present disclosure are capable of forming a nucleoprotein complex with a homologous Cas12 protein, such as a Cas12a protein, wherein the complex is capable of targeting a target sequence complementary to a targeting region (spacer sequence).

FIG. 1A illustrates an example of an amino acid coccus. BV3l6 Cas12a guide molecules comprise the following: an activation region (fig. 1a, 101) comprising a stem-loop duplex (fig. 1a, 102); and a spacer sequence (FIG. 1A, 103) comprising a target binding sequence (FIG. 1A, 104). Fig. 1B illustrates an alternative Cas12a guide molecule comprising the following: an activation region (FIG. 1B, 105) comprising a stem-loop duplex (FIG. 1B, 106); and a spacer sequence (FIG. 1B, 107) comprising a target binding sequence (FIG. 1B, 108) and a 3' extension (FIG. 1B, 109). The 3' extension (FIG. 1B, 109) may be linked to the spacer sequence (FIG. 1B, 107) via a linker sequence. Fig. 1C illustrates an alternative Cas12a guide molecule comprising the following: an activation region (FIG. 1C, 110) comprising a stem-loop duplex (FIG. 1C, 111) and a linker nucleotide (FIG. 1C, 114) and a 5' extension (FIG. 1C, 115); and a spacer sequence (FIG. 1C, 112) comprising a target binding sequence (FIG. 1C, 113).

In the Cas12 chRDNA guide molecules of the present disclosure, the targeting region may comprise DNA, RNA, or a mixture of DNA and RNA. In some embodiments, the targeting region may comprise both DNA and RNA. In certain embodiments, the targeting region can also comprise other base analogs, modified nucleotides, abasic sites, and the like, as well as synthetic, naturally occurring, and non-naturally occurring modified backbone residues or linkages, or combinations thereof.

In the Cas12 chRDNA guide molecules of the present disclosure, the activating region may comprise DNA, RNA, or a mixture of DNA and RNA. In some embodiments, the activation region may comprise both DNA and RNA. In certain embodiments, the activation region can also comprise other base analogs, modified nucleotides, abasic sites, and the like, as well as synthetic, naturally occurring, and non-naturally occurring modified backbone residues or linkages, or combinations thereof. In certain embodiments, the activation region is adjacent to the targeting region. In certain embodiments, the activation region is located downstream of the targeting region. In certain embodiments, the activation region is located upstream of the targeting region.

In some embodiments, the Cas12 chRDNA guide molecules of the present disclosure comprise a nucleic acid sequence, the nucleic acid sequence comprises a ribonucleotide base and about 2% or less, 3% or less, 4% or less, 5% or less, 6% or less, 7% or less, 8% or less, 9% or less, 10% or less, 11% or less, 12% or less, 13% or less, 14% or less, a nucleotide sequence that is a nucleotide sequence 15% or less, 16% or less, 17% or less, 18% or less, 19% or less, 20% or less, 21% or less, 22% or less, 23% or less, 24% or less, 25% or less, 26% or less, 27% or less, 28% or less, 29% or less, a 30% or less, 31% or less, 32% or less, 33% or less, 34% or less, 35% or less, 36% or less, 37% or less, 38% or less, 39% or less, 40% or less, 41% or less, 42% or less, 43% or less, 44% or less, 45% or less, 46% or less, 47% or less, 48% or less, 49% or less, 50% or less, 55% or less, 60% or less, 65% or less, 70% or less, or 75% or less deoxyribonucleotide bases or variant or modified derivatives thereof.

The Cas12chRDNA guide of the present disclosure can be, for example, 30-75 bases (including abasic sites) in length. In some embodiments, the Cas12chRDNA guide is 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75 bases (including abasic sites) in length. In some embodiments, the Cas12chRDNA guide is 40 bases in length (including abasic sites).

As used herein, the term "percentage of total length" of a polynucleotide sequence, such as a Cas12chRDNA guide, an activation region, or a targeting region, refers to the total length of the polynucleotide sequence, including, for example, abasic sites and modified and variant bases.

In some embodiments, the length of the activation region is between 10 and 25 bases (including abasic sites). In some embodiments, the length of the activation region is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 bases (including abasic sites). In some embodiments, the length of the activation region is 20 bases (including abasic sites).

In some embodiments, the targeting region is between 10 and 30 bases in length (including abasic sites). In some embodiments, the targeting region is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases (including abasic sites) in length. In some embodiments, the targeting region is 20 bases in length (including abasic sites).

In embodiments herein, the activation and/or targeting regions comprise ribonucleotide bases and one or more deoxyribonucleotide bases. In some embodiments, the activation region and/or the targeting region may also contain additional modifications, including base analogs, modified nucleotides, abasic sites, or combinations thereof. In some embodiments, the activation region and/or the targeting region may contain synthetic, naturally occurring, or non-naturally occurring modified backbone residues or linkages, or a combination thereof.

One or more deoxyribonucleotide bases can be present at any one or more positions in a targeting region. For example, for a targeting region of 30 bases in length (including abasic sites), one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30. For smaller targeting regions, the position will decrease accordingly. For example, for a targeting region of 20 bases in length (including abasic sites), one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

One or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof) may be present at any one or more positions in the targeting region. For example, for a targeting region of 30 bases in length (including abasic sites), one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30. For smaller targeting regions, the position will decrease accordingly. For example, for a targeting region of 20 bases in length (including abasic sites), one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

One or more deoxyribonucleotide bases may be present at any one or more positions in an activation region. For example, for an activation region of 25 bases in length (including abasic sites), one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. For smaller activation zones, the location will decrease accordingly. For example, for an activation region of 20 bases in length (including abasic sites), one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

One or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof) may be present at any one or more positions in the activation region. For example, for an activation region of 25 bases in length (including abasic sites), one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. For smaller activation zones, the location will decrease accordingly. For example, for an activation region of 20 bases in length (including abasic sites), one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

In some embodiments, the amount of deoxyribonucleotide bases is preferably 75% or less of the total size of the Cas12chRDNA guide (including abasic sites). In some embodiments, the amount of deoxyribonucleotide bases is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less, based on the total size of the Cas12chRDNA guide (including abasic sites).

In some embodiments, the amount of additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof) is preferably 75% or less of the total size of the Cas12chRDNA guide (including abasic sites). In some embodiments, the percentage of additional modifications to the total size of the Cas12chRDNA guide (including abasic sites) is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less.

In some embodiments, the amount of deoxyribonucleotide bases is preferably 75% or less based on the total size of the targeting region (including abasic sites). In some embodiments, the percentage of deoxyribonucleotide bases in the total size of the targeting region (including abasic sites) is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less.

In some embodiments, the amount of additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof) is preferably 75% or less of the total size of the targeting region (including abasic sites). In some embodiments, the percentage of additional modifications to the total size of the targeting region (including abasic sites) is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less.

In some embodiments, the amount of deoxyribonucleotide bases is preferably 75% or less based on the total size of the activation region (including abasic sites). In some embodiments, the percentage of deoxyribonucleotide bases in the total size of the activation region (including abasic sites) is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less.

In some embodiments, the amount of additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof) is preferably 75% or less of the total size of the activation region (including abasic sites). In some embodiments, the percentage of additional modifications to the total size of the activation region (including abasic sites) is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less.

In some embodiments, the amount of deoxyribonucleotide bases in an activation region and/or a targeting region is adjusted to provide a statistically significant difference compared to, for example, the corresponding deoxyribonucleotide base-free activation region and/or targeting region. In some embodiments, the statistically significant difference is a difference in mid-target or off-target editing.

In some embodiments, the activation region and the targeting region each contain one or more deoxyribonucleotide bases. In some embodiments, the activation region contains one or more deoxyribonucleotide bases and the targeting region does not contain any deoxyribonucleotide bases (e.g., contains only RNA and/or modified ribonucleotides). In some embodiments, the targeting region contains one or more deoxyribonucleotide bases and the activation region does not contain any deoxyribonucleotide bases (e.g., contains only RNA and/or modified ribonucleotides).

In some embodiments, the activation region and the targeting region each contain one or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof). In some embodiments, the activation region contains one or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof), and the targeting region does not contain any additional modifications (i.e., contains only RNA or DNA). In some embodiments, the targeting region contains one or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or a combination thereof), and the activation region does not contain any additional modifications (i.e., contains only RNA or DNA).

Figure 2 illustrates Cas12a protein (figure 2, 206) bound to a homologous Cas12a chRDNA guide molecule (figure 2, 204) comprising a target binding sequence (figure 2, 205). The Cas12a chRDNA guide/nucleoprotein complex untangling the target polynucleotide comprising the target sequence, and the target binding sequence of the Cas12chRDNA guide molecule (fig. 2, 205) is linked to the target sequence (fig. 2,207) via hydrogen bonds (fig. 2, represented by vertical lines between polynucleotides). In FIG. 2, the target polynucleotide comprises a target strand (FIG. 2, 201) comprising a target sequence (FIG. 2,207) and a non-target strand (FIG. 2, 202) comprising a PAM sequence (FIG. 2,203). PAM sequences (fig. 2,203) typically occur upstream (i.e., in the 5' direction) of the target sequence (fig. 2,207) on the non-target strand (fig. 2, 202). The formation of hydrogen bonds between the target binding sequence (fig. 2, 205) and the target sequence (fig. 2,207) of the Cas12a chRDNA guide molecule results in staggered cleavage of the target strand (fig. 2, 201) and the non-target strand (fig. 2, 202) (fig. 2, 208).

Figures 3A-3I illustrate various canonical and non-canonical nucleotides of Cas12chRDNA guide molecules for use in the present disclosure. Table 3 presents a series of indicators used in FIGS. 3A-3I.

FIG. 4 illustrates a Cas12a protein (FIG. 4,406) that binds to a homologous Cas12a chRDNA guide molecule (FIG. 4,404) that includes a target binding sequence (FIG. 4, 405), wherein the target binding sequence (FIG. 4, 405) includes non-RNA nucleotides (FIG. 4,409), both canonical and non-canonical nucleotides as presented in FIGS. 3B-3I. The Cas12a chRDNA guide/nucleoprotein complex untangling the target polynucleotide comprising the target sequence, and the target binding sequence of the Cas12chRDNA guide molecule (fig. 4, 405) is linked to the target sequence (fig. 4,407) via hydrogen bonds (fig. 4, represented by vertical lines between polynucleotides). In FIG. 4, the target polynucleotide comprises a target strand (FIG. 4,401) comprising a target sequence (FIG. 4,407) and a non-target strand (FIG. 4, 402) comprising a PAM sequence (FIG. 4, 403). PAM sequences (fig. 4, 403) typically occur upstream (i.e., in the 5' direction) of the target sequence (fig. 4,407) on the non-target strand (fig. 4, 402). The formation of hydrogen bonds between the target binding sequence of the chRDNA leader molecule (fig. 4, 405) and the target sequence (fig. 4,407) results in staggered cleavage of the target strand (fig. 4,401) and the non-target strand (fig. 4, 402) (fig. 4,408).

FIG. 5 illustrates an example of an amino acid coccus (strain BV3L 6). The Cas12a crRNA guide molecule comprises the following: an activation region (fig. 5, 501) comprising a stem-loop duplex (fig. 5, 502); and a spacer (fig. 5,503) comprising a target binding sequence (fig. 5,504). Each nucleotide position in the activation region (fig. 5, 501) and the spacer region (fig. 5,503) is labeled starting at the 5' end of the guide molecule, wherein the activation region and the target binding region each comprise RNA.

FIG. 6 illustrates an example of an amino acid coccus (strain BV3L 6). The Cas12a chRDNA guide molecule comprises the following: an activation region (fig. 6, 601) comprising a stem-loop duplex (fig. 6,602); and a spacer (fig. 6,603) comprising a target binding sequence (fig. 6,604). Each nucleotide position in the activation region (fig. 6, 601) and the spacer region (fig. 6,603) is labeled starting at the 5' end of the guide molecule, wherein the activation region comprises a mixture of RNA (white filled) and DNA (grey filled) and the target binding sequence comprises a mixture of RNA (white filled) and DNA (grey filled).

FIG. 7 illustrates an example of an amino acid coccus (strain BV3L 6). The Cas12a chRDNA guide molecule comprises the following: an activation region (fig. 7,701) comprising a stem-loop duplex (fig. 7, 702); and a spacer (fig. 7,703) comprising a target binding sequence (fig. 7, 704). Each nucleotide position in the activation region (fig. 7,701) and the spacer region (fig. 7,703) is labeled starting at the 5' end of the guide molecule, wherein the activation region comprises a mixture of RNA (white filled) and DNA (grey filled). Cas12a chRDNA guide molecules also contain other non-canonical nucleotides, such as chemically modified sugar nucleotides (fig. 7,705), abasic ribonucleotides (fig. 7,706), deoxyribonucleotides with chemically modified backbones (fig. 7,707), ribonucleotides with chemically modified backbones (fig. 7,708), and abasic deoxyribonucleotides (fig. 7,709).

Fig. 8 illustrates the formation of Cas12chRDNA guide/nucleoprotein complexes, wherein Cas12 protein (fig. 8,801) binds Cas12chRDNA guide molecule (fig. 8,802) to form Cas12chRDNA guide/nucleoprotein complex (fig. 8,803). The Cas12chRDNA guide/nucleoprotein complex (fig. 8,803) binds to a target polynucleotide (fig. 8,804), wherein the target polynucleotide contains a target sequence complementary to the target-binding sequence of the Cas12chRDNA guide molecule, and hydrogen bonds are formed between the target-binding sequence of the Cas12chRDNA guide molecule and the target sequence (fig. 8,805).

Fig. 9 illustrates the creation of an insertion or deletion (indel) in a target polynucleotide by a Cas12chRDNA guide/nucleoprotein complex, wherein the Cas12 protein (fig. 9, 901) complexed with a Cas12chRDNA guide molecule (fig. 9,902) binds to a target polynucleotide comprising PAM (fig. 9,904) (fig. 9,903), and the target polynucleotide is cleaved by the Cas12chRDNA guide/nucleoprotein complex (fig. 9,905). After targeting occurs, the Cas12chRDNA guide/nucleoprotein complex is separated from the target polynucleotide (fig. 9,906), wherein the target polynucleotide comprises an upstream (i.e., in the 5 'direction) strand (fig. 9,907) and a downstream (i.e., in the 3' direction) strand (fig. 9,908) relative to the PAM (fig. 9,904). Cellular DNA repair mechanisms repair target polynucleotides by inserting or deleting (figure 9,910) sequences around the cleavage site in the target polynucleotide. The upstream strand (FIG. 9,911) and the downstream strand (FIG. 9,912) are religated and the edited target polynucleotide (FIG. 9,914) comprises an indel (FIG. 9,913) at the cleavage site, wherein the edited target polynucleotide has a different sequence relative to the unedited target polynucleotide. In some embodiments, the creation of an insertion or deletion (indel) in the target polynucleotide by the Cas12chRDNA guide/nucleoprotein complex occurs within the cell.

Fig. 10 illustrates the incorporation of a donor polynucleotide sequence into a target polynucleotide, wherein Cas12 protein (fig. 10,1001) complexed with Cas12chRDNA guide molecule (fig. 10,1002) binds to a target polynucleotide (fig. 10,1003) comprising PAM (fig. 10,1004), and the target polynucleotide is cleaved by Cas12chRDNA guide/nucleoprotein complex (fig. 10,1005). After targeting occurs, the Cas12chRDNA guide/nucleoprotein complex is separated from the target polynucleotide (fig. 10,1006), wherein the target polynucleotide comprises an upstream (i.e., in the 5 'direction) strand (fig. 10,1007) and a downstream (i.e., in the 3' direction) strand (fig. 10,1008) relative to the PAM (fig. 10,1004), and wherein a donor polynucleotide is provided (fig. 10,1009). The cellular DNA repair mechanism repaired the target polynucleotide (fig. 10, 1010) using the donor polynucleotide (fig. 10,1011). The resulting edited target polynucleotide (fig. 10, 1010) contained a donor sequence at the target site (fig. 10,1011). In some embodiments, the incorporation of the donor polynucleotide sequence into the target polynucleotide occurs intracellularly.

Figure 11 illustrates a nick of a target polynucleotide in which Cas12 protein (figure 11,1101) complexed with Cas12chRDNA guide molecule (figure 11,1102) (comprising a DNA base in the target binding sequence (figure 11,1106)) binds to a target polynucleotide (figure 11,1103) comprising PAM (figure 11,1104), and the target polynucleotide creates a nick by Cas12chRDNA guide/nucleoprotein complex in only one strand of the target polynucleotide (figure 11,1105).

FIG. 12 illustrates the use of two nicked Cas12chRDNA guide/nucleoprotein complexes to create a staggered double-strand break in a target polynucleotide, wherein a first Cas12chRDNA guide/nucleoprotein complex binds to the target sequence upstream (i.e., in the 5' direction) of the target polynucleotide (FIG. 12,1201), creating a first nick in the target polynucleotide (FIG. 12,1202); and the second Cas12chRDNA guide/nucleoprotein complex binds to the target sequence downstream (i.e., in the 3' direction) of the target polynucleotide (fig. 12,1203), creating a second nick in the target polynucleotide (fig. 12,1204). After tandem nicking occurs, the cleaved target polynucleotide comprises an upstream (i.e., in the 5' direction) strand (FIG. 12, 1205) and a downstream (i.e., in the 3' direction) strand with a 5' overhang (FIG. 12,1206). A donor polynucleotide is provided, and a cellular DNA repair mechanism repairs the target polynucleotide (fig. 12,1207) using the donor polynucleotide (fig. 12,1208). The resulting edited target polynucleotide (fig. 12,1209) contained a donor sequence at the tandem nick site (fig. 12,1210). In some embodiments, the use of two nicked Cas12chRDNA guide/nucleoprotein complexes to generate staggered DSBs in the target polynucleotide occurs intracellularly.

FIG. 13 illustrates the position of the target binding sequence of the Cas12a chRDNA guide molecule for the amino acid coccus (strain BV3L 6) of the DNA base. The y-axis represents percent editing normalized to multiple targets with DNA (see example 5) at a single position in the target binding sequence (error bars show standard deviation). The x-axis represents the position (5 'to 3') of each position in the target binding sequence. The target binding sequence is illustrated above the graph (FIG. 13,1301), where the preferred positions for DNA base utilization (i.e., greater than 70% of the average normalized edits) are represented by grey fills. The location of the Cas12a chRDNA activation region is also indicated (figure 13,1302).

FIG. 14 illustrates the position of the activation region of the Cas12a chRDNA guide molecule for the amino acid coccus (strain BV3L 6) of the DNA base. The y-axis represents the normalized percent editing of the guide molecule with DNA at a single location in the activation region. The x-axis represents the position (5 'to 3') of each position in the activation region. The activation region is shown to the left of the graph (FIG. 14,1401), where the preferred positions for DNA base utilization (i.e., greater than 70% of the average normalized edits) are represented by grey fills. The position of the Cas12a chRDNA guide target binding sequence is also indicated (figure 14,1402).

Fig. 15A and 15B illustrate flow cytometry analysis of CAR-T cells engineered using Cas12a/chRDNA nucleoprotein complexes. Fig. 15A shows the percentage of cells expressing anti-BCMA CAR (fig. 15A, 1501), TRAC protein (fig. 15A, 1502) and B2M protein (fig. 15A, 1503). The x-axis represents untreated cells (fig. 15a, 1504), cells transfected with Cas12a chRDNA guide/nucleoprotein complexes targeting both TRAC and B2M genes (fig. 15a, 1505), and cells transfected with Cas12a chRDNA guide/nucleoprotein complexes targeting both TRAC and B2M genes and transduced with two viruses containing DNA donors encoding anti-BCMA CAR and B2M-HLA-E fusion genes, respectively (fig. 15a, 1506). The y-axis represents the percentage of positive cells for various cell surface markers measured via cytometry. Fig. 15B illustrates the results of in vitro cytotoxicity assays against BCMA positive target cell lines against BCMA, B2M-HLA-E CAR-T cells (grey circles) and control TRAC KO T cells (black circles). The y-axis represents the percent of target cell killing and the x-axis represents the E:T ratio used. Each data point represents the average of 3 co-cultured wells at each E: T ratio.

Fig. 16A and 16B illustrate the cell editing activity of Cas12a/chRDNA nucleoprotein complexes comprising multiple linkers and Nuclear Localization Sequences (NLS) configurations. The y-axis of the graphs in fig. 16A and 16B represents the percent editing measured by next generation sequencing. In fig. 16A, the x-axis represents each linker-NLS configuration, with each data point representing a duplicate measurement. In FIG. 16B, the x-axis represents pmol concentrations (20:60 or 80:240 pmol) of Cas12a and chRDNA guide for the first four linker-NLS designs shown in FIG. 16A as well as the "un-optimized" linker-NLS configuration (FIGS. 16B, 1613). Each data point represents a unique pilot target sequence and is the average of three duplicate measurements for each data point.

Figure 17 illustrates the cell editing activity of Cas12a chRDNA guide/nucleoprotein complexes with GS-SV40 (figure 7,1708;SEQ ID NO:479) and (G4S) 2-NPL (figure 7,1712;SEQ ID NO:489) when multiple Cas12a guides are co-delivered in a single transfection reaction. The y-axis of fig. 17 represents the percent editing measured by next generation sequencing. In fig. 17, the x-axis represents a target gene that is a TRAC gene (fig. 17,1701;SEQ ID NO:36), a B2M gene (fig. 17,1702;SEQ ID NO:62), a CISH gene (fig. 17,1703;SEQ ID NO:158), or a CBLB gene (fig. 17,1704;SEQ ID NO:171). Cas12a chRDNA guide/nucleoprotein complexes were used as single targeting complexes per transfection (fig. 17,1705 and 17,1709), two targeting complexes per transfection (fig. 17,1706 and 17,1710), or four targeting complexes per transfection (fig. 17,1707 and 17,1711). Each bar represents the average of 2-3 replicates.

Methods of designing specific Cas12 chRDNA guide molecules are known, wherein deoxyribonucleotide bases and optionally additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof) can be designed into the Cas12 chRDNA guide molecule. See, e.g., briner et al (Molecular Cell,2014, 56:333-339). To this end, the genomic sequence of the gene to be targeted is first identified. The exact targeting region of the gene selected will depend on the particular application. For example, to activate or repress a target gene using, for example, CRISPR activation or CRISPR inhibition, the Cas12 chRDNA guide/nucleoprotein complex can target a promoter that drives expression of the gene of interest. For gene knockout, the Cas12 chRDNA guide molecule can be designed to target exons of 5' constitutive expression to reduce the chance of removing the targeting region from the mRNA due to alternative splicing. Exons near the N-terminus can be targeted because the frameshift mutations herein will increase the likelihood of producing a nonfunctional protein product. Alternatively, homologous Cas12 chRDNA guide molecules can be designed to target exons encoding known essential protein domains. In this regard, when non-frameshift mutations such as insertions or deletions occur in protein domains essential for protein function, they are more likely to alter protein function. For gene editing using HDR, the target sequence should be close to the position of the desired editing. In this case, the position where editing is required is identified and the target sequence is selected nearby.

In some embodiments, the Cas12chRDNA guide molecule may be designed such that the Cas12chRDNA guide/nucleoprotein complex may bind outside the cleavage site of the Cas12 protein. In this case, the target nucleic acid may not interact with the Cas12chRDNA guide/nucleoprotein complex, and the target nucleic acid may be excised (e.g., without the Cas12chRDNA guide/nucleoprotein complex). In some embodiments, the Cas12chRDNA guide molecule may be designed such that the Cas12chRDNA guide/nucleoprotein complex may bind inside the cleavage site of the Cas12 protein. In this case, the target nucleic acid may interact with the Cas12chRDNA guide/nucleoprotein complex, and may bind to the target nucleic acid (e.g., to the Cas12chRDNA guide/nucleoprotein complex).

The Cas12chRDNA guide molecule may be designed in such a way that the Cas12chRDNA guide/nucleoprotein complex can hybridize to multiple locations in the nucleic acid sample. A plurality of Cas12chRDNA guide/nucleoprotein complexes may be contacted with a nucleic acid sample. The various Cas12chRDNA guide/nucleoprotein complexes may comprise Cas12chRDNA guide molecules designed to hybridize to the same sequence. The various Cas12chRDNA guide/nucleoprotein complexes may comprise Cas12chRDNA guide molecules designed to hybridize to different target sequences.

The target sequence may be at different positions within the target nucleic acid. The positions may comprise the same or similar target nucleic acid sequences. The positions may comprise different target nucleic acid sequences. The positions may be defined in terms of their distance from each other. The positions may be less than 10 kilobases (Kb) apart, less than 8Kb apart, less than 6Kb apart, less than 4Kb apart, less than 2Kb apart, less than 1Kb apart, less than 900 nucleotides apart, less than 800 nucleotides apart, less than 700 nucleotides apart, less than 600 nucleotides apart, less than 500 nucleotides apart, less than 400 nucleotides apart, less than 300 nucleotides apart, less than 200 nucleotides apart, or less than 100 nucleotides apart.

Cas12a chRDNA guide/nucleoprotein complexes can cleave target nucleic acids, which can result in excised target nucleic acids that can be less than 10 kilobases (Kb), less than 8Kb, less than 6Kb, less than 4Kb, less than 2Kb, less than 1Kb, less than 900 nucleotides, less than 800 nucleotides, less than 700 nucleotides, less than 600 nucleotides, less than 500 nucleotides, less than 400 nucleotides, less than 300 nucleotides, less than 200 nucleotides, or less than 100 nucleotides in length.

The Cas12chRDNA guide/nucleoprotein complex can bind to a fragmented target nucleic acid that can be less than 10 kilobases (Kb), less than 8Kb, less than 6Kb, less than 4Kb, less than 2Kb, less than 1Kb, less than 900 nucleotides, less than 800 nucleotides, less than 700 nucleotides long, less than 600 nucleotides, less than 500 nucleotides, less than 400 nucleotides, less than 300 nucleotides, less than 200 nucleotides, or less than 100 nucleotides in length.

The Cas12chRDNA guide molecules of the present disclosure can be synthesized in vitro by known methods, such as chemical synthesis in solution or on a solid support, or in some cases, can be recombinantly produced. A single production or synthesis technique or a combination of production and synthesis techniques may be used, wherein deoxyribonucleotide bases and/or modifications may be introduced at one or more positions in the length of the sequence.

In some embodiments, the Cas12chRDNA guide molecule, its targeting region, or its activating region is designed to contain deoxyribonucleotide bases (and/or modified deoxyribonucleotide bases) at certain positions as compared to a reference Cas12chRDNA guide molecule, a reference targeting region, or a reference activating region, each consisting of a ribonucleotide base, respectively.

In some embodiments, the reference Cas12a chRDNA guide molecule contains the following RNA sequences: UAAUUUCUACUCUUGUAGAUGAGUCUCUCAGCUGGUACAC. Cas12a chRDNA guide molecules of the present disclosure designed based on the reference RNA sequence comprise Cas12 chRDNA guide molecules having one or more deoxyribonucleotide bases at one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39 and 40. In some embodiments, 23 or fewer, 22 or fewer, 21 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these listed positions are deoxyribonucleotide bases. In some embodiments, all of the one or more deoxyribonucleotide bases in a targeting region form canonical base pairs with the target sequence. In some embodiments, at least one of the one or more deoxyribonucleotide bases in the targeting region does not form a canonical base pair with the target sequence.

In some embodiments, the reference Cas12a chRDNA guide molecule contains the following RNA sequences: UAAUUUCUACUCUUGUAGAUAGUGGGGGUGAAUUCAGUGU. Cas12 chRDNA guide molecules of the present disclosure designed based on the reference RNA sequence comprise Cas12 chRDNA guide molecules having one or more deoxyribonucleotide bases at one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, and 40. In some embodiments, 23 or fewer, 22 or fewer, 21 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these listed positions are deoxyribonucleotide bases. In some embodiments, all of the one or more deoxyribonucleotide bases in a targeting region form canonical base pairs with the target sequence. In some embodiments, at least one of the one or more deoxyribonucleotide bases in the targeting region does not form a canonical base pair with the target sequence.

In some embodiments, the reference activation region contains the following RNA sequences: UAAUUUCUACUCUUGUAGAU. The deoxyribonucleotide base-containing activation region of the present disclosure designed based on the reference RNA sequence comprises an activation region having one or more deoxyribonucleotide bases at one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19. In some embodiments, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these listed positions are deoxyribonucleotide bases.

In some embodiments, the reference targeting region contains the following RNA sequences: GAGUCUCUCAGCUGGUACAC. The targeting region containing deoxyribonucleotide bases of the present disclosure designed based on the reference RNA sequence comprises a targeting region having one or more deoxyribonucleotide bases at one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20. In some embodiments, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these listed positions are deoxyribonucleotide bases.

In some embodiments, the reference targeting region contains the following RNA sequences: AGUGGGGGUGAAUUCAGUGU. The targeting region containing deoxyribonucleotide bases of the present disclosure designed based on the reference RNA sequence comprises a targeting region having one or more deoxyribonucleotide bases at one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20. In some embodiments, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these listed positions are deoxyribonucleotide bases.

In some embodiments, the activation region has the sequence TrAArUrUrUCrUrCrUCrGrUrARGArU (where "r" precedes the ribonucleotide base; and the absence of "r" preceding the base indicates a deoxyribonucleotide base).

In some embodiments, the targeting region has the sequence GrArGrUrCrCrUrCrCrUrCrUrCrUrGrUrrCrAC (where "r" precedes the ribonucleotide base; and the absence of "r" preceding the base indicates a deoxyribonucleotide base).

In some embodiments, the targeting region has the sequence ArgGrrGrGrGrGrGrGrGrGrGrUrGArUrCrArGrUrGT (where "r" precedes the ribonucleotide base; and the absence of "r" preceding the base indicates a deoxyribonucleotide base).

In some embodiments, the Cas12a chRDNA guide has the sequence TrAArUrUrUCrUrACrUCrUTGrUrArGArUGrArGrUrCrUrCrUrCrAGrCr UrGrGrUrArCrAC (where "r" precedes the ribonucleotide base; and the absence of "r" preceding the base indicates a deoxyribonucleotide base).

In some embodiments, the Cas12a chRDNA guide has the sequence TrAArUrUrUCrUrACrUCrUTGrUrArGArUArGrUrGrGrGrGrGrUrGArA rUrUrCrArGrUrGT (where "r" precedes the ribonucleotide base; and the absence of "r" preceding the base indicates a deoxyribonucleotide base).

Cas12 proteins

Cas12 proteins of the present disclosure include, but are not limited to, cas12 wild-type proteins derived from a V-type CRISPR-Cas system, modified Cas12 proteins, variants of Cas12 proteins, cas12 orthologs, and combinations thereof. In some embodiments, the Cas12 protein is a wild-type Cas12a protein, a modified Cas12a protein, a variant of Cas12a protein, a Cas12a ortholog, or a combination thereof.

Cas12 proteins may be modified. Modifications may include modifications to amino acids. Modifications may also alter the primary amino acid sequence and/or secondary, tertiary and/or quaternary amino acid structure. In some embodiments, one or more amino acid sequences of the Cas12 protein may be varied without significantly affecting the structure or function of the Cas12 protein. If changes occur in some regions of the protein (e.g., non-critical regions), the type of mutation may not be relevant. Depending on the position of substitution, the mutation may not have a major effect on the biological properties of the resulting variant. For example, the characteristics and functions of certain Cas12 variants may be of the same type as the characteristics and functions of wild-type Cas 12.

In some cases, whether a mutation may severely affect the structure and/or function of the Cas12 protein may be determined using sequence and/or structural alignment. Sequence alignment may identify similar and/or dissimilar polypeptide regions (e.g., conserved, non-conserved, hydrophobic, hydrophilic, etc.). In some cases, regions of the sequence of interest that are similar to other sequences are suitable for modification. In other cases, regions of the sequence of interest that are dissimilar to other sequences are suitable for modification. For example, sequence alignment may be performed by database searches, pairwise alignments, multiple sequence alignments, genomic analysis, motif discovery, benchmarking assays and/or programs such as BLAST, CS-BLAST, HHPRED, psi-BLAST, LALIGN, pyMOL and SEQALN. Structural alignment can be performed by procedures such as Dali, PHYRE, chimera, COOT, O and PyMOL. Alignment may be performed by database search, pairwise alignment, multiple sequence alignment, genomic analysis, motif discovery, or benchmarking analysis, or any combination thereof.

Cas12 proteins typically consist of six domains corresponding to REC1, REC2, PAM Interaction (PI), nuclease (Nuc), ridge (WED), and RuvC domains. See, e.g., yamano et al (Cell, 2016,165 (4): 949-962). The WED domain and RuvC domain may have a three-part sequence structure interrupted by sequences from other domains. For example, the amino acid coccus Cas12a WED domain sequence is interrupted by REC1, REC2 and PI domain sequences. In addition, certain subtypes of Cas12 proteins contain a bridging helical domain that is adjacent to or exists between RuvC domain sequences.

The region of the Cas12 protein may be modified to modulate the activity of the Cas12 protein. For example, the region of the amino acid coccus (strain BV3L 6) Cas12a protein corresponding to residues of the PI domain (598-718) and WED domain (526-597 and 719-883) can be modified to alter PAM specificity. See, e.g., tback et al (Nucleic Acid Research,2020,48 (7): 3722-3733). The regions in the amino acid coccus (strain BV3L 6) Cas12a protein corresponding to residues of REC1 (24-319) and REC2 (320-526) domains can be modified to alter target engagement and cleavage kinetics. The regions of the REC1 (226-304) and REC2 (368-435) domains directly interact with the target binding sequence and PAM distal end of the target sequence, and can be engineered to alter the efficiency of target sequence cleavage. The regions of the Nuc domains (1066-1261) and RuvC domains (940-956, 957-1065, and 1261-1307) can be modified to alter the cleavage efficiency of the target, non-target, or target and non-target strands of the target sequence. Engineering these regions can include introducing mutations, substitutions with corresponding regions from other Cas12 orthologs, deletions, insertions, and the like.

The modified Cas12 protein may be used in combination with a Cas12chRDNA guide molecule to alter the activity or specificity of the Cas12 protein. In some cases, the Cas12 protein may be modified to provide enhanced activity or specificity when complexed with a Cas12chRDNA guide molecule, wherein Cas12 modification occurs in the REC1, REC2, ruvC, WED and/or Nuc domains. In some cases, the Cas12 protein may be modified to provide enhanced activity or specificity when complexed with a Cas12chRDNA guide molecule, wherein Cas12a modification occurs in regions 226-304, 368-435, 940-956, 978-1158, 1159-1180, and 1181-1298 (numbering based on the amino acid coccus Cas12a sequence).

Such mutations may be generated by site-directed mutagenesis. Mutations may include substitutions, additions, deletions, or any combination thereof. In some cases, the mutation converts the mutated amino acid to alanine. In other cases, the mutation converts the mutated amino acid into another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, or arginine). Mutations can convert a mutated amino acid to an unnatural amino acid (e.g., selenomethionine). Mutations can convert a mutated amino acid into an amino acid mimetic (e.g., a phosphate mimetic). The mutation may be a conservative mutation. For example, the mutation can convert the mutated amino acid to an amino acid that is similar to the size, shape, charge, polarity, conformation, and/or rotamer of the mutated amino acid (e.g., a cysteine/serine mutation, a lysine/asparagine mutation, a histidine/phenylalanine mutation).

In some embodiments, the Cas12 protein is an nCas12 protein. The nCas12 protein is a variant of a nuclease-deficient Cas12 protein, also known as a "nicking Cas12" or "Cas 12-nickase". Such molecules lack a portion of endonuclease activity and are therefore capable of creating nicks on only one strand of a target nucleic acid. See, e.g., jinek et al (Science, 2012, 337:816-821). This can be accomplished, for example, by introducing mutations into the RuvC nuclease domain. Non-limiting examples of such modifications may include D917A, E a and D1225A for the RuvC nuclease domain of the new francisco-killing Cas12a protein. It is understood that one skilled in the art could also make mutations in other catalytic residues to reduce the activity of RuvC nuclease domains. The resulting nCas12 protein is unable to cleave double stranded DNA, but retains the ability to complex with a guide molecule, bind to a target DNA sequence, and create a nick on only one strand of the target DNA. The targeting specificity is determined by the binding of Cas12 protein to PAM sequence, and by complementary base pairing of the guide molecule to the genomic locus. In some embodiments of the disclosure, the nCas12 protein is an nCas12a protein.

In some embodiments, the Cas12 protein is dCas12 protein. dCas12 protein is a variant of nuclease-inactivated Cas12 protein, also known as "catalytically inactivated Cas12 protein", "enzyme-inactivated Cas12", "catalytically dead Cas12", or "dead Cas12". Such molecules lack endonuclease activity and are therefore useful for modulating genes in an RNA-guided manner. See, e.g., jinek et al (Science, 2012, 337:816-821). Mutations to the catalytic residues can be made by those skilled in the art to eliminate the activity of RuvC domains. The resulting dCas12 protein is unable to cleave double stranded DNA, but retains the ability to complex with the guide molecule and bind to the target DNA sequence. The targeting specificity is determined by the binding of Cas12 protein to PAM sequence, and by complementary base pairing of the guide molecule to the genomic locus. In some embodiments of the present disclosure, the dCas12 protein is dCas12a protein.

Some Cas12 protein subtypes lack nuclease activity due to inactivation of RuvC-like nuclease domains, or deletion of some or all RuvC-like nuclease domains. One such subtype, type V-K and associated protein Cas12K, is instead associated with Tn 7-like transposable element tnsB, tnsC, tniQ. See, for example, strecker et al (Science, 2019,364 (6448):48-53). Cas12k retains the ability to complex with a guide molecule and bind to a target DNA sequence, and the associated Tn 7-like protein facilitates RNA-guided transposition of the DNA sequence. In some embodiments of the present disclosure, the Cas12 chRDNA guide/nucleoprotein complex is a Cas12k chRDNA guide/nucleoprotein complex.

Other amino acid changes may include amino acids having glycosylated forms, aggregated conjugates with other molecules, and covalent conjugates with unrelated chemical moieties (e.g., pegylated molecules). Covalent variants may be prepared by attaching functional groups to groups found in the amino acid chain or at the N-or C-terminal residues. In some cases, the mutant site-directed polypeptide may also include allelic variants and species variants.

In certain embodiments, the Cas12 protein may be a fusion protein or a chimeric protein that contains a first domain from a Cas12 protein and a second domain from a different protein, such as a Csy4 protein. Fusion modifications to Cas12 proteins may confer additional activity to the modified Cas12 proteins. Such activity may include nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, disproportionation enzyme activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolytic activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, reverse transcriptase activity, deubiquitination activity, adenylation activity, deadenylation activity, sumoylation activity, desumoylation activity, ribosylation activity, deribosylation activity and/or myristoylation activity or demyristoylation activity, which modifies a polypeptide associated with a nucleic acid target sequence (e.g., a histone).

In certain embodiments, the Cas12 protein may contain one or more NLS sequences (e.g., attached to and/or inserted into the Cas12 protein sequence). The NLS sequences can be located, for example, at the N-terminus, the C-terminus, or within a Cas12 protein (e.g., cas12a protein), including combinations thereof (e.g., one or more NLS at the N-terminus and one or more NLS at the C-terminus).

In certain embodiments, cas12 proteins, including Cas12a proteins, may contain multiple NLS sequences, such as, for example, at least 2, at least 3, at least 4, or at least 5 NLS sequences. The multiple NLS sequences may be present at a single end of the Cas12a protein (e.g., the NLS sequences are present at the N-terminus only or at the C-terminus only), or may be present at both ends (e.g., one or more NLS sequences at the N-terminus and one or more NLS sequences at the C-terminus). NLS sequences may be fully synthetic, modified or derived from endogenous or exogenous protein sequences. In some embodiments, cas12 proteins, including Cas12a proteins, may contain the following NLS sequences, modified or derived from an NLS sequence selected from the group consisting of: SV40 large T antigen, nucleoplasmin, 53BP1, VACM-1/CUL5, CXCR4, VP1, ING4, IER5, ERK5, UL79, EWS, hrp1, cMyc (1), cMyc (2), mouse c-able IV, mat.alpha.2 and MINIYO.

In some embodiments, cas12 proteins, including Cas12a proteins, may contain or be modified or derived from the NLS sequence of any of SEQ ID NOs 04, 05, and 493-507. The modified or derived NLS sequence may contain, for example, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 amino acid substitutions relative to a reference NLS sequence (e.g., an NLS sequence selected from any of SEQ ID NOs: 04, 05, and 493-507); 5 or less, 4 or less, 3 or less, 2 or less, or 1 amino acid deletions; and/or 5 or less, 4 or less, 3 or less, 2 or less, or 1 amino acid addition.

In some embodiments, the NLS sequence may be identical to a sequence selected from SEQ ID NOs: 04. the NLS sequence of any one of 05 and 493-507 has, for example, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.

The NLS sequences may be covalently linked directly or via a linker polypeptide (e.g., cas12 protein, another NLS sequence, or a fusion peptide sequence linked to Cas12 protein). The length of the linker sequence can be optimized according to the structural features of the particular Cas12 protein (e.g., solvent accessibility of the terminus, presence of other critical functional peptide sequences at the terminus, etc.) to ensure accessibility of the NLS sequence to the cognate introduced protein for binding and transport. In addition, the desired linker lengths can be empirically screened as described in example 11 herein.

In some embodiments, the NLS sequences are covalently linked via a linker sequence comprising one or more amino acids (e.g., cas12 protein, another NLS sequence, or a fusion peptide sequence linked to Cas12 protein). In some embodiments, the linker sequence contains at least one glycine, serine, and/or threonine residue. In some embodiments, the linker sequence contains at least one glycine residue and at least one serine residue. In some embodiments, the linker sequence contains a plurality of glycine residues and at least one serine residue. In some embodiments, the linker sequence consists of or comprises a GS sequence. In some embodiments, the linker sequence consists of or comprises a GGGGS sequence. In some embodiments, the linker sequence consists of or comprises a GGGGSGGGGS sequence.

In some embodiments, the Cas12a protein comprises at least one linker sequence and at least one NLS sequence at the C-terminus. In some embodiments, at least one NLS sequence is selected from SV40 large T antigen and nucleoplasmin or sequences modified or derived therefrom.

In certain embodiments, the Cas12a protein comprises a GGGGSGGGGS linker sequence and a nucleoprotein NLS sequence at the C-terminus, wherein the nucleoprotein NLS sequence is located on the C-terminal side of the GGGGSGGGGS linker sequence.

In certain embodiments, the Cas12a protein comprises at least one GS linker sequence, an SV40 large T antigen NLS sequence, and a nucleoplasmin NLS sequence at the C-terminus, wherein the nucleoplasmin NLS sequence is located on the C-terminal side of the SV40 large T antigen NLS sequence. In some embodiments thereof, the first GS linker sequence is present on the N-terminal side of the SV40 large T antigen NLS sequence and the second GS linker sequence is present between the SV40 large T antigen NLS sequence and the nucleoplasmin NLS sequence.

In certain embodiments, the Cas12a protein comprises a GS linker sequence, a GGGGSGGGGS linker sequence, an SV40 large T-antigen NLS sequence, and a nucleoplasmin NLS sequence at the C-terminus, wherein the nucleoplasmin NLS sequence is located on the C-terminal side of the SV40 large T-antigen NLS sequence. In some embodiments thereof, the GGGGSGGGGS linker sequence is present on the N-terminal side of the SV40 large T antigen NLS sequence, and the GS linker sequence is present between the SV40 large T antigen NLS sequence and the nucleoplasmin NLS sequence.

In certain embodiments, the Cas12a protein comprises a GGGGSGGGGS linker sequence and an SV40 large T antigen NLS sequence at the C-terminus, wherein the SV40 large T antigen NLS sequence is located on the C-terminal side of the GGGGSGGGGS linker sequence.

In some embodiments, the Cas12a protein comprises a sequence containing a linker and an NLS at the C-terminus. In some embodiments, the sequence comprising the linker and NLS comprises or consists of an amino acid sequence selected from SEQ ID NOs 479-490. In some embodiments, the linker and NLS containing sequence comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with an amino acid sequence selected from SEQ ID NOS 479-490.

Homologous Cas12chRDNA guide/nucleoprotein complexes can also be generated using methods well known in the art. The Cas12 protein component may be recombinantly produced, and then the Cas12chRDNA guide molecule and Cas12 protein may be complexed together using methods known in the art. See, e.g., example 2, which provides a non-limiting example of a method of assembling a nucleoprotein complex comprising a guide molecule/Cas 12 protein.

In addition, cell lines constitutively expressing Cas12 proteins can be developed and Cas12 chRDNA-directed components can be transfected and complexes can be purified from cells using standard purification techniques such as, but not limited to, affinity chromatography, ion exchange chromatography, and size exclusion chromatography. See, e.g., jinek et al (Science, 2012, 337:816-821).

According to known methods, cas12 proteins may be produced using expression cassettes encoding Cas12 proteins. Expression cassettes typically comprise regulatory sequences that function in the host cell into which they are introduced. Regulatory sequences are involved in one or more of the following: transcriptional regulation, post-transcriptional regulation, and translational regulation. The expression cassette may be present in an expression vector and introduced into a variety of host cells including bacterial cells, yeast cells, plant cells, and mammalian cells.

The Cas12 protein may be produced in a vector (including expression vectors) comprising a polynucleotide encoding the Cas12 protein. Vectors for producing Cas12 proteins include plasmids, viruses (including phages), and integrable nucleic acid fragments (i.e., fragments that can be integrated into the host genome by homologous recombination). The vector replicates and functions independently of the host genome or, in some cases, may integrate into the genome itself. Suitable replication vectors will contain replicons and control sequences derived from species compatible with the intended expression host cell. In some embodiments, the polynucleotide encoding the Cas12 protein is operably linked to an inducible promoter, a repressible promoter, or a constitutive promoter. The expression vector may also comprise a polynucleotide encoding a protein tag (e.g., poly-His tag, hemagglutinin tag, fluorescent protein tag, bioluminescent tag, nuclear localization tag). The coding sequence of such a protein tag may be fused to the coding sequence or may be contained in an expression cassette (e.g., a targeting vector).

General methods for constructing expression vectors are known in the art. Expression vectors for most host cells are commercially available. There are several types of commercial software products designed to facilitate selection of appropriate vectors and their construction, such as insect cell vectors for insect cell transformation and gene expression in insect cells, bacterial plasmids for bacterial transformation and gene expression in bacterial cells, yeast plasmids for cell transformation and gene expression in yeast and other fungi, mammalian vectors for mammalian cell transformation and gene expression in mammalian cells or mammals, viral vectors for cell transformation (including retrovirus, lentivirus, and adenovirus vectors), and gene expression and methods that allow easy cloning of such polynucleotides. For example, snapGene ^TM (GSL Biotech LLC, chicago, ill.; snapgene.com/resources/plasma_files/you_time_is_valid /) provides a broad list of vectors, individual vector sequences and vector maps, and a number of commercial sources of vectors. A large number of mammalian vectors suitable for use are commercially available (e.g., from Life Technologies, grand Island, N.Y., neoBiolab, cambridge, mass., promega, madison, wis., ATUM, menlo Park, calif., addgene, cambridge, mass.).

Vectors derived from mammalian viruses may also be used to express the Cas12 protein component of the methods of the invention in mammalian cells. These include vectors derived from viruses such as adenovirus, adeno-associated virus, parvovirus, herpes virus, polyoma virus, cytomegalovirus, lentiviruses, retroviruses, vaccinia virus, and simian virus 40 (SV 40). See, for example, kaufman et al (mol. Biotech.,2000, 16:151-160); and Cooray et al (Methods enzymol.,2012, 507:29-57). Regulatory sequences operably linked to a sequence encoding a Cas12 protein may include an activator binding sequence, an enhancer, an intron, a polyadenylation recognition sequence, a promoter, a repressor binding sequence, a stem-loop structure, a translation initiation sequence, a translation leader sequence, a transcription termination sequence, a translation termination sequence, a primer binding site, and the like. Commonly used promoters are the constitutive mammalian promoters CMV, MND, EF a, SV40, PGK1 (mouse or human), ubc, CAG, caMKIIa and β -Act, and others are known in the art. See, e.g., khan et al (Advanced Pharmaceutical Bulletin,2013, 3:257-263). In addition, mammalian RNA polymerase III promoters (including H1 and U6) may be used.

Many mammalian cell lines have been used to express gene products, including HEK 293 (human embryonic kidney) and CHO (chinese hamster ovary). These cell lines can be transfected by standard methods, for example using calcium phosphate or Polyethylenimine (PEI) or electroporation. Other typical mammalian cell lines include, but are not limited to, heLa, U2OS, 549, HT1080, CAD, P19, NIH 3T3, L929, N2a, human embryonic kidney 293 cells, MCF-7, Y79, SO-Rb50, hep G2, DUKX-X11, J558L and Baby Hamster Kidney (BHK) cells. Such cells are examples of cells that can be used to produce Cas12 proteins.

The vector may be introduced into a prokaryote and allowed to multiply in the prokaryote. Prokaryotic vectors are well known in the art. Typically, the prokaryotic vector comprises an origin of replication (e.g., oriC from E.coli, pUC from pBR322, pSC101 from Salmonella), a 15A origin (from p 15A) and a bacterial artificial chromosome) suitable for the target host cell. The vector may include selectable markers (e.g., genes encoding ampicillin, chloramphenicol, gentamicin, and kanamycin resistance). Zeocin ^TM (Life Technologies, grand Island, NY) can be used for selection of bacterial, fungal (including yeast), plant and mammalian cell lines. Thus, it can be designed to carry only Zeocin ^TM Drug resistance gene of (a)For performing a selection task in a number of organisms. Useful promoters for expressing proteins in prokaryotes are known, such as T5, T7, rhamnose (inducible), arabinose (inducible) and PhoA (inducible). In addition, the T7 promoter is widely used in vectors that also encode T7 RNA polymerase. Prokaryotic vectors may also include ribosome binding sites of varying strength and secretion signals (e.g., mal, sec, tat, ompC and pelB). In addition, the vector may comprise an RNA polymerase promoter for expression of NATNA. Prokaryotic RNA polymerase transcription termination sequences are also well known (e.g., transcription termination sequences from streptococcus pyogenes).

Expression of proteins in prokaryotes is often carried out in E.coli with vectors containing constitutive or inducible promoters directing the expression of fusion or non-fusion proteins. However, protein expression using other prokaryotic systems is within the scope of the present disclosure.

In some embodiments, the vector is a yeast expression vector. Examples of vectors for expression in Saccharomyces cerevisiae (Saccharomyces cerevisiae) include, but are not limited to, the following: pYepSec1, pMFa, pJRY88, pYES2 and picZ. Methods for gene expression in yeast cells are known in the art. See, e.g., christine Guthrie and Gerald r.fink ("Guide to Yeast Genetics and Molecular and Cell Biology, part a" in Methods in Enzymology,2004, volume 194, elsevier Academic Press, san Diego, CA). In general, expression of a gene encoding a protein in yeast requires a promoter and a transcription terminator operably linked to the coding region of interest. Various yeast promoters can be used to construct expression cassettes for expressing genes in yeast.

Genome editing of cells using Cas12chRDNA guide/nucleoprotein complexes

Delivery of Cas12chRDNA guide molecules, cas12 proteins, and Cas12chRDNA guide/nucleoprotein complexes of the present disclosure to cells in vitro, ex vivo, or in vivo can be accomplished by a variety of methods known to those of ordinary skill in the art. Non-limiting methods of introducing these components into cells include viral vector delivery, acoustic perforation, cell extrusion, electroporation, nuclear transfection, lipofection, particle gun technology, microprojectile bombardment, or chemicals (e.g., cell penetrating peptides).

In some embodiments, electroporation can be used to deliver Cas12chRDNA guide molecules of the present disclosure to cells. Electroporation may also be used to deliver Cas12chRDNA guide/nucleoprotein complexes of the disclosure. In these methods, the chRDNA guide molecule or Cas12chRDNA guide/nucleoprotein complex is mixed with target cells in an electroporation buffer to form a suspension. The suspension is then subjected to an electrical pulse at an optimized voltage that creates temporary pores in the phospholipid bilayer of the cell membrane, allowing charged molecules (such as nucleic acids and proteins) to be driven through the pores and into the cell. Reagents and equipment for performing electroporation are commercially available.

Example 3 illustrates nuclear transfection of activated T cells with Cas12 guide/nucleoprotein complexes. Example 5 illustrates nuclear transfection of activated T cells with Cas12chRDNA guide/nucleoprotein complex.

Cas12chRDNA guide/nucleoprotein complexes can be used to cleave or bind target nucleic acids. The Cas12chRDNA guide molecule may be introduced into the cell with the Cas12 protein, thereby forming a Cas12chRDNA guide/nucleoprotein complex. The Cas12chRDNA guide/nucleoprotein complex can hybridize to a target nucleic acid, wherein the target nucleic acid comprises PAM. In one embodiment, the present disclosure encompasses methods of binding a nucleic acid target sequence in a polynucleotide (e.g., double-stranded DNA (dsDNA)) comprising providing one or more Cas12chRDNA guide/nucleoprotein complexes for introduction into a cell and delivering the Cas12 nucleoprotein complexes into the cell, thereby facilitating contact of the Cas12chRDNA guide/nucleoprotein complexes with the target polynucleotide sequence. In one embodiment, the first Cas12chRDNA guide/nucleoprotein complex comprises a Cas12chRDNA guide molecule having a first targeting region element complementary to a first nucleic acid target sequence in a polynucleotide; and the second Cas12chRDNA guide/nucleoprotein complex comprises a Cas12chRDNA guide molecule having a second targeting region complementary to a second nucleic acid target sequence in the polynucleotide. Contact of the Cas12chRDNA guide/nucleoprotein complex with the polynucleotide results in binding of the Cas12chRDNA guide/nucleoprotein complex to a nucleic acid target sequence in the polynucleotide. In one embodiment, the first Cas12a chRDNA guide/nucleoprotein complex binds to a first nucleic acid target sequence; and a second Cas12a chRDNA guide/nucleoprotein complex binds to a second nucleic acid target sequence in the polynucleotide.

Such a method of binding a nucleic acid target sequence may be performed in vitro (e.g., in a biochemical reaction or in cultured cells; in some embodiments, the cultured cells are human cultured cells that remain in culture and are not introduced into a human; in vivo (e.g., in cells of a living organism, provided that in some embodiments the organism is a non-human organism), or ex vivo (e.g., cells removed from a subject, provided that in some embodiments the subject is a non-human subject).

Delivery of Cas12 chRDNA guide molecules, cas12 proteins, and Cas12 chRDNA guide/nucleoprotein complexes of the present disclosure to cells can be achieved by packaging the components into a biological compartment. The biological compartment comprising the component may be administered in vivo (e.g., in a cell of a living organism, provided that in some embodiments, the organism is a non-human organism). Biological compartments may include, but are not limited to, viruses (lentiviruses, adenoviruses), nanospheres, liposomes, quantum dots, nanoparticles, microparticles, nanocapsules, vesicles, polyethylene glycol particles, hydrogels, and micelles.

For example, the biological compartment may comprise a liposome. Liposomes can be self-assembled structures comprising one or more lipid bilayers, each of which can comprise two monolayers containing oppositely oriented amphiphilic lipid molecules. Amphiphilic lipids can comprise a polar (hydrophilic) headgroup covalently linked to one or two or more non-polar (hydrophobic) acyl or alkyl chains. Energy-unfavourable contact between the hydrophobic acyl chains and the surrounding aqueous medium induces self-alignment of the amphiphilic lipid molecules such that the polar head groups can be oriented towards the surface of the bilayer and the acyl chains towards the interior of the bilayer, thereby effectively protecting the acyl chains from contact with the aqueous environment.

Examples of preferred amphiphilic compounds for use in liposomes may include phosphoglycerides and sphingolipids, representative examples of which include phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, phosphatidylglycerol, palmitoyl oleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylcholine, distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine, lecithin, or any combination thereof.

The biological compartment may comprise nanoparticles. The nanoparticles may comprise diameters of about 40 nanometers to about 1.5 microns, about 50 nanometers to about 1.2 microns, about 60 nanometers to about 1 micron, about 70 nanometers to about 800 nanometers, about 80 nanometers to about 600 nanometers, about 90 nanometers to about 400 nanometers, or about 100 nanometers to about 200 nanometers. In some cases, the release rate may slow or extend as the nanoparticle size increases, and the release rate may increase as the nanoparticle size decreases.

In certain embodiments, the Cas12 chRDNA guide/nucleoprotein complex is packaged into a biological compartment. In some cases, the nucleic acid encoding Cas12 and the chemically synthesized chRDNA guide are packaged into a biological compartment. In some cases, mRNA encoding Cas12 and the chemically synthesized chRDNA guide are packaged into a biological compartment.

Various methods are known in the art for assessing and/or quantifying interactions between a nucleic acid sequence and a polypeptide, including, but not limited to, the following: immunoprecipitation (ChIP) assays, DNA Electrophoretic Mobility Shift Assay (EMSA), DNA pulldown assays, and microplate capture and detection assays. Commercial kits, materials and reagents may be used to carry out many of these methods and are available, for example, from the following suppliers: thermo Scientific (Wilmington, DE), signosis (Santa Clara, calif.), bio-Rad (Hercules, calif.) and Promega (Madison, wis.). A common method for detecting interactions between polypeptides and nucleic acid sequences is EMSA (see, e.g., hellman L.M. et al, nature Protocols 2 (8): 1849-1861 (2007)).

In another embodiment, the present disclosure encompasses methods of cleaving a nucleic acid target sequence in a polynucleotide (e.g., single strand cleavage in dsDNA or double strand cleavage in dsDNA) comprising providing one or more Cas12 chRDNA guide/nucleoprotein complexes for introduction into a cell and delivering the Cas12 chRDNA guide/nucleoprotein complexes into the cell, thereby facilitating contact of the Cas12 chRDNA guide/nucleoprotein complexes with the polynucleotide. In one embodiment, a first Cas12 chRDNA guide/nucleoprotein complex comprising a first Cas12 chRDNA guide molecule having a first targeting region complementary to a first nucleic acid target sequence in a polynucleotide and a second Cas12 chRDNA guide/nucleoprotein complex comprising a second Cas12 chRDNA guide molecule having a second targeting region complementary to a second nucleic acid target sequence in a polynucleotide are introduced into a cell. Contact results in the Cas12 chRDNA guide/nucleoprotein complex cleaving the nucleic acid target sequence in the polynucleotide (e.g., dsDNA). In one embodiment, the first Cas12a chRDNA guide/nucleoprotein complex binds to a first nucleic acid target sequence in dsDNA and cleaves a first strand of dsDNA; and the second Cas12a chRDNA guide/nucleoprotein complex binds to a second nucleic acid target sequence in the dsDNA and cleaves a second strand of the dsDNA. In some embodiments, the nucleic acid target sequence is DNA or genomic DNA. This method of binding nucleic acid target sequences is performed in vitro, in cells (e.g., in cultured cells), ex vivo (e.g., stem cells removed from a subject), and in vivo.

The target nucleic acid sequence may be appropriately selected based on, for example, a desired position in the polynucleotide sequence or genome and/or a desired gene sequence in the polynucleotide sequence or genome to be deleted or disrupted.

In further embodiments of cleaving a nucleic acid target sequence in a polynucleotide, a donor polynucleotide may also be introduced into a cell to facilitate incorporation of at least a portion of the donor polynucleotide into genomic DNA of the cell. Typically, a donor polynucleotide is fragmented in close proximity to a fixed-point target nucleic acid to enhance insertion (e.g., homologous recombination) of the donor polynucleotide into the double-strand-break site. In some cases, the donor polynucleotide is brought into close proximity to the double-strand break site in the target nucleic acid by binding the donor polynucleotide to a Cas12 protein (e.g., cas12 a) that produces the double-strand break.

The donor polynucleotide sequence may be appropriately selected based on, for example, the desired modification to be made. For example, the donor polynucleotide may encode all or part of the protein of interest. In some embodiments, the donor polynucleotide can encode a CAR.

The present disclosure also encompasses delivery of a donor polynucleotide to a cell via a virus, wherein the donor polynucleotide encodes a CAR.

In some embodiments, the donor polynucleotide may be single stranded. In some embodiments, the donor polynucleotide may be double stranded. In some embodiments, the donor DNA may be a micro-loop. In some embodiments, the donor polynucleotide may be a plasmid. In some embodiments, the plasmid may be supercoiled. In some embodiments, the donor polynucleotide may be methylated. In some embodiments, the donor polynucleotide may be unmethylated. The donor polynucleotide may comprise a modification. Modifications may include those described herein, including but not limited to biotinylation, chemical conjugates, and synthetic nucleotides.

Therapeutic compositions, uses and methods

The Cas12 chRDNA guide molecules and Cas12 chRDNA guide/nucleoprotein complexes of the present disclosure are useful for producing modified cells (e.g., CAR-expressing cells). Such modified cells are useful, for example, in the field of cell therapy (e.g., via administration of cells to treat or prevent a disease), particularly for adoptive cell therapy. Such administered cells may be, for example, genetically modified adoptive cells. Genetic modifications may be introduced into the adoptive cells by Cas12 chRDNA guide molecules and Cas12 chRDNA guide/nucleoprotein complexes disclosed herein using one or more delivery techniques. The present disclosure encompasses, for example, modifying and administering cells that are autologous or allogeneic with respect to the recipient to be administered. As used herein, the term "allogeneic" refers to different genetically diverse individuals of the same species. For example, allogeneic cells refer to cells derived from different genetically diverse individuals of the same species (relative to the recipient of the cells to be administered). In contrast, the term "autologous" refers to the same individual. For example, autologous cells administered to an individual refer to cells (modified or unmodified or modified or unmodified progeny thereof) derived from the same individual.

By "adoptive cell" is meant a cell that may be genetically modified for use in cell therapy treatment. Adoptive cells include, but are not limited to, stem cells, induced pluripotent stem cells, embryonic stem cells, cord blood stem cells, lymphocytes, natural killer cells, fibroblasts, endothelial cells, epithelial cells, pancreatic precursor cells, and the like.

"Stem cells" refers to cells that have the ability to self-renew (i.e., have the ability to undergo multiple cell division cycles while maintaining an undifferentiated state). Stem cells may be totipotent, pluripotent, multipotent, oligopotent or unipotent. The stem cells are embryonic, fetal, amniotic, adult or induced pluripotent stem cells.

"induced pluripotent stem cells" (ipscs) refer to a type of pluripotent stem cells that are artificially derived from non-pluripotent cells, typically somatic cells. In some embodiments, the somatic cell is a human somatic cell. Examples of somatic cells include, but are not limited to, dermal fibroblasts, bone marrow-derived mesenchymal cells, cardiomyocytes, keratinocytes, hepatocytes, gastric cells, neural stem cells, lung cells, kidney cells, spleen cells, and pancreatic cells. Additional examples of somatic cells include cells of the immune system including, but not limited to, B cells, dendritic cells, granulocytes, congenital lymphoid cells, megakaryocytes, monocytes/macrophages, myeloid-derived suppressor cells, NK cells, T cells, thymocytes, and hematopoietic stem cells. Pluripotent stem cells can differentiate into a variety of cell types including somatic cells, NK-like cells, T cell-like cells, NK-T cell-like cells, dendritic-like cells, macrophages and macrophage-like cells. The pluripotent stem cells can be edited with Cas12 chRDNA guide/nucleoprotein complex before or after differentiation. Ipscs can be further modified by introducing exogenous genes or sequences, such as CAR-encoding sequences, into the genome either before or after differentiation.

"hematopoietic stem cells" refers to undifferentiated cells that have the ability to differentiate into hematopoietic cells, such as lymphocytes.

"lymphocyte" refers to a white blood cell (white blood cell) that is part of the vertebrate immune system. The term "lymphocyte" also encompasses hematopoietic stem cells that produce lymphoid cells. Lymphocytes include T cells for cell-mediated cytotoxic adaptive immunity, such as cd4+ and/or cd8+ cytotoxic T cells; alpha/beta T cells and gamma/delta T cells; regulatory T cells, such as Treg cells; natural Killer (NK) cells that function in cell-mediated cytotoxic innate immunity; b cells for antibody-driven adaptive immunity of body fluids; NK/T cells; cytokine-induced killer cells (CIK cells); and Antigen Presenting Cells (APCs), such as dendritic cells. The lymphocytes may be mammalian cells, such as human cells.

The term "lymphocyte" as used herein also encompasses T cell receptor engineered T Cells (TCRs) genetically engineered to express one or more specific naturally occurring or engineered T cell receptors capable of recognizing a protein or (glyco) lipid antigen of a target cell. Small fragments of these antigens, such as peptides or fatty acids, are shuttled to the target cell surface and presented to T cell receptors as part of the Major Histocompatibility Complex (MHC). Binding of T cell receptors to antigen-loaded MHC activates lymphocytes.

The term "lymphocyte" as used herein also encompasses Tumor Infiltrating Lymphocytes (TILs). TIL is an immune cell that has penetrated into the environment within and surrounding the tumor ("tumor microenvironment"). TIL is typically isolated from tumor cells and tumor microenvironment and selected in vitro for high reactivity against tumor antigens. TIL is grown in vitro under conditions that overcome the tolerogenic effects present in vivo and then introduced into a subject for treatment.

The term "lymphocyte" also encompasses genetically modified T cells and NK cells, such as those cells modified to produce a Chimeric Antigen Receptor (CAR) on the surface of a T or NK cell (CAR-T cells and CAR-NK cells).

Lymphocytes may be isolated from a subject, such as a human subject, e.g., from blood or a solid tumor, as in the case of TIL; or isolated from lymphoid organs such as thymus, bone marrow, lymph nodes and mucosa-associated lymphoid tissue. Techniques for isolating lymphocytes are well known in the art. For example, lymphocytes may be isolated from Peripheral Blood Mononuclear Cells (PBMCs) that are isolated from whole blood using, for example, ficoll, hydrophilic polysaccharides that separate the blood layers, and density gradient centrifugation. Typically, an anticoagulant or defibrinated blood sample is layered on top of a Ficoll solution and centrifuged to form different cell layers. The bottom layer includes red blood cells (red blood cells) that are collected or aggregated by the Ficoll medium and sink completely to the bottom. The next layer contains mainly granulocytes, which also migrate down through the Ficoll-paque solution. The next layer includes lymphocytes, which are typically at the interface between plasma and Ficoll solution; monocytes and platelets. To isolate lymphocytes, the layer was recovered, washed with saline to remove platelets, ficoll and plasma, and then centrifuged again.

Other techniques for isolating lymphocytes include biopanning (biopanning), which separates a population of cells from solution by binding the cells of interest to an antibody-coated plastic surface. Unwanted cells are then removed by treatment with specific antibodies and complement. In addition, fluorescence Activated Cell Sorter (FACS) analysis can be used to detect and count lymphocytes. FACS analysis uses a flow cytometer that separates labeled cells based on differences in light scattering and fluorescence.

For TIL, lymphocytes are isolated from tumors and grown, for example, in high doses of IL-2, and selected using cytokine release co-culture assays against autologous tumors or HLA-matched tumor cell lines. Cultures with evidence of increased specific reactivity compared to allogeneic non-MHC matched controls can be selected for rapid expansion and then introduced into subjects to treat cancer. See, e.g., rosenberg et al (Clin. Cancer Res.,2011, 17:4550-4557); dudly et al (Science, 2002, 298:850-854); dudly et al (J.Clin. Oncol.,2008, 26:5233-5239); and Dudley et al (J.Immunother., 2003, 26:332-342).

Lymphocytes, when isolated, can be characterized in terms of specificity, frequency, and function. Frequently used assays include ELISPOT assays, which measure the frequency of T cell responses.

After isolation, lymphocytes can be activated using techniques well known in the art to promote proliferation and differentiation into specialized effector lymphocytes. Surface markers for activated T cells include, for example, CD3, CD4, CD8, PD1, IL2R, and the like. Activated cytotoxic lymphocytes can kill target cells after binding to cognate receptors on the surface of the target cells. Surface markers for NK cells include, for example, CD16, CD56, and the like.

After isolation and optional activation, lymphocytes can be modified using Cas12chRDNA guide/nucleoprotein complexes of the disclosure for adoptive T cell immunotherapy. Adoptive immunotherapy generally utilizes immune cells (autologous cells) of a patient to treat cancer. However, the method of the present invention for generating adoptive immunotherapy also allows the use of third party donor cells (allogeneic cells), resulting in "off the shelf" therapy.

Thus, in some embodiments, lymphocytes for adoptive immunotherapy are isolated from a subject, modified ex vivo, and then reintroduced into the same subject. This technique is known as "autologous lymphocyte therapy".

Alternatively, lymphocytes may be isolated, modified ex vivo and introduced into different subjects. This technique is known as "allogeneic lymphocyte therapy".

In certain embodiments, the Cas12 chRDNA guide/nucleoprotein complex is used to produce a therapeutic composition comprising allogeneic cells. In a preferred embodiment, the allogeneic cells are T cells. In a more preferred embodiment, the T cell expresses a CAR. In an even more preferred embodiment, the CAR targets an antigen associated with cancer.

In some embodiments, T cells may be modified to allow for safer and more effective allogeneic therapies. For example, the T cell receptor alpha constant region (TRAC) is a gene encoding a protein that forms part of an αβ TCR. Thus, selected mutations in TRAC and knockdown expression of TRAC may help to eliminate GvHD during allogeneic cell therapy. See, e.g., poirot et al (Cancer Res.,2015, 75:3853-3864). The use of the CRISPR-Cas9 system to direct CD19 specific CARs to the TRAC locus has been shown to lead to tumor rejection. See, e.g., eyquem et al (Nature, 2017, 543:113). Similarly, T cell receptor beta constant regions (TRBC) can also be targeted to prevent expression of the αβ TCR. See, e.g., ren et al (Clin. Cancer Res.,2017, 23:2255-2266).

Programmed cell death protein 1, also known as PD1, PDCD1 and CD279, is a cell surface receptor that plays an important role in down-regulating the immune system and promoting self-tolerance by suppressing T cell inflammatory activity. PDCD1 binds its cognate ligand "programmed death ligand 1", also known as PD-L1, CD274, and B7 homolog 1 (B7-H1). PD1 prevents autoimmunity by a dual mechanism that promotes programmed cell death (apoptosis) in antigen-specific T cells in lymph nodes while reducing apoptosis in anti-inflammatory suppressor T cells (regulatory T cells). Through these mechanisms, PD1 binding of PD-L1 inhibits the immune system, thereby preventing autoimmune disorders, and also preventing the immune system from killing cancer cells. Thus, mutation or knockout generation of PD1 may be beneficial in T cell therapies.

PD1 is an example of an "immune checkpoint" molecule. Immune checkpoint molecules are used to down regulate or suppress immune responses. Immune checkpoint molecules include, but are not limited to, PD1, cytotoxic T lymphocyte antigen 4 (CTLA-4, also known as CD 152), LAG3 (also known as CD 223), tim3 (also known as HAVCR 2), BTLA (also known as CD 272), BY55 (also known as CD 160), TIGIT (also known as IVSTM 3), LAIR1 (also known as CD 305), SIGLEC10, 2B4 (also known as CD 244), PPP2CA, PPP2CB, PTPN6, PTPN22, CD96, CRTAM, SIGLEC7, SIGLEC9, TNFRSF10B, TNFRSF10A, CASP, CASP10, CASP3, CASP6, CASP7, FADD, FAS, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL ST, EIF2AK4, CSK, PAG1, SIT1, FOXP3, sadm 1, BATF, gu 1A2, gu 1A3, gu 1B 1 and cy1B3. In some embodiments, the Cas12 chRDNA guide/nucleoprotein complex of the disclosure is used to inactivate one or more immune checkpoint molecules. In some embodiments, as described above, the inactivation of one or more immune checkpoint molecules is combined with the inactivation of one or more TCR components.

Beta-2 microglobulin (B2M) is a component of MHC class I molecules present on nucleated cells. Beta-2 microglobulin is released into the blood by cells (including tumor cells) and is necessary for the assembly and expression of HLA I complexes. However, the expression of HLA on the surface of allogeneic T cells causes rapid rejection of T cells of the host immune system. Thus, disrupting expression of beta-2 microglobulin is also desirable to increase the efficiency of allogeneic T cell therapy. In addition, the lack of expression of MHC class I molecules on allogeneic T cells results in clearance of the host immune system. Thus, it is desirable to present only a subset of HLA molecules, preferably HLA-E, on the cell surface.

Additional genes can be similarly targeted with Cas12chRDNA guides disclosed herein to enhance the efficacy of adoptive immune cell therapies. Non-limiting examples of preferred genes and chromosomal locations (hg 38 genome assembly) are provided in table 4.

/>

In some embodiments, the gene encoding TRAC is targeted intracellularly using the Cas12chRDNA guide as disclosed herein. In some embodiments, the gene encoding PD1 is targeted intracellularly using the Cas12chRDNA guide as disclosed herein. In some embodiments, the gene encoding B2M is targeted intracellularly using the Cas12chRDNA guide as disclosed herein. In some embodiments, the Cas12chRDNA guide as disclosed herein is used to target the gene encoding TRAC and the gene encoding B2M in a cell.

Cells modified using Cas12chRDNA guide/nucleoprotein complexes of the disclosure can be used, for example, in adoptive cell therapy to treat cancer. In some embodiments thereof, the modified cell is a genetically modified lymphocyte. Such genetically modified lymphocytes, such as CAR-T cells, can be used to treat various types of cancer in a subject, including but not limited to prostate cancer; ovarian cancer; cervical cancer; colorectal cancer; intestinal cancer; testicular cancer; skin cancer; lung cancer; thyroid cancer; bone cancer; breast cancer; bladder cancer; uterine cancer; vaginal cancer; pancreatic cancer; liver cancer; renal cancer; brain cancer; spinal cord cancer; oral cancer; parotid tumor; blood cancer; lymphomas, such as B-cell lymphomas; and leukemia, etc. Preferably, an effective amount of the modified cells is used for such treatment.

Table 5 lists representative B-cell leukemias and lymphomas treatable using adoptive cells (e.g., CAR-T cells) produced by Cas12chRDNA guide/nucleoprotein complexes of the present disclosure. It is to be understood that lymphocytes modified by the Cas12chRDNA guide/nucleoprotein complexes disclosed herein are not limited to treatment of the diseases listed in table 5.

/>

In other embodiments, adoptive cells (e.g., CAR-T cells) produced using Cas12chRDNA guide/nucleoprotein complexes of the disclosure can be used to treat other cell proliferative disorders, including pre-cancerous conditions; hematologic disorders and immune disorders, such as autoimmune disorders, including, but not limited to Ai Disen disease, celiac disease, type 1 diabetes, graves 'disease, hashimoto's disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, scleroderma, and systemic lupus erythematosus.

The adoptive cell therapy treatments described herein may be combined at the same or different times with one or more additional therapies selected from antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, laser therapy, and radiation therapy.

Administration of the modified cells of the present disclosure to a subject can be performed in any convenient manner, including by aerosol inhalation, injection, ingestion, infusion, implantation, or transplantation. The compositions described herein may be administered to a patient by subcutaneous, intradermal, intratumoral, intranodal, intramedullary, intramuscular, intravenous or intralymphatic injection or intraperitoneal administration.

In one embodiment, the modified cell compositions of the present disclosure are preferably administered by intravenous injection. Administration may include administration 10 ⁴ -10 ⁹ Individual cells/kg body weight, preferably 10 ⁵ -10 ⁶ Individual cells/kg body weight. The cells may be administered in one or more doses. In some embodiments, an effective amount of the modified cells is administered as a single dose. In other embodiments, an effective amount of cells is administered in more than one dose over a period of time. It is within the skill of those in the art to determine the optimal range of effective amounts of a given cell type for a particular disease or condition.

Chimeric Antigen Receptor (CAR) cells

In some embodiments, the adoptive cell is a CAR-expressing cell. CARs are receptors engineered to recognize and bind a particular antigen or epitope. The receptor is chimeric in that it combines antigen binding and T cell activation functions into a single receptor. CARs are typically fusion proteins comprising an extracellular ligand binding domain capable of binding an antigen, a transmembrane domain, and at least one intracellular signaling domain. The extracellular ligand binding domain may comprise a single chain variable fragment (scFv) comprising a fusion of two or more variable regions connected by one or more linkers. The CAR may also comprise a hinge region. CARs are sometimes referred to as "chimeric receptors", "T-bodies" or "Chimeric Immune Receptors (CIRs)".

In some embodiments, the CAR may be a TRUCK, universal CAR, self-driven CAR, tanCAR, armor CAR (Armored CAR), self-destructed CAR, conditional CAR, labeled CAR, tenCAR, dual CAR, or sCAR.

TRUCK (T cells redirected for general cytokine killing) co-expresses Chimeric Antigen Receptor (CAR) and anti-tumor cytokine. Cytokine expression may be constitutive or induced by T cell activation. Targeting CAR specificity, local production of pro-inflammatory cytokines recruits endogenous immune cells to the tumor site and can enhance the anti-tumor response.

Universal allogeneic CAR-T cells are engineered to no longer express endogenous T Cell Receptor (TCR) and/or Major Histocompatibility Complex (MHC) molecules, thereby preventing Graft Versus Host Disease (GVHD) or rejection, respectively.

The self-driven CAR co-expresses a CAR that binds to a tumor ligand and a chemokine receptor, thereby enhancing tumor homing.

CAR-T cells engineered to resist immunosuppression (armored CARs) may be genetically modified to no longer express various immune checkpoint molecules with immune checkpoint switch receptors (e.g., cytotoxic T lymphocyte-associated antigen 4 (CTLA 4) or programmed cell death protein 1 (PD 1)), or may be administered with monoclonal antibodies that block immune checkpoint signaling.

Self-destructing CARs can be designed using RNA delivered by electroporation to encode the CAR. Alternatively, induced apoptosis of T cells can be achieved based on the binding of ganciclovir to thymidine kinase in genetically modified lymphocytes or the recently described system of activation of human caspase 9 by small molecule dimers.

The conditional CAR-T cells are by default unresponsive or closed until a small molecule is added to complete the circuit, enabling complete transduction of signal 1 and signal 2, thereby activating the CAR-T cells. Alternatively, T cells can be engineered to express aptamer-specific receptors with affinity for a subsequently administered secondary antibody to a target antigen.

The labeled CAR-T cells express the CAR and tumor epitope to which the existing monoclonal antibody reagents bind. In the case of intolerable side effects, administration of monoclonal antibodies clears CAR-T cells and alleviates symptoms without additional extra-tumor effects.

Tandem CAR (TanCAR) T cells express a single CAR comprising two linked scFv that have different affinities and are fused to one or more intracellular co-stimulatory domains and a CD3 zeta signaling domain. TanCAR-T cell activation requires only one antigen to be present on the target cell; however, the presence of both antigens promotes synergistic activation. In certain embodiments, the scFv of the TanCAR comprises a heavy chain variable region (VH) and a light chain variable region (VL), a pair of two heavy chain variable regions (VH), or a pair of two light chain variable regions (VL). In another embodiment, the two scFv of the TanCAR can occur in a stacked configuration. In yet another embodiment, the two scFv of the TanCAR may occur consecutively or in a circular configuration. In particular embodiments, at least one scFv of the tandem CAR is an anti-CD 20 scFv, and the second scFv is selected to target a specific antigen on a cancer cell, such as an anti-BCMA scFv, an anti-CD 19 scFv, an anti-CD 30 scFv, an anti-CD 22 scFv, an anti-CD 70scFv, an anti-ROR 1 scFv, or an anti-k light chain scFv.

Dual CAR-T cells express two separate CARs with different ligand binding targets; one CAR comprises only the cd3ζ domain, while another CAR comprises only the co-stimulatory domain. Dual CAR-T cell activation requires co-expression of two targets on the tumor.

A safety CAR (sCAR) consists of extracellular scFv fused to an intracellular inhibitory domain, sCAR-T cells co-expressing a standard CAR are activated only when encountering target cells with a standard CAR target but lacking the sCAR target.

The extracellular (antigen recognition) domain of the CAR is preferably a single chain antibody, more preferably an scFv. In one embodiment, the antigen binding domain comprises an scFv. However, any suitable moiety that binds a given target with high affinity may be used as the antigen recognition region. The extracellular domain of a CAR capable of binding an antigen can be, for example, any oligopeptide or polypeptide capable of binding an antigen.

Depending on the desired antigen to be targeted, the CARs of the present disclosure can be engineered to include an appropriate antigen binding portion that is specific for the desired antigen target. For example, if BCMA is the desired antigen to be targeted, an antibody or antibody fragment (e.g., scFv) that targets BCMA can be used as the antigen binding portion in a CAR incorporating the present disclosure.

Preferred cellular targets and CAR scFv/binding proteins targeting them are listed in table 6.

/>

/>

In certain embodiments, the CAR-bound cellular target is more preferably selected from BCMA, CD19, CD20, CD22, CD47, CD79b, CD371, ROR-1, ephA2, MUC16, glypican 3, PSCA, and sealing protein 18.2.

In an even more preferred embodiment, the cellular target to which the CAR binds is BCMA.

In an even more preferred embodiment, the cellular target to which the CAR binds is CD371.

The intracellular domain of the CAR may be an oligopeptide or polypeptide known to function as a domain that transmits a signal to cause activation or inhibition of a biological process in a cell. The intracellular domain may comprise an activation domain comprising all or a portion of the intracellular signaling domain of a T Cell Receptor (TCR) and/or co-receptor, provided that it transduces effector function signals. The cytoplasmic signaling sequences that regulate primary activation of the TCR complex acting in a stimulatory manner may contain signaling motifs known as immune receptor tyrosine-based activation motifs (ITAMs). Examples of ITAMs containing cytoplasmic signaling sequences include those derived from: CD8, CD3 ζ, CD3 δ, CD3 γ, CD3 ε, CD32 (fcyriia), DAP10, DAP12, CD79a, CD79b, fcyriγ, fcyriiiγ, fceriβ (FCERIB), and Fceriγ (FCERIG).

In a preferred embodiment, the activation domain of the intracellular signaling domain is derived from cd3ζ.

The intracellular signaling domain of the CARs of the disclosure may be designed to comprise an activation domain, such as a CD3 zeta signaling domain, by itself or in combination with any other desired cytoplasmic domain useful in the context of the CARs of the disclosure. For example, the intracellular signaling domain of the CAR may comprise an activation domain, such as a cd3ζ chain portion, in addition to the costimulatory domain. A co-stimulatory domain refers to a portion of a CAR that comprises the intracellular domain of a co-stimulatory molecule.

Costimulatory molecules are molecules other than antigen receptors or their ligands, which are necessary for the effective response of lymphocytes to antigens. Examples of such costimulatory molecules include CD27, CD28, 4-1BB (CD 137), OX40, CD30, CD40, ICOS-1, GITR, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3, wherein all or a portion of the costimulatory molecules are useful in the costimulatory domains of the CARs of the present disclosure.

In a preferred embodiment, the CAR contains a co-stimulatory domain derived from at least 4-1 BB.

The transmembrane domain may be derived from natural or synthetic sources. When the source is natural, the domain may be derived from any membrane-bound protein or transmembrane protein. For example, the transmembrane region may be derived from (i.e., comprise at least a portion of) the following transmembrane regions: the α, β or ζ chain of a T cell receptor, CD28, CD3 ζ, CD3 ε, CD45, CD4, CD5, CD8 (e.g., CD8 α, CD8 β), CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD 11a, CD 18), ICOS (CD 278), 4-1BB (CD 137), GITR, CD40, BAFFR, HVEM (LIGHT), SLAMF7, NKp80 (KLRF 1), CD160, CD19, IL2Rβ, IL2Rγ, IL7Rα, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11D, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11B, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD 226), SLAMF4 (CD 244, 2B 4), CD84, CD96 (Tactile), CEACAM1, CRTAM, ly9 (CD 229), CD160 (BY 55), PSGL1, CD100 (SEMA 4D), SLAMF6 (NTB-A, ly 108), SLAM (SLAMF 1, CD150, IPO-3), BLASAMF 8, SELPLG (CD 162), LTBR and PAG/Cbp.

Alternatively, the transmembrane domain may be synthetic, in which case it will predominantly comprise hydrophobic residues such as leucine and valine. In some cases, triplets of phenylalanine, tryptophan and valine will be found at each end of the synthetic transmembrane domain. Short oligopeptide or polypeptide linkers, such as 2 to 10 amino acids in length, can form a link between the transmembrane domain and the cytoplasmic domain of the CAR.

In a preferred embodiment, the transmembrane domain is derived from CD8.

In some embodiments, the CAR has more than one transmembrane domain, which may be a repeat of the same transmembrane domain, or may be a different transmembrane domain.

The hinge region may comprise a variable length polypeptide hinge, such as one or more amino acids, a CD8 portion, or an IgG4 region, and combinations thereof.

In a preferred embodiment, the hinge region is derived from CD8.

The CAR may also be incorporated into TIL, NK cells, macrophages, dendritic cells, induced pluripotent stem cells (ipscs) or TCRs to produce CAR-TIL, CAR-NK cells, CAR-M, CAR-DCs and TCR-engineered CAR-T cells, respectively. For a description of CAR-T cells, methods of making CAR-T cells, and uses thereof, see, e.g., brudno et al (Nature rev. Clin. Oncol.,2018, 15:31-46); maude et al (N.Engl. J.Med.,2014, 371:1507-1517); and Sadelain et al (Cancer disc.,2013, 3:388-398).

In some embodiments, the CAR expression cassette is transduced into an adoptive cell and the cassette is integrated into the Cas12 protein-mediated cleavage site. Example 9 herein illustrates transduction of primary cells with an adeno-associated virus (AAV) vector comprising a CAR cassette.

In some embodiments, the CAR expression cassette comprises a promoter that drives CAR expression. Commonly used promoters include the constitutive mammalian promoters CMV, MND, EF a, SV40, PGK1 (mouse or human), ubc, CAG, caMKIIa and β -Act, and others are known in the art. See, e.g., khan et al (Advanced Pharmaceutical Bulletin,2013, 3:257-263). Alternatively, the CAR expression cassette may comprise a ribosome jump sequence (also known as a self-cleaving peptide) and may be introduced in-frame with an endogenously expressed gene. Commonly used ribosome-hopping sequences include T2A, P2A, E a and F2A. For a description of ribosome-hopping sequences and their use, see, for example, chug et al (MAbs, 2015,7 (2): 403-412). Similarly, non-CAR expression cassettes may comprise a similar promoter or ribosome jump sequence.

In certain embodiments, the Cas12 chRDNA guide/nucleoprotein complex is used to treat a genetic disorder caused by a pathogenic autosomal "dominant negative (dominant negative)" mutation present on a single allele of a patient. In some cases, the potential genetic mutation may be a Single Nucleotide Polymorphism (SNP) on one of the alleles. The chRDNA primer/nucleoprotein complex can be engineered to target SNP alleles, but not wild-type alleles, thereby disrupting only SNP alleles. See, e.g., example 7, which provides a non-limiting example of a method of designing Cas12a chRDNA guide/nucleoprotein complexes to target wild-type sequences, the Cas12a chRDNA guide/nucleoprotein complexes are capable of reducing editing at off-target sequences comprising SNPs.

In some embodiments, the Cas12chRDNA guide/nucleoprotein complex can be used to selectively edit (e.g., knock out or revert back to wild-type using homology directed repair) an allele containing a SNP, while not modifying the wild-type allele. In some embodiments, such editing may result in gene disruption. In other embodiments, such editing may restore the allele back to the "wild-type" state, such as by homology-directed repair. For example, many genetic diseases that lead to progressive vision loss are due to pathogenic autosomal "dominant negative" mutations. Examples of SNP correction strategies for dominant negative diseases include, but are not limited to, SNP mutations in the rhodopsin gene that target induced retinitis pigmentosa, see, e.g., li et al (CRISPR j.,2018,1 (1): 55-64); targeting induces SNP mutations in the transforming growth factor beta-induced (TGFBI) gene of corneal dystrophies, see, e.g., christie et al (Scientific Reports,2017,7 (1): 16174).

The Cas12chRDNA guide/nucleoprotein complexes of the disclosure can be delivered to ocular tissues affected, for example, by autosomal pathogenic "dominant negative" gene mutations. In some embodiments thereof, the chRDNA guide/nucleoprotein complex is designed to selectively disrupt disease alleles without targeting wild-type alleles, thereby treating the underlying pathology. Such diseases may include, but are not limited to, macular dystrophy, rod-cone dystrophy, cone-rod dystrophy, or chorioretinopathy. It is to be understood that the Cas12chRDNA guide/nucleoprotein complexes disclosed herein are not limited to treatment of genetic diseases that cause progressive vision loss.

Experimental properties

Non-limiting embodiments of the present disclosure are illustrated in the following examples. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, concentrations, percentages of change, etc.), but some experimental errors and deviations should be accounted for. Unless otherwise indicated, temperatures are in degrees celsius and pressures are at or near atmospheric pressure. It should be understood that these examples are given by way of illustration only and are not intended to limit the scope of the various embodiments of the disclosure as contemplated by the inventors. Not all of the following steps shown in each embodiment are required nor are the order of the steps in each embodiment as presented. As used herein, "r" preceding a nucleotide represents RNA; and all other nucleotides are DNA (see, e.g., tables 15 and 17), unless otherwise indicated. Phosphorothioate linkages are indicated by "×" between adjacent bases.

Example 1

Preparation of cytotoxic T cells (CD4+ and CD8+) from PBMC and culture of primary cells

This example illustrates the preparation of cd4+ and cd8+ T cells from donor Peripheral Blood Mononuclear Cells (PBMCs).

Preparation of CD4+ and CD8+ T cells from donor PBMC essentially as follows. Using RoboSep-S (STEMCELL Technologies, cambridge, mass.) and EasySep ^TM Human T cell isolation kit (STEMCELL Technologies, cambridge, mass.) T cells were isolated from Peripheral Blood Mononuclear Cells (PBMC) and were isolated in anti-CD 3/CD28 beads (Dynabeads) in ImmunoCurie-XF complete media (ImmunoCurie-XF T cell expansion Medium (STEMCELL Technologies, cambridge, mass.), CTS Immune Cell SR (Gibco A2596102), antibiotic-antimycotic (Antibiotics-Antimycotics) (100X, corning 30-004-Cl)) supplemented with recombinant human (rh) IL-2 (100 units/mL) ^TM The method comprises the steps of carrying out a first treatment on the surface of the Gibco 11132D) was activated for 3 days. After 3 days, the beads were removed via magnetic separation and the cells were expanded in ImmunoCurt-XF complete medium supplemented with IL-2 (100 units/mL) for 1 day.

Example 2

Cloning, expression, production and assembly of Cas12a guide/nucleoprotein complexes

This example describes methods for cloning, expressing, and purifying Cas12a guide/nucleoprotein complexes, as well as methods of producing Cas12a guide components.

Cloning of the Cas12 protein

The catalytically active Cas12a protein sequence (SEQ ID NO: 1) of the amino acid coccus (strain BV3L 6) was codon optimized for expression in E.coli cells. At the C-terminus, a glycine-serine linker and a Nuclear Localization Sequence (NLS) (SEQ ID NO: 4) were added. Oligonucleotide sequences encoding Cas12a-NLS proteins (referred to as AsCas12a and Cas12a proteins in the examples below) are provided to commercial manufacturers for synthesis. The DNA sequence is then cloned into a suitable bacterial expression vector using standard cloning methods.

Expression and purification of the Cas12a protein

The AsCas12a protein was expressed in E.coli using an expression vector and purified using affinity chromatography, ion exchange and size exclusion chromatography, substantially as described, for example, in Swarts et al (Molecular Cell,2017, 66:221-233).

C.Cas12a directs the production of components

Cas12a guides are generated by linking the targeting region to a specific Cas12a guide activation region. The targeting or spacer region preferably comprises a target binding sequence of 20 nucleotides. The target binding sequence is complementary to a target sequence that occurs downstream (in the 3' direction) of 5' -TTTV or 5' -TTTN PAM. For amino acid cocci, trichomonad bacteria, and novel francisco-killing Cas12a species, exemplary Cas12a guide activation region sequences are SEQ ID No. 6, SEQ ID No. 8, and SEQ ID No. 10, respectively.

CAS12a leader sequences (e.g., crRNAs and chRDNA) are provided to commercial manufacturers for synthesis.

By incorporating a T7 promoter at the 5' end of the dsDNA template sequence, a guide RNA component (e.g., crRNA) can be produced from a double stranded (ds) DNA template by in vitro transcription (e.g., T7 rapid high yield RNA synthesis kit (T7 Quick High Yield RNA Synthesis Kit); new England Biolabs, ipswick, mass.).

Assembly of Cas12a leader/nucleoprotein complexes

The amino acid coccus Cas12a (AsCas 12 a) labeled with the C-terminal Nuclear Localization Sequence (NLS) was expressed recombinantly in escherichia coli and purified using chromatographic methods. Unless otherwise indicated, the protein cas12a was present in 80 pmol: the concentration of 240pmol of the guide forms a nucleoprotein complex. Each of the guide components (e.g., crRNA or chRDNA) was adjusted to a final volume of 1 μl at the desired total concentration (240 pmol) prior to assembly with Cas12a protein, incubated for 2 minutes at 95 ℃, removed from the thermocycler, and allowed to equilibrate to room temperature. Cas12a protein was diluted to the appropriate concentration in binding buffer (60 mM TRIS-acetate, 150mM potassium acetate, 30mM magnesium acetate, ph 7.9), final volume was 1.5 μl, and mixed with 1 μl of the guide component, then incubated for 10 min at 37 ℃.

Example 3

Nuclear transfection of T cells (CD4+ and CD8+) from PBMC with Cas12a guide/nucleoprotein complex

This example describes the nuclear transfection of activated T cells with Cas12a guide/nucleoprotein complexes.

Using a Nucleofector ^TM The Cas12a guide/nucleoprotein complex of example 2 was performed by a 96-well shuttle system (Lonza, allendale, NJ)The material was transfected into primary activated T cells (cd4+ and cd8+) (prepared as described in example 1). Cas12a guide/nucleoprotein complexes with a final volume of 2.5 μl were dispensed into individual wells of a 96-well plate. The suspended T cells were pelleted by centrifugation at 200×g for 10 min, washed with Phosphate Buffered Saline (PBS) without calcium and magnesium, and the cell pellet was resuspended in 10ml PBS without calcium and magnesium. Using II automated cell counter (Life Technologies; grand Island, N.Y.) counts cells.

2.2e7 cells were transferred to a 15ml conical tube and pelleted. Aspirate PBS and resuspend cells in Nucleofector ^TM P4 or P3 (Lonza, allendale, NJ) to a density of 2e5-1e6 cells/ml/sample. Mu.l of the cell suspension was then added to each well containing 2.5. Mu.l of Cas12a guide/nucleoprotein complex and the entire volume from each well was transferred to 96-well Nucleocuvette ^TM Plate (Lonza, allendale, NJ). Loading the plate to a Nucleofector ^TM On a 96-well screen (Lonza, allendale, N.J.), and using a CA137 Nucleofector ^TM Cells were subjected to nuclear transfection by the procedure (Lonza, allendale, NJ). Following nuclear transfection, 77.5 μl of ImmunoCurt-XF complete medium supplemented with IL-2 (100 units/mL) was added to each well, and the entire volume of transfected cell suspension was transferred to 96-well cell culture plates containing 100 μl of pre-warmed ImmunoCurt-XF complete medium supplemented with IL-2 (100 units/mL). Plates were transferred to tissue culture incubators and at 37 ℃ at 5% CO prior to downstream analysis ₂ Is maintained for 48 hours.

Example 4

Splicing human genes with Cas12a guide/nucleoprotein complexes

This example describes the design and use of Cas12a guide/nucleoprotein complexes to target genes encoding human T cell alpha constant region (TRAC), beta-2-microglobulin (B2M), programmed cell death 1 (PDCD 1), cytokine-induced SH 2-containing protein (CISH) and Cbl proto-oncogene B (Cbl-B) in human T cells.

A. Design of AsCas12a crRNA guide

All 20 nucleotide sequences downstream (in the 3 'direction) of the 5' -TTTV PAM motif in the coding region of the genes encoding human TRAC, B2M, PDCD1, CISH and CBL-B were selected for targeting (SEQ ID No: 12-189). Target selection criteria include, but are not limited to, homology to other regions in the genome; G-C content; melting temperature; and the presence of homopolymers in the spacers.

The 20 nucleotide sequence identified was appended downstream (in the 3' direction) of the AsCas12a activation region sequence (SEQ ID NO: 6).

The sequences were provided to commercial manufacturers for synthesis. Then, separate Cas12a guide/nucleoprotein complexes were prepared as described in example 2 and transfected into primary T cells as described in example 3.

B. Determination of genome editing efficiency

(1) Target dsDNA sequence generation for deep sequencing

48 hours post-transfection, cas12a guide/nucleoprotein complex and 50 μl QuickExtract per well were used ^TM The DNA extraction solution (Epicentre, madison, WI) isolated gDNA from nuclear transfected primary T cells, then incubated for 10 min at 37 ℃, 30 min at 65 ℃ and 3 min at 95 ℃ to terminate the reaction. The isolated gDNA was diluted with 50. Mu.L of sterile water and the samples were stored at-80 ℃.

Using isolated gDNA, a first PCR was performed at 1X concentration using Q5 hot start high fidelity 2X premix (New England Biolabs, ipswitch, MA), primers designed to amplify regions surrounding Cas12a target were each used at 0.5 μΜ, and 3.75 μΜ gDNA was used in a final volume of 10 μΜ. By holding at 98 ℃ for 1 minute; holding at 98 ℃ for 10 seconds, at 60 ℃ for 20 seconds, at 72 ℃ for 30 seconds for 35 cycles; and an initial cycle of final extension for 2 minutes at 72℃for amplification. The PCR reaction was diluted 1:100 in water.

A unique set of index primers (index primers) for barcode PCR was used to facilitate multiple sequencing of each sample. Bar code PCR was performed using a reaction mixture containing a 1X concentration of Q5 hot start high fidelity 2X premix (New England Biolabs, ipswitch, MA), 0.5 μm primers each, and 1 μl of a 1:100 dilution of the first PCR (final volume 10 μl). The reaction mixture was amplified as follows: maintaining at 98 ℃ for 1 minute; followed by 12 cycles of 10 seconds at 98 ℃, 20 seconds at 60 ℃ and 30 seconds at 72 ℃; the final extension reaction was maintained at 72℃for 2 minutes.

(2) SPRIselect clean up

PCR reactions were pooled and transferred to a single microcentrifuge tube, and sprselected (Beckman Coulter, pasadena, CA) for amplicons was sequenced based on bead-based clean-up.

Spriselect beads at 0.9x volume were added to the amplicon, mixed, and incubated for 10 minutes at room temperature. The microcentrifuge tube was placed on a magnetic tube rack until the solution was clear. The supernatant was removed and discarded, the remaining beads were washed with 1 volume of 85% ethanol and the beads were incubated for 30 seconds at room temperature. After incubation, the ethanol was aspirated and the beads were air dried at room temperature for 10 minutes. The microcentrifuge tube was removed from the magnetic rack and 0.25 volumes of Qiagen EB buffer (Qiagen, venlo, netherlands) was added to the beads, mixed vigorously and incubated for 2 minutes at room temperature. The microcentrifuge tube was returned to the magnet, incubated until the solution was clear, and the supernatant containing purified amplicon was dispensed into a clean microcentrifuge tube. Using Nanodrop ^TM 2000 systems (Thermo Scientific, wilmington, DE) quantitate purified amplicons and use Fragment Analyzer ^TM System (Advanced Analytical Technologies, ames, IA) and DNF-910dsDNA kit (Advanced Analytical Technologies, ames, IA) analyze library quality.

(3) Deep sequencing setup

Pooled amplicons were normalized to 4nM concentration, e.g.according to Nanodrop ^TM 2000 calculated as the system value and average amplicon size. 300 cycles were performed on a Miseq sequencer (Illumina, san Diego, calif.) with MiSeq Reagent Kit v (Illumina, san Diego, calif.) with two 151 cycle paired end runs and two 8-cycle index reads to analyze the library.

(4) Deep sequencing data analysis

The identity of the product in the sequencing data is determined based on the index barcode sequence in the barcode PCR that is adapted to the amplicon. Processing MiSeq data using a computational script to perform tasks such as:

a. reads were aligned with the human genome (construct GRCh 38/38) using Bowtie (Bowtie-bio.sourceforge.net/index.shtml) software;

b. comparing the aligned reads to expected wild-type genomic locus sequences and discarding reads that are not aligned with any portion of the wild-type locus;

c. counting reads that match the wild-type sequence;

d. reads with indels are classified and counted by indel (insertion or deletion of bases) type; and

e. the total indel reading was divided by the sum of the wild-type reading and the indel reading to give the percentage of mutant readings.

The resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex is determined by identifying the indel sequence of the region targeted by the Cas12a guide/nucleoprotein complex. The results of the intracellular editing experiments are shown in table 7.

/>

/>

/>

/>

/>

StDev = standard deviation; n=3

The data presented in table 7 demonstrate that Cas12a crRNA/nucleoprotein complexes are capable of editing multiple genes in human primary T cells. Other genes, such as those described elsewhere herein, can be targeted in a similar manner using AsCas12a or other Cas12a proteins (e.g., a chaetomium species bacterium or new francisco).

Example 5

Engineered Cas12a chRDNA guide molecules with DNA in target binding sequences

The following examples describe engineering the AsCas12a chRDNA guide molecule to include DNA bases in the target binding sequence.

A. Cas12a chRDNA guide design via computer simulation (in silico)

A 20 nucleotide target binding sequence of the AsCas12a guide was selected for engineering and a separate DNA base was utilized at each position in the target binding sequence. The positions of the DNA bases in the target binding sequence of the AsCas12a chRDNA guide molecule are shown in table 8 (DNA bases indicated by "d" and RNA bases indicated by "R"; control crrnas are also shown).

Three target sequences (B2M-tgt 12, B2M-tgt1, B2M-intron-tgt 12) in the gene encoding human B2M, the target sequence (TRAC-tgt 12) in the gene encoding human TRAC and the target sequence (DNMT 1-tgt 1) in the gene encoding human DNA methyltransferase 1 (DNMT 1) were selected for editing. Cas12a chRDNA guides, as well as Cas12a crRNA control sequences, comprising each target containing a single DNA base at each position (see table 8) were provided to commercial manufacturers for synthesis.

B. Cell transfection and analysis

Individual Cas12a guide/nucleoprotein complexes for screening are prepared essentially as described in example 2. The nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4. The results of the intracellular editing experiments are shown in table 9.

/>

/>

/>

/>

StDev = standard deviation; n=3

The editing results in Table 9 indicate that the Cas12a chRDNA guide molecule comprising DNA in the spacer region is capable of editing in multiple targets at a rate comparable to crRNA (compare SEQ ID NO:211 and SEQ ID NO:224;SEQ ID NO:232 with SEQ ID NO:234 or SEQ ID NO:274 with SEQ ID NO: 293). The edit rate of the chRDNA guide design in table 9 was normalized to the edit rate of crRNA per target. The average normalized edit rate is presented in fig. 13, where the positions within the target binding sequence are plotted as a function of the average normalized edit. Preferred positions for DNA base utilization (i.e., greater than 70% of average normalized editors) are represented by grey fills and include positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20. The data presented in this example, table 9 and the data in fig. 13, can be used to determine which positions in the target-binding sequence of the Cas12a guide can be engineered into DNA.

Example 6

Cas12a chrDNA guide molecules with multiple DNA bases in the target binding sequence

This example describes the design and testing of Cas12a chRDNA guide molecules with multiple DNA bases in the target binding sequence.

A. Cas12a chRDNA guide design via computer simulation

Three targets (B2M-tgt 12, B2M-tgt1, B2M-intron-tgt 12) in the gene encoding human TRAC, the target (TRAC-tgt 12) in the gene encoding human DNA methyltransferase 1 and the 20 nucleotide sequence of the target (DNMT 1-tgt 1) in the gene encoding human DNA methyltransferase 1 were selected for editing. For each target, 1 to 7 nucleotides of DNA were designed into the target-binding sequence of each AsCas12a guide. Design criteria for DNA base position include, but are not limited to, previous unit position screening data (see example 5), previous consensus on DNA-tolerant positions (see fig. 13), distance between DNA bases in the target binding sequence, and known positions of mismatches in the off-target sequence. Cas12a chRDNA guide design and crRNA control sequences were provided to commercial manufacturers for synthesis.

B. Cell transfection and analysis

Individual Cas12a guide/nucleoprotein complexes for screening are prepared essentially as described in example 2. The Cas12a guide/nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4. The results of the intracellular editing experiments and the positions of the DNA bases in the target binding sequence of each Cas12a chRDNA guide are shown in table 10.

/>

StDev = standard deviation; n=3

The editing results in table 10 indicate that Cas12a chRDNA guide molecules comprising multiple DNA bases in the target binding sequence are capable of editing in multiple targets at a rate comparable to crRNA (compare SEQ ID NO:316 to SEQ ID NO:321;SEQ ID NO:330 to SEQ ID NO:335 or SEQ ID NO:345 to SEQ ID NO: 347).

Example 7

Reduction of off-target editing with Cas12a chRDNA guide

The present embodiment describes the use ofAssays (Cameron, P.et al, (2017) Mapping the genomic landscape of CRISPR-Cas9 clean. Nature Methods,14 (6), 600-606.Https:// doi.org/10.1038/nmeth.4284) identified Cas12a off-target and reduced off-target editing efficiency of Cas12a chRDNA guides compared to Cas12a crRNA guides.

A.Measurement

Human primary T cells were grown as described in example 1. After expansion of the cells in 50ml conical tubes, high molecular weight genomic DNA (gDNA) was extracted from human primary T cells using Blood and Cell Culture DNA Maxi Kit (Qiagen, hilden, germany) according to the manufacturer's protocol.

A target of 20 nucleotides in the gene encoding human ribosomal protein L32 (RPL 32-tgt 1) and the gene encoding DNMT1 (DNMT 1-tgt 1) was selected for useThe measurement (Cameron, P. Et al, (2017) Nature Methods,14 (6), 600-606) was evaluated. Each Cas is put into 12a guide the serial dilution of the fractions to the corresponding nucleoprotein concentration, incubation at 95 ℃ for 2 min, then allowing it to slowly reach room temperature within 5 min. Cas12a nucleoprotein complexes for RPL32 (SEQ ID NO: 375) and DNMT1 (SEQ ID NO: 404) targets were formed by combining the incubated Cas12a guide with Cas12a protein at a ratio of 3:1 in cleavage reaction buffer (60 mM TRIS-acetate, 150mM potassium acetate, 30mM magnesium acetate, pH 7.9) and incubating for 10 min at 37 ℃. The single cleavage of 10 μg of genomic DNA (gDNA) occurred at 6 Cas12a guide/nucleoprotein complex concentrations (8 nM, 16nM, 32nM, 48nM, 64nM, 96nM and 128 nM) in a total volume of 50 μl. Negative control reactions (0 nM) were assembled in parallel and the control reactions did not include any nucleoprotein complex. All cleavage reactions (including negative controls) were assembled in triplicate in 96-well format plates. The cleavage reaction was incubated at 37℃for 4 hours.

Library preparation and sequencing was performed essentially as described by Cameron et al (Nature meth.,2017, 14:600-606), except for the dA tailing (dA-tailing) step after cleavage of the nucleoprotein complex. Since Cas12a nucleoprotein complex cleavage results in staggered (5' overhang) ends, an additional enzymatic end repair step is required. The volume added remained the same, but the original dA tailing kit components were replaced with those from New England BioLabs (NEB#E7442L) Ultra ^TM End Prep enzyme mix (3 μl) and 10x End repair reaction buffer (5 μl) components of End repair/dA tailing module. The samples were incubated at 20℃for 30 minutes, then at 65℃for 30 minutes, and the standard procedure was restarted. NGS sequencing was performed using Illumina NextSeq platform (Illumina, san Diego, CA) and 3 million reads were obtained per sample. By->Any sites recovered (without off-target motifs within 1 nucleotide of the cleavage site) were considered false positives and discarded for assay (camelon, p. Et al, (2017) Nature Methods,14 (6), 600-606). From->The number of recovered target sites for the off-target assay is shown in table 11.

The data presented in Table 11 showsThe assay (camelon, p. Et al, (2017) Mapping the genomic landscape of CRISPR-Cas9 clean nature Methods,14 (6), 600-606) recovered biochemical off-target of Cas12 guide for further intracellular evaluation.

B.Intracellular validation of off-target assay recovery sites

For measuring that shown in table 11The index frequency of off-target sites was analyzed for targeted depth sequencing for a subset of sites recovered in RPL32 and DNMT1 samples for the lowest (e.g., 8nM and 16 nM) Cas12a nucleoprotein complex concentrations. Two off-target sites (SEQ ID NO:371 and SEQ ID NO: 372) from RPL32 samples and a single off-target in DNMT1 (SEQ ID NO: 374) were selected for evaluation of intracellular off-target editing rate of crRNA. Forward and reverse amplicon primers were designed for each off-target site and ordered from commercial manufacturers.

Human primary T cells were cultured as described in example 1. RPL32 (SEQ ID NO: 375) and DNMT1 (SEQ ID NO: 404) Cas12a nucleoprotein complexes were prepared essentially as described in example 2. The nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4. An untransfected cell pool was used as wild-type reference. Mutant reads (% indel) were defined as 2 of the cleavage siteAny non-reference variant call within 0 base pairs (bp). Discard samples with low sequencing coverage (in combined Cas12a nucleoprotein complex-treated samples<1,000 readings or in a reference sample<200 readings) or in a reference sample>Sites of 2% variant calls. If accumulated in a combined Cas12a nucleoprotein complex-treated sample>0.1% of the mutation reads, the site is considered cell off-target. Recovered SITE-The results of targeted deep sequencing of the off-target sites are presented in Table 12, with mismatched nucleotides underlined (Cameron, P. Et al, (2017), nature Methods,14 (6), 600-606).

StDev = standard deviation; n=3

The data presented in table 12 shows that,the assay recovered off-target editing in T cells by Cas12a crRNA guide.

C. Design of chRDNA guide via computer simulation

A target of 20 nucleotides in the gene encoding human RPL32 (RPL 32-tgt 1) and the gene encoding DNMT1 (DNMT 1-tgt 1) was selected for editing. For each target, 1 to 4 nucleotides of DNA were designed into the target binding sequence of each AsCas12a chRDNA guide. Design criteria for DNA base position include, but are not limited to, previous unit position screening data (see example 5), previous consensus on DNA-tolerant positions (see fig. 13), distance between DNA bases in the target binding sequence, and known positions of mismatches in the off-target sequence. Cas12a chRDNA guides and Cas12a crRNA control sequences were provided to commercial manufacturers for synthesis.

D. Cell transfection and analysis

Separate Cas12a guide/nucleoprotein complexes are prepared essentially as described in example 2. The nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4. Results of mid-target and off-target (see table 12) cell editing experiments and DNA base positions in the target binding sequence of each Cas12a chRDNA guide are shown for RPL32 (table 13) and DNMT1 (table 14) targets. In addition, cas12a chRDNA guide molecules with abasic deoxyribose sites were also tested, and the positions of abasic sites are expressed in dN.

/>

StDev = standard deviation; n=3

/>

StDev = standard deviation; n=3

The editing results in tables 13 and 14 indicate that Cas12a chRDNA guide molecules are capable of reduced editing at off-target sites (compare the results of off-target editing of SEQ ID NO:375 and SEQ ID NO:391, 375 and 394 in table 13; compare the results of off-target editing of SEQ ID NO:404 and 408 or 404 and 412 in table 14), even at sites with single nucleotide mismatches (see, e.g., table 12, SEQ ID NO:371 and 372).

Example 8

Cas12a chRDNA guide molecules with DNA bases in the activation region

This example describes the design and testing of AsCas12a chRDNA guide molecules with DNA bases in the activation region.

A. Design of chRDNA guide via computer simulation

An activation region of 20 nucleotides of the AsCas12a guide was selected for engineering, with a separate DNA base utilized at each position in the activation region. The positions of the DNA bases in the activation region of the AsCas12a guide are shown in table 15.

/>

The target in the gene encoding human DNMT1 (SEQ ID NO: 361) was selected for editing. The DNMT target binding sequence was attached downstream (i.e., in the 3' direction) of the activation region sequence containing a single DNA base at each position (see table 15). The sequences were provided to commercial manufacturers for synthesis.

B. Cell transfection and analysis

Individual Cas12a guide/nucleoprotein complexes for screening are prepared essentially as described in example 2. The nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4. The results of the intracellular editing experiments are shown in table 16.

StDev = standard deviation; n=3

The editing results in Table 16 indicate that Cas12a chRDNA with DNA in the activation region is capable of editing in multiple targets at a rate comparable to crRNA (compare SEQ ID NO:438 and SEQ ID NO:445;SEQ ID NO:438 with SEQ ID NO:450 or SEQ ID NO:438 and SEQ ID NO: 457). The edit rate of the chRDNA design in table 16 was normalized to the edit rate of crRNA. The average normalized edit rate is presented in fig. 14, where the locations within the activation region are plotted as a function of the average normalized edit. Preferred positions for DNA base utilization (i.e., greater than 70% of average normalized edits) are represented by grey fills and include positions 1, 3, 5, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, and 19.

D. chRDNA having multiple DNA bases in the activation region

Based on the results presented in table 10, single DNA positions were combined into an activation region design containing multiple DNA bases. The design and location of the DNA base in the activation region of the AsCas12a guide is shown in table 17.

The activation region design presented in Table 17 was combined with a 20 nucleotide target sequence (SEQ ID NO: 321) in the gene encoding human TRAC designed with DNA nucleotides in the target binding sequence. TRAC target binding sequences were appended downstream (i.e., in the 3' direction) of the activation region sequences presented in Table 17, and chRDNA designs as well as crRNA control sequences were provided to commercial manufacturers for synthesis.

E. Cell transfection and analysis

Individual Cas12a guide/nucleoprotein complexes for screening are prepared essentially as described in example 2. The Cas12a guide/nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4. The results of the intracellular editing experiments and the positions of the DNA bases in the activation region and target binding sequence of each chRDNA are shown in table 18.

StDev = standard deviation; n=3

The editing results in Table 18 indicate that the Cas12a chRDNA guide molecule, with DNA in both the activation region and the target binding sequence, is capable of editing at a rate comparable to crRNA (compare SEQ ID NO:466 with SEQ ID NO:467;SEQ ID NO:466 with SEQ ID NO:468 or SEQ ID NO:466 with SEQ ID NO: 469).

Example 9

Cloning of AAV donor cassettes, AAV production, and AAV transduction of primary cells

This example describes the design of a DNA donor cassette and cloning of the DNA donor cassette into an AAV vector, production of AAV, delivery of Cas12a chRDNA guide/nucleoprotein complex into primary cells, and transduction of primary cells with AAV to site-specifically integrate the CAR expression cassette into primary cells.

AAV may be engineered to deliver DNA donor polynucleotides to mammalian cells. If AAV delivery is combined with a genome cleavage event and DNA donor polynucleotide in AAV is flanked by homology arms, the DNA donor polynucleotide can be seamlessly inserted into the genome cleavage site through HDR, as described, for example, by Eyquem et al (Nature, 2017, 543:113-117).

A. AAV donor cassette and rAAV production via computer simulation design

The design of CAR receptors has been described. See, e.g., kochenderfer et al (J.Immunothepy, 2009, 32:689-702). The CAR construct was designed to contain an N-terminal secretion signal (CD 8a signal peptide), an scFv portion specific for BCMA, then a CD8 hinge region and transmembrane, a 4-1BB effector region, a CD3 zeta effector region, and a C-terminal BGH polyadenylation signal sequence. A mammalian promoter sequence is inserted upstream of the CAR polynucleotide. In order to insert the DNA donor polynucleotide site-specifically into the host cell genome after site-specific cleavage, the target site is selected in the endogenous TRAC locus (SEQ ID NO: 23). Then, 500bp long homology arms 5 'and 3' of the cleavage site were identified. The 5 'and 3' homology arms are appended to the ends of the DNA donor polynucleotide, wherein the DNA donor polynucleotide is oppositely oriented (i.e., 3 'to 5') with respect to the homology arms. The resulting DNA donor polynucleotide is presented in SEQ ID NO. 413.

The design of B2M and HLA class I histocompatibility antigen alpha chain E (HLA-E) has been described. See, for example, gornagusse et al (Nature Biotechnology,2017,35 (8): 765-772). Fusion constructs were designed using the N-terminal B2M secretion signal followed by HLA-G derived peptide sequence, first linker sequence, B2M sequence, second linker sequence, HLA-E sequence and C-terminal BGH polyadenylation signal sequence. An EF1 alpha mammalian promoter sequence is inserted upstream of the B2M-HLA-E polynucleotide. To insert the DNA donor polynucleotide site-specifically into the host cell genome after site-specific cleavage, the target site in the endogenous B2M locus (SEQ ID NO: 62) is selected. Then, 500bp long homology arms 5 'and 3' of the cleavage site were identified. The 5 'and 3' homology arms are appended to the ends of the DNA donor polynucleotide, wherein the DNA donor polynucleotide is oppositely oriented (i.e., 3 'to 5') with respect to the homology arms. The resulting DNA donor polynucleotide is presented in SEQ ID NO. 414.

Oligonucleotide sequences encoding DNA donor polynucleotides are provided to commercial manufacturers for synthesis of suitable recombinant AAV (rAAV) plasmids. The rAAV plasmid comprising SEQ ID NO. 413 and the separate rAAV plasmid comprising SEQ ID NO. 414 are provided to commercial manufacturers for packaging into two separate AAV6 viruses.

B. Primary T cell transduction with rAAV

Primary activated T cells were obtained from PBMCs as described in example 1. Cas12a chRDNA guide/nucleoprotein complexes targeting the genes encoding TRAC (SEQ ID NO: 415) and B2M (SEQ ID NO: 416) were prepared as described in example 2. T cells were transfected with a TRAC-targeted Cas12a chRDNA guide/nucleoprotein complex (SEQ ID NO: 415) and 1X10 by AAV6 virus packaged with CAR donor sequence (SEQ ID NO: 413) 1 min to 4 hours after nuclear transfection ⁶ MOI of (E) infected cells. In addition, T cells were transfected with a Cas12a chRDNA guide/nucleoprotein complex targeting B2M (SEQ ID NO: 416) and 1x10 with AAV6 virus packaged with B2M-HLA-E donor sequence (SEQ ID NO: 414) 1 min to 4 hours post nuclear transfection ⁶ MOI of (E) infected cells. Complete culture of IL-2 (100 units/mL) -supplemented ImmunoCurt-XF after transductionT cells were cultured for 24 hours in medium (STEMCELL Technologies, cambridge, MA). The following day, transduced T cells were transferred to a 50mL conical tube and centrifuged at 300xg for about 7-10 minutes to pellet the cells. The supernatant was discarded, the pellet was gently resuspended, and T cells were pooled in an appropriate volume of ImmunoCurt-XF complete medium (STEMCELL Technologies, cambridge, mass.) supplemented with IL-2 (100 units/mL).

T cells were counted at 1X 10 ⁶ Individual cells/mL were resuspended in ImmunoCult-XF complete medium (STEMCELL Technologies, cambridge, MA) supplemented with IL-2 (100 units/mL) and inoculated as needed into multiple T-175 suspension flasks (maximum volume per flask 250 mL).

C. Expression of anti-BCMA, B2M-HLA-E CAR-T cells

In vitro characterization of anti-BCMA, B2M-HLA-E CAR-T cells, control (TRAC Knockout (KO) and B2M KO) and wild type T cells was performed 7 days after transduction.

Using recombinant BCMA protein conjugated to Phycoerythrin (PE), anti-BCMA CAR expression of CAR-T cells was evaluated via flow cytometry; using a target Alexa647 (ThermoFisher Scientific, waltham, MA) anti-TCR a/B specific antibody conjugates evaluate the TRAC expression of CAR-T cells via flow cytometry, or the B2M expression of CAR-T cells via flow cytometry using anti-B2M specific antibodies conjugated to PE. The results from the flow cytometry analysis are presented in fig. 15A, which shows the ratio of CAR positives (fig. 15A, 1501), TRAC positives (fig. 15A, 1502) and B2M positives (fig. 15A, 1503) for cells transfected with Cas12a chRDNA guide/nucleoprotein complex alone (TRAC KO/B2M KO; fig. 15A, 1505) and cells transfected with Cas12a chRDNA guide/nucleoprotein complex and transduced with both viruses (anti-BCMA, B2M-HLA-E CAR-T; fig. 15A, 1506). The y-axis represents the percentage of positive cells for various cell surface markers measured via FACS. The results are also provided in table 19.

The results presented in fig. 15A and table 19 demonstrate Cas12a chRDNA guide-mediated KO of endogenous TRAC and B2M expression, as well as AAV 6-mediated introduction and expression of anti-BCMA CARs and exogenous B2M-HLA-E proteins.

D. In vitro cytotoxicity against BCMA, B2M-HLA-E CAR-T cells

Cytotoxicity against BCMA, B2M-HLA-E CAR-T cells was assessed in vitro against the multiple myeloma NCI-H929 cell line presenting BCMA antigen. TRAC KO T cells served as controls for CAR-mediated killing. Briefly, target cells (NCI-H929 (T)) were subjected to CellTrace ^TM Violet (CTV; thermo Fisher C34557) was performed to distinguish them from effector anti-BCMA, B2M-HLA-E CAR-T (E), and cells were co-cultured at E:T ratios (3 co-culture wells/E:T ratio) of 0:1, 1:20, 1:10, 1:5, 1:3, 1:1, 3:1 and 10:1. After 48 hours of co-culture, cytotoxicity was measured by gating on CTV cell populations (target cells) and living cells (as measured by Propidium Iodide (PI)). The data were analyzed by flow cytometry (Intellicyt iQue Screener Plus). For each well, specific lysis was calculated using the following formula: specific lysis = 1- (number of viable target cells in test sample/number of viable target cells in control sample).

For anti-BCMA, B2M-HLA-E CAR-T cells (grey circles) and control TRAC KO T cells (black circles), the results from the in vitro cytotoxicity assays are presented in fig. 15B. The y-axis represents the percent of target cell killing and the x-axis represents the E:T ratio used. The data presented in fig. 15B is also presented in table 20.

StDev = standard deviation; n=3

The results presented in fig. 15B and table 20 demonstrate that CAR-T cells prepared using Cas12a chRDNA guide molecules are capable of antigen-specifically killing target cells.

The methods presented herein can be used to prepare other cells using Cas12a chRDNA guide molecules that site-specifically introduce a donor polynucleotide comprising a Chimeric Antigen Receptor (CAR). Additional donor polynucleotides expressing non-CAR polypeptides (i.e., B2M-HLA-E fusion constructs) can be similarly introduced using the guidance herein.

Example 10

Production of anti-BCMA CARE-T by expression driven by endogenous B2M promoter of B2M-HLA-E fusion

This example describes the design of transducing primary cells with AAV to site-specifically integrate a CAR polynucleotide and B2M-HLA-E polynucleotide expression cassette into the genome of the primary cells at a Cas12a chRDNA-mediated cleavage site.

A. AAV donor cassette and rAAV production via computer simulation design

An anti-BCMA CAR was designed as described in example 9.

A donor cassette polynucleotide for a P2A-B2M-HLA-E fusion construct is designed having a polynucleotide encoding an N-terminal B2M secretion signal followed by a polynucleotide encoding an HLA-G derived peptide sequence, a polynucleotide encoding a first linker sequence, a polynucleotide encoding a B2M sequence, a polynucleotide encoding a second linker sequence, a polynucleotide encoding an HLA-E sequence, and a polynucleotide encoding a C-terminal BGH polyadenylation signal sequence. A polynucleotide encoding a P2A ribosome jump sequence is inserted upstream of B2M-HLA-E such that expression of the fusion construct is under the control of the endogenous B2M promoter. To insert the DNA donor polynucleotide site-specifically into the host cell genome after site-specific cleavage, the target site in the endogenous B2M locus (SEQ ID NO: 62) is selected. Then, 500 base pair long homology arms 5 'and 3' of the cleavage site were identified. 5 'and 3' homology arms are appended to the 5 'and 3' ends of the DNA donor polynucleotide, wherein the DNA donor polynucleotide is oriented forward (i.e., 5 'to 3') with respect to the homology arms. The resulting DNA donor polynucleotide is presented in SEQ ID NO. 419.

Oligonucleotide sequences encoding DNA donor polynucleotides are provided to commercial manufacturers for synthesis of suitable recombinant AAV (rAAV) plasmids. The rAAV plasmid comprising SEQ ID NO. 413 and the separate rAAV plasmid comprising SEQ ID NO. 479 are provided to commercial manufacturers for packaging into two separate AAV6 viruses.

B. Primary T cell transduction with rAAV

Primary activated T cells were obtained from PBMCs as described in example 1. Cas12a chRDNA guide/nucleoprotein complexes targeting the genes encoding TRAC (SEQ ID NO: 415) and B2M (SEQ ID NO: 416) were prepared as described in example 2. T cells were transfected with a TRAC-targeted Cas12a chRDNA guide/nucleoprotein complex (SEQ ID NO: 415) and 1X10 by AAV6 virus packaged with CAR donor sequence (SEQ ID NO: 413) 1 min to 4 hours after nuclear transfection ⁶ MOI of (E) infected cells. In addition, T cells were transfected with a B2M (SEQ ID NO: 416) -targeted Cas12A chRDNA guide/nucleoprotein complex and 1x10 with AAV6 virus packaged with P2A-B2M-HLA-E donor sequence (SEQ ID NO: 479) 1 min to 4 hours post nuclear transfection ⁶ MOI of (E) infected cells. T cells were cultured for 24 hours after transduction in ImmunoCult-XF complete medium (STEMCELL Technologies, cambridge, MA) supplemented with IL-2 (100 units/mL). The following day, transduced T cells were transferred to a 50mL conical tube and centrifuged at 300xg for about 7-10 minutes to pellet the cells. The supernatant was discarded, the pellet was gently resuspended, and T cells were pooled in an appropriate volume of ImmunoCurt-XF complete medium (STEMCELL Technologies, cambridge, mass.) supplemented with IL-2 (100 units/mL).

T cells were counted at 1X 10 ⁶ Individual cells/mL were resuspended in ImmunoCult-XF complete medium (STEMCELL Technologies, cambridge, MA) supplemented with IL-2 (100 units/mL) and inoculated as needed into multiple T-175 suspension flasks (maximum volume per flask 250 mL).

C. Expression of anti-BCMA CARs and B2M-HLA-E on CAR-T cells

In vitro characterization of anti-BCMA, P2A-B2M-HLA-E CAR-T cells and control (TRAC Knockout (KO) and B2M KO) and wild type T cells was performed 7 days after transduction.

Using recombinant BCMA protein conjugated to Phycoerythrin (PE), anti-BCMA CAR expression of CAR-T cells was evaluated via flow cytometry; using a target Alexa647 (ThermoFisher Scientific, waltham, MA) anti-TCR a/B specific antibody conjugates evaluate the TRAC expression of CAR-T cells via flow cytometry, or the B2M expression of CAR-T cells via flow cytometry using anti-B2M specific antibodies conjugated to PE. The results from the flow cytometry analysis are presented in table 21, showing the ratios of CAR positive, TRAC positive and B2M positive for untreated cells (wild-type T cells), cells transfected with Cas12a chRDNA guide/nucleoprotein complex alone (TRAC KO/B2M KO) and cells transfected with Cas12a chRDNA guide/nucleoprotein complex and transduced with two viruses (anti-BCMA, B2M-HLA-E CAR-T).

The results presented in table 21 demonstrate Cas12a chRDNA guide-mediated KO for endogenous TRAC and B2M expression, as well as AAV 6-mediated introduction and exogenous expression of an anti-BCMA CAR donor cassette and exogenous B2M-HLA-E donor cassette driven by the endogenous B2M promoter.

The methods presented herein can be used to identify Cas12 chRDNA guide designs for other targets. The activation region and target binding sequences of other Cas12 chRDNA guides can be screened in a similar manner to the methods described herein.

Example 11

Cas12a guide/nucleoprotein complexes with alternative linker-NLS configuration

This example describes the design and comparison of Cas12a guide/nucleoprotein complexes with different linker and Nuclear Localization Signal (NLS) configurations compared to the "non-optimized" design of large T antigen NLS (SV 40; SEQ ID NO: 04) with glycine-serine linker and simian vacuolar virus 40 used in the previous examples of this application.

A. Cas12a linker-NLS sequences designed via computer modeling

The amino acid coccus (strain BV3L 6) Cas12a protein (SEQ ID NO: 01) was selected for engineering, and two NLS sequences, SV40 (SEQ ID NO: 04) and nucleoplasmin sequence (NPL; SEQ ID NO: 05) were selected for covalent addition to the Cas12a protein using glycine-serine (GS) or a pair of glycine-serine (G4S) amino acid linkers. Designs containing two NLSs with variable joints were also generated for testing. The linker-NLS sequence design is presented in Table 22:

* NLS design used in previous example

The NLS sequence presented in Table 22 was cloned at the C-terminus of the amino acid coccus (strain BV3L 6) Cas12a protein (SEQ ID NO: 01) and recombinant proteins were expressed as described in example 2.

Cell Activity of the Cas12a linker-NLS design

Purified recombinant Cas12a protein comprising the linker-NLS sequence presented in Table 22 was complexed with a chRDNA guide targeting the TRAC gene (SEQ ID NO: 467) as described in example 2 and transfected into primary T cells as described in example 3. 48 hours after transfection, the resulting genome editing efficiency of each Cas12a guide/nucleoprotein complex was determined as described in example 4. The results of the cell editing experiments are shown in fig. 16A and presented in table 23.

StDev = standard deviation; n=3; * NLS design used in the foregoing example

The data presented in fig. 16A and table 23 of the present example show that replacing linker and NLS sequences can result in increased editing compared to designs with a single GS-SV40 NLS configuration.

C. Cell activity of a surrogate Cas12a linker-NLS sequence in a target

The first four Cas12a linker-NLS configurations presented in table 23 (SEQ ID NO:489, SEQ ID NO:485, SEQ ID NO:487, and SEQ ID NO: 483) and the "non-optimized" design (SEQ ID NO: 479) were selected for comparison using the mixed set of crRNA and chRDNA. The targeting region (including the position of the DNA base in the chRDNA design) is presented in table 24.

The targeting region presented in Table 24 was appended to the 3' end of the activation region (SEQ ID NO: 459) and was provided to commercial manufacturers for synthesis.

Each Cas12a linker-NLS configuration complexed with each guide was prepared essentially as described in example 2, except that for each Cas12a linker-NLS and guide combination, the complexes were assembled at two concentrations of Cas12a and guide of 20:60 and 80:240 pmol. The Cas12a guide/nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4.

The compiled results of Cas12a linker-NLS configuration complexed with the guide shown in table 24 are presented in fig. 16B and tables 25 and 26.

/>

StDev = standard deviation; n=2; * NLS design used in the foregoing example

The data presented in fig. 16B and tables 25 and 26 demonstrate improved activity of various NLS configurations in multiple targets of human primary T cells (see, e.g., average editing of fig. 16B 1613 compared to average editing of fig. 16B1616 or 16B 1617 in fig. 16B). Alternative NLS sequences, linkers, and Cas nucleases can be screened in a similar manner to the methods described herein.

Example 12

Multiplexing (multiplexing) of Cas12a chRDNA guide/nucleoprotein complexes

This example describes the co-delivery of multiple Cas12a chRDNA to cells in a single transfection reaction (multiplexing) and comparison of multiplex editing rates for Cas12a chRDNA guide/nucleoprotein complexes with GS-SV40 (SEQ ID NO:479; "non-optimized NLS") and (G4S) 2-NPL (SEQ ID NO:489; "optimized NLS").

A. Cas12a chRDNA linker-NLS sequence designed through computer simulation

The amino acid coccus (strain BV3L 6) Cas12a protein (SEQ ID NO: 01) was engineered with a first C-terminal linker-NLS sequence (SEQ ID NO: 479) or a second C-terminal linker-NLS sequence (SEQ ID NO: 489) and the Cas12a recombinant protein was expressed as described in example 2.

Cell multiplexing Activity of Cas12a linker-NLS

Purified recombinant Cas12a protein comprising either the linker-NLS sequence SEQ ID NO:479 or the linker-NLS sequence SEQ ID NO:489 was complexed with TRAC-targeted chRDNA (SEQ ID NO: 508), B2M-targeted chRDNA gene (SEQ ID NO: 416), CISH-targeted chRDNA (SEQ ID NO: 509) or CBLB-targeted chRDNA (SEQ ID NO: 510) as described in example 2, except that the complex was assembled at a ratio of 40:80pmol of Cas12a to the guide. Each Cas12a chRDNA guide/nucleoprotein complex is used as a single targeting complex; cas12a chRDNA guide/nucleoprotein complex targeting TRAC and B2M for combination in a mixture; cas12a chRDNA guide/nucleoprotein complexes targeting CISH and CBLB for use as a combination in a mixture; or as Cas12a chRDNA guide/nucleoprotein complexes targeting all TRAC, B2M, CISH and CBLB in combination in one mixture. Each Cas12a chRDNA/nucleoprotein composition was transfected into primary T cells as described in example 3. 48 hours after transfection, the resulting genome editing efficiency of each Cas12a chRDNA/nucleoprotein complex was determined as described in example 4. The results of the cell editing experiments are shown in fig. 17 and presented in table 27.

The data presented in fig. 17 and table 27 demonstrate that the activity of the linker-NLS construct improves when used for multiplexing in human primary T cells. See, e.g., average editing of series figures 17, 1707 with non-optimized GS-SV40 linker-NLS (SEQ ID NO:479, fig. 17 1708) and average editing of series figures 17, 1711 with optimized (G4S) 2-NPL linker NLS (SEQ ID NO:489, fig. 17,1712). Alternative NLS sequences, linkers, cas12 nucleases and targets for multiplexing may be screened in a similar manner to the methods described herein.

Example 13

Editing with Cas12a chRDNA guide/nucleoprotein complex comprising chemical modification

This example describes the cell editing activity of Cas12a chRDNA containing phosphorothioate chemical modifications in the activation and targeting regions of Cas12a guide RNAs.

A. Cas12a chRDNA with chemical modification via computer simulation design

TRAC target-12 sequence (SEQ ID NO: 316) was selected for engineering. Two phosphorothioate linkages were designed to the 5 'end of the Cas12a guide (i.e., the 5' -terminal nucleotide of the activation region) and two phosphorothioate linkages were designed to the 3 'end of the Cas12a guide (i.e., the 3' -terminal nucleotide of the targeting region). A series of Cas12a guides were then designed with DNA bases in the activation region in addition to the end-protecting phosphorothioate modifications. The sequence of Cas12a chRDNA with chemical modification is shown in table 28. The sequences were provided to commercial manufacturers for synthesis (the phosphorothioate linkages and DNA base positions listed correspond to the numbers shown in fig. 5).

Phosphorothioate linkages are indicated by "×".

B. Cell transfection and analysis

Separate Cas12a guide/nucleoprotein complexes are prepared essentially as described in example 2. The nucleoprotein complex was transfected into primary T cells as described in example 3, and the resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4. The results of the intracellular editing experiments are shown in table 29.

StDev = standard deviation; n=2

The data presented in table 29 demonstrate the editing activity of Cas12a guides comprising phosphorothioate linkages alone or phosphorothioate linkages and DNA bases. These leads were able to edit robustly in human primary T cells compared to full RNA leads (all-RNA guide) (see, e.g., average editing of SEQ ID NO:511 vs. average editing of SEQ ID NO:512 or SEQ ID NO:515 in Table 29). Alternative combinations and positions of chemical modifications may be screened in a manner similar to the methods described herein.

Example 14

Transfection of human induced pluripotent stem cells with Cas12a chRDNA/nucleoprotein complexes

This example describes the cell editing of human induced pluripotent stem cells (ipscs) with Cas12a chRDNA/nucleoprotein complex.

A. Design of chRDNA guide via computer simulation

The AsCas12a guide sequence targeting the CISH gene (SEQ ID NO: 509) comprising a DNA base in the activation region of the guide was selected for further engineering and introduction of additional DNA bases into the targeting region (SEQ ID NO:518-SEQ ID NO: 529). The sequences were provided to commercial manufacturers for synthesis.

B. Cell transfection and analysis

Separate Cas12a guide/nucleoprotein complexes are prepared essentially as described in example 2. The nucleoprotein complex was transfected into primary T cells as described in example 3.

Ipscs were treated and transfected in a similar manner to the method of treating and transfecting primary T cells described in example 3, with the following modifications. Ipscs were incubated for 3 hours at 37 ℃ in mTeSR-plus medium (STEMCELL Technologies, cambridge, MA) supplemented with a final concentration of 10 μm Rho-associated coiled-coil-containing protein kinase inhibitor ("ROCKi," millipore sigma, burlington, MA) prior to transfection. The mTESR-plus/ROCKi medium was removed and the iPSC was washed with 10mL PBS, then 3mL accutase (STEMCELL Technologies, cambridge, mass.) was added and the cells incubated at 37℃for 5-10 min. 7ml of mTESR-pulse and ROCKi were then added to the cells and the cells were mixed and counted. The cells were then centrifuged, the medium removed, the cells washed with 10mL PBS, centrifuged again and the PBS removed. Resuspending cells in Nucleofector ^TM P3 (Lonza, allendale, NJ) solution to a density of 2e5 cells/mL was mixed with the Cas12a chRDNA guide/nucleoprotein complex and transfected with pulse-encoded CA 158. The resulting genome editing efficiency of the Cas12a guide/nucleoprotein complex was determined as described in example 4 and presented in table 29.

StDev = standard deviation; n=1-2

The data presented in table 29 indicate that Cas12a chRDNA guide/nucleoprotein complexes can be used for engineering of human ipscs. Other cell types may be edited in a similar manner to the methods described herein.

As will be apparent to those skilled in the art, modifications and variations can be made to the above-described embodiments without departing from the spirit and scope of the disclosure. Such modifications and variations are within the scope of the present disclosure.

Sequence listing

<110> Calibonus bioscience Co (CARIBOU BIOSCIENCES, INC.)

Luo denier, dorohol (DONOHUE, paul Daniel)

<120> DNA-containing polynucleotides and guides for CRISPR V-type systems and methods of making and using the same

<130> CBI039.30

<150> US 63/093,459

<151> 2020-10-19

<150> US 63/127,648

<151> 2020-12-18

<150> US 63/229,870

<151> 2021-08-05

<160> 529

<170> PatentIn version 3.5

<210> 1

<211> 1307

<212> PRT

<213> amino acid coccus (Acidoaerococcus sp.)

<220>

<221> SITE

<222> (1)..(1307)

<223> amino acid coccus (strain BV3L 6), cas12a

<400> 1

Met Thr Gln Phe Glu Gly Phe Thr Asn Leu Tyr Gln Val Ser Lys Thr

1 5 10 15

Leu Arg Phe Glu Leu Ile Pro Gln Gly Lys Thr Leu Lys His Ile Gln

20 25 30

Glu Gln Gly Phe Ile Glu Glu Asp Lys Ala Arg Asn Asp His Tyr Lys

35 40 45

Glu Leu Lys Pro Ile Ile Asp Arg Ile Tyr Lys Thr Tyr Ala Asp Gln

50 55 60

Cys Leu Gln Leu Val Gln Leu Asp Trp Glu Asn Leu Ser Ala Ala Ile

65 70 75 80

Asp Ser Tyr Arg Lys Glu Lys Thr Glu Glu Thr Arg Asn Ala Leu Ile

85 90 95

Glu Glu Gln Ala Thr Tyr Arg Asn Ala Ile His Asp Tyr Phe Ile Gly

100 105 110

Arg Thr Asp Asn Leu Thr Asp Ala Ile Asn Lys Arg His Ala Glu Ile

115 120 125

Tyr Lys Gly Leu Phe Lys Ala Glu Leu Phe Asn Gly Lys Val Leu Lys

130 135 140

Gln Leu Gly Thr Val Thr Thr Thr Glu His Glu Asn Ala Leu Leu Arg

145 150 155 160

Ser Phe Asp Lys Phe Thr Thr Tyr Phe Ser Gly Phe Tyr Glu Asn Arg

165 170 175

Lys Asn Val Phe Ser Ala Glu Asp Ile Ser Thr Ala Ile Pro His Arg

180 185 190

Ile Val Gln Asp Asn Phe Pro Lys Phe Lys Glu Asn Cys His Ile Phe

195 200 205

Thr Arg Leu Ile Thr Ala Val Pro Ser Leu Arg Glu His Phe Glu Asn

210 215 220

Val Lys Lys Ala Ile Gly Ile Phe Val Ser Thr Ser Ile Glu Glu Val

225 230 235 240

Phe Ser Phe Pro Phe Tyr Asn Gln Leu Leu Thr Gln Thr Gln Ile Asp

245 250 255

Leu Tyr Asn Gln Leu Leu Gly Gly Ile Ser Arg Glu Ala Gly Thr Glu

260 265 270

Lys Ile Lys Gly Leu Asn Glu Val Leu Asn Leu Ala Ile Gln Lys Asn

275 280 285

Asp Glu Thr Ala His Ile Ile Ala Ser Leu Pro His Arg Phe Ile Pro

290 295 300

Leu Phe Lys Gln Ile Leu Ser Asp Arg Asn Thr Leu Ser Phe Ile Leu

305 310 315 320

Glu Glu Phe Lys Ser Asp Glu Glu Val Ile Gln Ser Phe Cys Lys Tyr

325 330 335

Lys Thr Leu Leu Arg Asn Glu Asn Val Leu Glu Thr Ala Glu Ala Leu

340 345 350

Phe Asn Glu Leu Asn Ser Ile Asp Leu Thr His Ile Phe Ile Ser His

355 360 365

Lys Lys Leu Glu Thr Ile Ser Ser Ala Leu Cys Asp His Trp Asp Thr

370 375 380

Leu Arg Asn Ala Leu Tyr Glu Arg Arg Ile Ser Glu Leu Thr Gly Lys

385 390 395 400

Ile Thr Lys Ser Ala Lys Glu Lys Val Gln Arg Ser Leu Lys His Glu

405 410 415

Asp Ile Asn Leu Gln Glu Ile Ile Ser Ala Ala Gly Lys Glu Leu Ser

420 425 430

Glu Ala Phe Lys Gln Lys Thr Ser Glu Ile Leu Ser His Ala His Ala

435 440 445

Ala Leu Asp Gln Pro Leu Pro Thr Thr Leu Lys Lys Gln Glu Glu Lys

450 455 460

Glu Ile Leu Lys Ser Gln Leu Asp Ser Leu Leu Gly Leu Tyr His Leu

465 470 475 480

Leu Asp Trp Phe Ala Val Asp Glu Ser Asn Glu Val Asp Pro Glu Phe

485 490 495

Ser Ala Arg Leu Thr Gly Ile Lys Leu Glu Met Glu Pro Ser Leu Ser

500 505 510

Phe Tyr Asn Lys Ala Arg Asn Tyr Ala Thr Lys Lys Pro Tyr Ser Val

515 520 525

Glu Lys Phe Lys Leu Asn Phe Gln Met Pro Thr Leu Ala Ser Gly Trp

530 535 540

Asp Val Asn Lys Glu Lys Asn Asn Gly Ala Ile Leu Phe Val Lys Asn

545 550 555 560

Gly Leu Tyr Tyr Leu Gly Ile Met Pro Lys Gln Lys Gly Arg Tyr Lys

565 570 575

Ala Leu Ser Phe Glu Pro Thr Glu Lys Thr Ser Glu Gly Phe Asp Lys

580 585 590

Met Tyr Tyr Asp Tyr Phe Pro Asp Ala Ala Lys Met Ile Pro Lys Cys

595 600 605

Ser Thr Gln Leu Lys Ala Val Thr Ala His Phe Gln Thr His Thr Thr

610 615 620

Pro Ile Leu Leu Ser Asn Asn Phe Ile Glu Pro Leu Glu Ile Thr Lys

625 630 635 640

Glu Ile Tyr Asp Leu Asn Asn Pro Glu Lys Glu Pro Lys Lys Phe Gln

645 650 655

Thr Ala Tyr Ala Lys Lys Thr Gly Asp Gln Lys Gly Tyr Arg Glu Ala

660 665 670

Leu Cys Lys Trp Ile Asp Phe Thr Arg Asp Phe Leu Ser Lys Tyr Thr

675 680 685

Lys Thr Thr Ser Ile Asp Leu Ser Ser Leu Arg Pro Ser Ser Gln Tyr

690 695 700

Lys Asp Leu Gly Glu Tyr Tyr Ala Glu Leu Asn Pro Leu Leu Tyr His

705 710 715 720

Ile Ser Phe Gln Arg Ile Ala Glu Lys Glu Ile Met Asp Ala Val Glu

725 730 735

Thr Gly Lys Leu Tyr Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ala Lys

740 745 750

Gly His His Gly Lys Pro Asn Leu His Thr Leu Tyr Trp Thr Gly Leu

755 760 765

Phe Ser Pro Glu Asn Leu Ala Lys Thr Ser Ile Lys Leu Asn Gly Gln

770 775 780

Ala Glu Leu Phe Tyr Arg Pro Lys Ser Arg Met Lys Arg Met Ala His

785 790 795 800

Arg Leu Gly Glu Lys Met Leu Asn Lys Lys Leu Lys Asp Gln Lys Thr

805 810 815

Pro Ile Pro Asp Thr Leu Tyr Gln Glu Leu Tyr Asp Tyr Val Asn His

820 825 830

Arg Leu Ser His Asp Leu Ser Asp Glu Ala Arg Ala Leu Leu Pro Asn

835 840 845

Val Ile Thr Lys Glu Val Ser His Glu Ile Ile Lys Asp Arg Arg Phe

850 855 860

Thr Ser Asp Lys Phe Phe Phe His Val Pro Ile Thr Leu Asn Tyr Gln

865 870 875 880

Ala Ala Asn Ser Pro Ser Lys Phe Asn Gln Arg Val Asn Ala Tyr Leu

885 890 895

Lys Glu His Pro Glu Thr Pro Ile Ile Gly Ile Asp Arg Gly Glu Arg

900 905 910

Asn Leu Ile Tyr Ile Thr Val Ile Asp Ser Thr Gly Lys Ile Leu Glu

915 920 925

Gln Arg Ser Leu Asn Thr Ile Gln Gln Phe Asp Tyr Gln Lys Lys Leu

930 935 940

Asp Asn Arg Glu Lys Glu Arg Val Ala Ala Arg Gln Ala Trp Ser Val

945 950 955 960

Val Gly Thr Ile Lys Asp Leu Lys Gln Gly Tyr Leu Ser Gln Val Ile

965 970 975

His Glu Ile Val Asp Leu Met Ile His Tyr Gln Ala Val Val Val Leu

980 985 990

Glu Asn Leu Asn Phe Gly Phe Lys Ser Lys Arg Thr Gly Ile Ala Glu

995 1000 1005

Lys Ala Val Tyr Gln Gln Phe Glu Lys Met Leu Ile Asp Lys Leu

1010 1015 1020

Asn Cys Leu Val Leu Lys Asp Tyr Pro Ala Glu Lys Val Gly Gly

1025 1030 1035

Val Leu Asn Pro Tyr Gln Leu Thr Asp Gln Phe Thr Ser Phe Ala

1040 1045 1050

Lys Met Gly Thr Gln Ser Gly Phe Leu Phe Tyr Val Pro Ala Pro

1055 1060 1065

Tyr Thr Ser Lys Ile Asp Pro Leu Thr Gly Phe Val Asp Pro Phe

1070 1075 1080

Val Trp Lys Thr Ile Lys Asn His Glu Ser Arg Lys His Phe Leu

1085 1090 1095

Glu Gly Phe Asp Phe Leu His Tyr Asp Val Lys Thr Gly Asp Phe

1100 1105 1110

Ile Leu His Phe Lys Met Asn Arg Asn Leu Ser Phe Gln Arg Gly

1115 1120 1125

Leu Pro Gly Phe Met Pro Ala Trp Asp Ile Val Phe Glu Lys Asn

1130 1135 1140

Glu Thr Gln Phe Asp Ala Lys Gly Thr Pro Phe Ile Ala Gly Lys

1145 1150 1155

Arg Ile Val Pro Val Ile Glu Asn His Arg Phe Thr Gly Arg Tyr

1160 1165 1170

Arg Asp Leu Tyr Pro Ala Asn Glu Leu Ile Ala Leu Leu Glu Glu

1175 1180 1185

Lys Gly Ile Val Phe Arg Asp Gly Ser Asn Ile Leu Pro Lys Leu

1190 1195 1200

Leu Glu Asn Asp Asp Ser His Ala Ile Asp Thr Met Val Ala Leu

1205 1210 1215

Ile Arg Ser Val Leu Gln Met Arg Asn Ser Asn Ala Ala Thr Gly

1220 1225 1230

Glu Asp Tyr Ile Asn Ser Pro Val Arg Asp Leu Asn Gly Val Cys

1235 1240 1245

Phe Asp Ser Arg Phe Gln Asn Pro Glu Trp Pro Met Asp Ala Asp

1250 1255 1260

Ala Asn Gly Ala Tyr His Ile Ala Leu Lys Gly Gln Leu Leu Leu

1265 1270 1275

Asn His Leu Lys Glu Ser Lys Asp Leu Lys Leu Gln Asn Gly Ile

1280 1285 1290

Ser Asn Gln Asp Trp Leu Ala Tyr Ile Gln Glu Leu Arg Asn

1295 1300 1305

<210> 2

<211> 1228

<212> PRT

<213> Maospiraceae bacteria ND2006 (Lachnospiraceae bacterium ND 2006)

<220>

<221> SITE

<222> (1)..(1228)

<223> Cas12a

<400> 2

Met Ser Lys Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser Lys Thr

1 5 10 15

Leu Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn Ile Asp

20 25 30

Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp Tyr Lys

35 40 45

Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile Asn Asp

50 55 60

Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn Tyr Ile Ser Leu

65 70 75 80

Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu Asn Lys Glu Leu Glu Asn

85 90 95

Leu Glu Ile Asn Leu Arg Lys Glu Ile Ala Lys Ala Phe Lys Gly Asn

100 105 110

Glu Gly Tyr Lys Ser Leu Phe Lys Lys Asp Ile Ile Glu Thr Ile Leu

115 120 125

Pro Glu Phe Leu Asp Asp Lys Asp Glu Ile Ala Leu Val Asn Ser Phe

130 135 140

Asn Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg Glu Asn

145 150 155 160

Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg Cys Ile

165 170 175

Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe Glu Lys

180 185 190

Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu Ile Lys Glu Lys

195 200 205

Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp Phe Phe Glu Gly Glu Phe

210 215 220

Phe Asn Phe Val Leu Thr Gln Glu Gly Ile Asp Val Tyr Asn Ala Ile

225 230 235 240

Ile Gly Gly Phe Val Thr Glu Ser Gly Glu Lys Ile Lys Gly Leu Asn

245 250 255

Glu Tyr Ile Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu Pro Lys

260 265 270

Phe Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser Leu Ser

275 280 285

Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu Val Phe

290 295 300

Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser Ile Lys Lys

305 310 315 320

Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr Ser Ser Ala Gly Ile

325 330 335

Phe Val Lys Asn Gly Pro Ala Ile Ser Thr Ile Ser Lys Asp Ile Phe

340 345 350

Gly Glu Trp Asn Val Ile Arg Asp Lys Trp Asn Ala Glu Tyr Asp Asp

355 360 365

Ile His Leu Lys Lys Lys Ala Val Val Thr Glu Lys Tyr Glu Asp Asp

370 375 380

Arg Arg Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu Gln Leu

385 390 395 400

Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu Lys Glu

405 410 415

Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly Ser Ser

420 425 430

Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser Leu Lys Lys

435 440 445

Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu Leu Asp Ser Val Lys

450 455 460

Ser Phe Glu Asn Tyr Ile Lys Ala Phe Phe Gly Glu Gly Lys Glu Thr

465 470 475 480

Asn Arg Asp Glu Ser Phe Tyr Gly Asp Phe Val Leu Ala Tyr Asp Ile

485 490 495

Leu Leu Lys Val Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr Val Thr

500 505 510

Gln Lys Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln Asn Pro

515 520 525

Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr Arg Ala

530 535 540

Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met Asp Lys

545 550 555 560

Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp Asp Val Asn Gly

565 570 575

Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu Pro Gly Pro Asn Lys Met

580 585 590

Leu Pro Lys Val Phe Phe Ser Lys Lys Trp Met Ala Tyr Tyr Asn Pro

595 600 605

Ser Glu Asp Ile Gln Lys Ile Tyr Lys Asn Gly Thr Phe Lys Lys Gly

610 615 620

Asp Met Phe Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe Phe Lys

625 630 635 640

Asp Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp Phe Asn

645 650 655

Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr Arg Glu

660 665 670

Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser Lys Lys

675 680 685

Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr Met Phe Gln Ile

690 695 700

Tyr Asn Lys Asp Phe Ser Asp Lys Ser His Gly Thr Pro Asn Leu His

705 710 715 720

Thr Met Tyr Phe Lys Leu Leu Phe Asp Glu Asn Asn His Gly Gln Ile

725 730 735

Arg Leu Ser Gly Gly Ala Glu Leu Phe Met Arg Arg Ala Ser Leu Lys

740 745 750

Lys Glu Glu Leu Val Val His Pro Ala Asn Ser Pro Ile Ala Asn Lys

755 760 765

Asn Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp Val Tyr

770 775 780

Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile Pro Ile

785 790 795 800

Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn Thr Glu Val

805 810 815

Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr Val Ile Gly Ile Asp

820 825 830

Arg Gly Glu Arg Asn Leu Leu Tyr Ile Val Val Val Asp Gly Lys Gly

835 840 845

Asn Ile Val Glu Gln Tyr Ser Leu Asn Glu Ile Ile Asn Asn Phe Asn

850 855 860

Gly Ile Arg Ile Lys Thr Asp Tyr His Ser Leu Leu Asp Lys Lys Glu

865 870 875 880

Lys Glu Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu Asn Ile

885 890 895

Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys Ile Cys

900 905 910

Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp Leu Asn

915 920 925

Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln Val Tyr Gln

930 935 940

Lys Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Tyr Met Val Asp Lys

945 950 955 960

Lys Ser Asn Pro Cys Ala Thr Gly Gly Ala Leu Lys Gly Tyr Gln Ile

965 970 975

Thr Asn Lys Phe Glu Ser Phe Lys Ser Met Ser Thr Gln Asn Gly Phe

980 985 990

Ile Phe Tyr Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp Pro Ser Thr

995 1000 1005

Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser Ile Ala Asp

1010 1015 1020

Ser Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met Tyr Val Pro

1025 1030 1035

Glu Glu Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys Asn Phe Ser

1040 1045 1050

Arg Thr Asp Ala Asp Tyr Ile Lys Lys Trp Lys Leu Tyr Ser Tyr

1055 1060 1065

Gly Asn Arg Ile Arg Ile Phe Arg Asn Pro Lys Lys Asn Asn Val

1070 1075 1080

Phe Asp Trp Glu Glu Val Cys Leu Thr Ser Ala Tyr Lys Glu Leu

1085 1090 1095

Phe Asn Lys Tyr Gly Ile Asn Tyr Gln Gln Gly Asp Ile Arg Ala

1100 1105 1110

Leu Leu Cys Glu Gln Ser Asp Lys Ala Phe Tyr Ser Ser Phe Met

1115 1120 1125

Ala Leu Met Ser Leu Met Leu Gln Met Arg Asn Ser Ile Thr Gly

1130 1135 1140

Arg Thr Asp Val Asp Phe Leu Ile Ser Pro Val Lys Asn Ser Asp

1145 1150 1155

Gly Ile Phe Tyr Asp Ser Arg Asn Tyr Glu Ala Gln Glu Asn Ala

1160 1165 1170

Ile Leu Pro Lys Asn Ala Asp Ala Asn Gly Ala Tyr Asn Ile Ala

1175 1180 1185

Arg Lys Val Leu Trp Ala Ile Gly Gln Phe Lys Lys Ala Glu Asp

1190 1195 1200

Glu Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn Lys Glu Trp

1205 1210 1215

Leu Glu Tyr Ala Gln Thr Ser Val Lys His

1220 1225

<210> 3

<211> 1300

<212> PRT

<213> Francisella tularensis (Francisella tularensis)

<220>

<221> SITE

<222> (1)..(1300)

<223> Francisella subspecies novicida (strain U112), cas12a

<400> 3

Met Ser Ile Tyr Gln Glu Phe Val Asn Lys Tyr Ser Leu Ser Lys Thr

1 5 10 15

Leu Arg Phe Glu Leu Ile Pro Gln Gly Lys Thr Leu Glu Asn Ile Lys

20 25 30

Ala Arg Gly Leu Ile Leu Asp Asp Glu Lys Arg Ala Lys Asp Tyr Lys

35 40 45

Lys Ala Lys Gln Ile Ile Asp Lys Tyr His Gln Phe Phe Ile Glu Glu

50 55 60

Ile Leu Ser Ser Val Cys Ile Ser Glu Asp Leu Leu Gln Asn Tyr Ser

65 70 75 80

Asp Val Tyr Phe Lys Leu Lys Lys Ser Asp Asp Asp Asn Leu Gln Lys

85 90 95

Asp Phe Lys Ser Ala Lys Asp Thr Ile Lys Lys Gln Ile Ser Glu Tyr

100 105 110

Ile Lys Asp Ser Glu Lys Phe Lys Asn Leu Phe Asn Gln Asn Leu Ile

115 120 125

Asp Ala Lys Lys Gly Gln Glu Ser Asp Leu Ile Leu Trp Leu Lys Gln

130 135 140

Ser Lys Asp Asn Gly Ile Glu Leu Phe Lys Ala Asn Ser Asp Ile Thr

145 150 155 160

Asp Ile Asp Glu Ala Leu Glu Ile Ile Lys Ser Phe Lys Gly Trp Thr

165 170 175

Thr Tyr Phe Lys Gly Phe His Glu Asn Arg Lys Asn Val Tyr Ser Ser

180 185 190

Asn Asp Ile Pro Thr Ser Ile Ile Tyr Arg Ile Val Asp Asp Asn Leu

195 200 205

Pro Lys Phe Leu Glu Asn Lys Ala Lys Tyr Glu Ser Leu Lys Asp Lys

210 215 220

Ala Pro Glu Ala Ile Asn Tyr Glu Gln Ile Lys Lys Asp Leu Ala Glu

225 230 235 240

Glu Leu Thr Phe Asp Ile Asp Tyr Lys Thr Ser Glu Val Asn Gln Arg

245 250 255

Val Phe Ser Leu Asp Glu Val Phe Glu Ile Ala Asn Phe Asn Asn Tyr

260 265 270

Leu Asn Gln Ser Gly Ile Thr Lys Phe Asn Thr Ile Ile Gly Gly Lys

275 280 285

Phe Val Asn Gly Glu Asn Thr Lys Arg Lys Gly Ile Asn Glu Tyr Ile

290 295 300

Asn Leu Tyr Ser Gln Gln Ile Asn Asp Lys Thr Leu Lys Lys Tyr Lys

305 310 315 320

Met Ser Val Leu Phe Lys Gln Ile Leu Ser Asp Thr Glu Ser Lys Ser

325 330 335

Phe Val Ile Asp Lys Leu Glu Asp Asp Ser Asp Val Val Thr Thr Met

340 345 350

Gln Ser Phe Tyr Glu Gln Ile Ala Ala Phe Lys Thr Val Glu Glu Lys

355 360 365

Ser Ile Lys Glu Thr Leu Ser Leu Leu Phe Asp Asp Leu Lys Ala Gln

370 375 380

Lys Leu Asp Leu Ser Lys Ile Tyr Phe Lys Asn Asp Lys Ser Leu Thr

385 390 395 400

Asp Leu Ser Gln Gln Val Phe Asp Asp Tyr Ser Val Ile Gly Thr Ala

405 410 415

Val Leu Glu Tyr Ile Thr Gln Gln Ile Ala Pro Lys Asn Leu Asp Asn

420 425 430

Pro Ser Lys Lys Glu Gln Glu Leu Ile Ala Lys Lys Thr Glu Lys Ala

435 440 445

Lys Tyr Leu Ser Leu Glu Thr Ile Lys Leu Ala Leu Glu Glu Phe Asn

450 455 460

Lys His Arg Asp Ile Asp Lys Gln Cys Arg Phe Glu Glu Ile Leu Ala

465 470 475 480

Asn Phe Ala Ala Ile Pro Met Ile Phe Asp Glu Ile Ala Gln Asn Lys

485 490 495

Asp Asn Leu Ala Gln Ile Ser Ile Lys Tyr Gln Asn Gln Gly Lys Lys

500 505 510

Asp Leu Leu Gln Ala Ser Ala Glu Asp Asp Val Lys Ala Ile Lys Asp

515 520 525

Leu Leu Asp Gln Thr Asn Asn Leu Leu His Lys Leu Lys Ile Phe His

530 535 540

Ile Ser Gln Ser Glu Asp Lys Ala Asn Ile Leu Asp Lys Asp Glu His

545 550 555 560

Phe Tyr Leu Val Phe Glu Glu Cys Tyr Phe Glu Leu Ala Asn Ile Val

565 570 575

Pro Leu Tyr Asn Lys Ile Arg Asn Tyr Ile Thr Gln Lys Pro Tyr Ser

580 585 590

Asp Glu Lys Phe Lys Leu Asn Phe Glu Asn Ser Thr Leu Ala Asn Gly

595 600 605

Trp Asp Lys Asn Lys Glu Pro Asp Asn Thr Ala Ile Leu Phe Ile Lys

610 615 620

Asp Asp Lys Tyr Tyr Leu Gly Val Met Asn Lys Lys Asn Asn Lys Ile

625 630 635 640

Phe Asp Asp Lys Ala Ile Lys Glu Asn Lys Gly Glu Gly Tyr Lys Lys

645 650 655

Ile Val Tyr Lys Leu Leu Pro Gly Ala Asn Lys Met Leu Pro Lys Val

660 665 670

Phe Phe Ser Ala Lys Ser Ile Lys Phe Tyr Asn Pro Ser Glu Asp Ile

675 680 685

Leu Arg Ile Arg Asn His Ser Thr His Thr Lys Asn Gly Ser Pro Gln

690 695 700

Lys Gly Tyr Glu Lys Phe Glu Phe Asn Ile Glu Asp Cys Arg Lys Phe

705 710 715 720

Ile Asp Phe Tyr Lys Gln Ser Ile Ser Lys His Pro Glu Trp Lys Asp

725 730 735

Phe Gly Phe Arg Phe Ser Asp Thr Gln Arg Tyr Asn Ser Ile Asp Glu

740 745 750

Phe Tyr Arg Glu Val Glu Asn Gln Gly Tyr Lys Leu Thr Phe Glu Asn

755 760 765

Ile Ser Glu Ser Tyr Ile Asp Ser Val Val Asn Gln Gly Lys Leu Tyr

770 775 780

Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ser Ala Tyr Ser Lys Gly Arg

785 790 795 800

Pro Asn Leu His Thr Leu Tyr Trp Lys Ala Leu Phe Asp Glu Arg Asn

805 810 815

Leu Gln Asp Val Val Tyr Lys Leu Asn Gly Glu Ala Glu Leu Phe Tyr

820 825 830

Arg Lys Gln Ser Ile Pro Lys Lys Ile Thr His Pro Ala Lys Glu Ala

835 840 845

Ile Ala Asn Lys Asn Lys Asp Asn Pro Lys Lys Glu Ser Val Phe Glu

850 855 860

Tyr Asp Leu Ile Lys Asp Lys Arg Phe Thr Glu Asp Lys Phe Phe Phe

865 870 875 880

His Cys Pro Ile Thr Ile Asn Phe Lys Ser Ser Gly Ala Asn Lys Phe

885 890 895

Asn Asp Glu Ile Asn Leu Leu Leu Lys Glu Lys Ala Asn Asp Val His

900 905 910

Ile Leu Ser Ile Asp Arg Gly Glu Arg His Leu Ala Tyr Tyr Thr Leu

915 920 925

Val Asp Gly Lys Gly Asn Ile Ile Lys Gln Asp Thr Phe Asn Ile Ile

930 935 940

Gly Asn Asp Arg Met Lys Thr Asn Tyr His Asp Lys Leu Ala Ala Ile

945 950 955 960

Glu Lys Asp Arg Asp Ser Ala Arg Lys Asp Trp Lys Lys Ile Asn Asn

965 970 975

Ile Lys Glu Met Lys Glu Gly Tyr Leu Ser Gln Val Val His Glu Ile

980 985 990

Ala Lys Leu Val Ile Glu Tyr Asn Ala Ile Val Val Phe Glu Asp Leu

995 1000 1005

Asn Phe Gly Phe Lys Arg Gly Arg Phe Lys Val Glu Lys Gln Val

1010 1015 1020

Tyr Gln Lys Leu Glu Lys Met Leu Ile Glu Lys Leu Asn Tyr Leu

1025 1030 1035

Val Phe Lys Asp Asn Glu Phe Asp Lys Thr Gly Gly Val Leu Arg

1040 1045 1050

Ala Tyr Gln Leu Thr Ala Pro Phe Glu Thr Phe Lys Lys Met Gly

1055 1060 1065

Lys Gln Thr Gly Ile Ile Tyr Tyr Val Pro Ala Gly Phe Thr Ser

1070 1075 1080

Lys Ile Cys Pro Val Thr Gly Phe Val Asn Gln Leu Tyr Pro Lys

1085 1090 1095

Tyr Glu Ser Val Ser Lys Ser Gln Glu Phe Phe Ser Lys Phe Asp

1100 1105 1110

Lys Ile Cys Tyr Asn Leu Asp Lys Gly Tyr Phe Glu Phe Ser Phe

1115 1120 1125

Asp Tyr Lys Asn Phe Gly Asp Lys Ala Ala Lys Gly Lys Trp Thr

1130 1135 1140

Ile Ala Ser Phe Gly Ser Arg Leu Ile Asn Phe Arg Asn Ser Asp

1145 1150 1155

Lys Asn His Asn Trp Asp Thr Arg Glu Val Tyr Pro Thr Lys Glu

1160 1165 1170

Leu Glu Lys Leu Leu Lys Asp Tyr Ser Ile Glu Tyr Gly His Gly

1175 1180 1185

Glu Cys Ile Lys Ala Ala Ile Cys Gly Glu Ser Asp Lys Lys Phe

1190 1195 1200

Phe Ala Lys Leu Thr Ser Val Leu Asn Thr Ile Leu Gln Met Arg

1205 1210 1215

Asn Ser Lys Thr Gly Thr Glu Leu Asp Tyr Leu Ile Ser Pro Val

1220 1225 1230

Ala Asp Val Asn Gly Asn Phe Phe Asp Ser Arg Gln Ala Pro Lys

1235 1240 1245

Asn Met Pro Gln Asp Ala Asp Ala Asn Gly Ala Tyr His Ile Gly

1250 1255 1260

Leu Lys Gly Leu Met Leu Leu Gly Arg Ile Lys Asn Asn Gln Glu

1265 1270 1275

Gly Lys Lys Leu Asn Leu Val Ile Lys Asn Glu Glu Tyr Phe Glu

1280 1285 1290

Phe Val Gln Asn Arg Asn Met

1295 1300

<210> 4

<211> 7

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: nuclear Localization Sequence (NLS)

<400> 4

Pro Lys Lys Lys Arg Lys Val

1 5

<210> 5

<211> 16

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: nuclear Localization Sequence (NLS)

<400> 5

Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

1 5 10 15

<210> 6

<211> 20

<212> RNA

<213> amino acid coccus (Acidoaerococcus sp.)

<220>

<221> misc_feature

<222> (1)..(20)

<223> amino acid coccus (strain BV3L 6), asCas12 CRISPR repeat sequence

<400> 6

uaauuucuac ucuuguagau 20

<210> 7

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: asCas12 crRNA

<220>

<221> misc_feature

<222> (21)..(40)

<223> n is a, c, g or u

<400> 7

uaauuucuac ucuuguagau nnnnnnnnnn nnnnnnnnnn 40

<210> 8

<211> 21

<212> RNA

<213> Maospiraceae bacteria ND2006 (Lachnospiraceae bacterium ND 2006)

<220>

<221> misc_feature

<222> (1)..(21)

<223> LbacAS12 CRISPR repeat sequence

<400> 8

uaauuucuac uaaguguaga u 21

<210> 9

<211> 41

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: lbacAS12 crRNA

<220>

<221> misc_feature

<222> (22)..(41)

<223> n is a, c, g or u

<400> 9

uaauuucuac uaaguguaga unnnnnnnnn nnnnnnnnnn n 41

<210> 10

<211> 20

<212> RNA

<213> Francisella tularensis (Francisella tularensis)

<220>

<221> misc_feature

<222> (1)..(20)

<223> Francisella subspecies novicola (strain U112), fnocAS12

CRISPR repeat sequence

<400> 10

uaauuucuac uguuguagau 20

<210> 11

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: fnocas12 crRNA

<220>

<221> misc_feature

<222> (21)..(40)

<223> n is a, c, g or u

<400> 11

uaauuucuac uguuguagau nnnnnnnnnn nnnnnnnnnn 40

<210> 12

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt1

<400> 12

tttctctcct ctttcccaca gaat 24

<210> 13

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt2

<400> 13

tttcccacag aatttagcat ggct 24

<210> 14

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt3

<400> 14

tttagcatgg ctcagacagt cact 24

<210> 15

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt4

<400> 15

tttattctgg tacaagcagc ctcc 24

<210> 16

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt5

<400> 16

tttctggaag ttcacagaga aacg 24

<210> 17

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt6

<400> 17

tttctctgtg aacttccaga aagc 24

<210> 18

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt7

<400> 18

tttggctgct ttctggaagt tcac 24

<210> 19

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt8

<400> 19

tttatcaacc tcaccaactc acac 24

<210> 20

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt9

<400> 20

tttgctgtca gtccaagctc catg 24

<210> 21

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt10

<400> 21

tttccaaaga caagaggtgt gttt 24

<210> 22

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt11

<400> 22

tttggaaagg gcacaagact ttct 24

<210> 23

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt12

<400> 23

tttagagtct ctcagctggt acac 24

<210> 24

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt13

<400> 24

tttgagaatc aaaatcggtg aata 24

<210> 25

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt14

<400> 25

tttgtttgag aatcaaaatc ggtg 24

<210> 26

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt15

<400> 26

tttgattctc aaacaaatgt gtca 24

<210> 27

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt16

<400> 27

tttgtgacac atttgtttga gaat 24

<210> 28

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt17

<400> 28

tttgtctgtg atatacacat caga 24

<210> 29

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt18

<400> 29

tttgttgctc caggccacag cact 24

<210> 30

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt19

<400> 30

tttgcacatg caaagtcaga tttg 24

<210> 31

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt20

<400> 31

tttgcatgtg caaacgcctt caac 24

<210> 32

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt21

<400> 32

tttcctttta gaaagttcct gtga 24

<210> 33

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt22

<400> 33

tttagaaagt tcctgtgatg tcaa 24

<210> 34

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt23

<400> 34

tttctcgacc agcttgacat caca 24

<210> 35

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt24

<400> 35

tttcaaagct tttctcgacc agct 24

<210> 36

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt25

<400> 36

tttacagata cgaacctaaa cttt 24

<210> 37

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt26

<400> 37

tttgaaagtt taggttcgta tctg 24

<210> 38

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt27

<400> 38

tttcaaaacc tgtcagtgat tggg 24

<210> 39

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt28

<400> 39

tttcaggagg aggattcgga accc 24

<210> 40

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt29

<400> 40

tttaatctgc tcatgacgct gcgg 24

<210> 41

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt30

<400> 41

tttggagagg gagaagaggg gcaa 24

<210> 42

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt31

<400> 42

tttcacctcc ttgggggtag gaga 24

<210> 43

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt32

<400> 43

tttatgatta agattgctga agag 24

<210> 44

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt33

<400> 44

tttggcagct cttcagcaat ctta 24

<210> 45

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt34

<400> 45

tttatttttt tttaatagtg ttca 24

<210> 46

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt35

<400> 46

tttatgaaca ctattaaaaa aaaa 24

<210> 47

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt36

<400> 47

tttctttatg aacactatta aaaa 24

<210> 48

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt37

<400> 48

tttaatagtg ttcataaaga aata 24

<210> 49

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt38

<400> 49

tttcccccca cgtcttgaga agaa 24

<210> 50

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> TRAC-tgt39

<400> 50

tttaatgaag gcatcggcag cagg 24

<210> 51

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt1

<400> 51

tttaatataa gtggaggcgt cgcg 24

<210> 52

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt2

<400> 52

tttctggcct ggaggctatc cagc 24

<210> 53

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt3

<400> 53

tttcccgata ttcctcaggt actc 24

<210> 54

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt4

<400> 54

tttactcacg tcatccagca gaga 24

<210> 55

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt5

<400> 55

tttccattct ctgctggatg acgt 24

<210> 56

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt6

<400> 56

tttgactttc cattctctgc tgga 24

<210> 57

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt7

<400> 57

tttcctgaat tgctatgtgt ctgg 24

<210> 58

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt8

<400> 58

tttcatccat ccgacattga agtt 24

<210> 59

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt9

<400> 59

tttcaattct ctctccattc ttca 24

<210> 60

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt10

<400> 60

tttcagcaag gactggtctt tcta 24

<210> 61

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt11

<400> 61

tttctatctc ttgtactaca ctga 24

<210> 62

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt12

<400> 62

tttcagtggg ggtgaattca gtgt 24

<210> 63

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt13

<400> 63

tttgtcacag cccaagatag ttaa 24

<210> 64

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt14

<400> 64

tttctccact gtctttttca taga 24

<210> 65

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt15

<400> 65

tttcatagat cgagacatgt aagc 24

<210> 66

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt16

<400> 66

tttctcaagg tcaaaaactt acct 24

<210> 67

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt17

<400> 67

tttcttttct tttcaggttt gaag 24

<210> 68

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt18

<400> 68

tttcttttca ggtttgaaga tgcc 24

<210> 69

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt19

<400> 69

tttcaggttt gaagatgccg catt 24

<210> 70

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt20

<400> 70

tttgaagatg ccgcatttgg attg 24

<210> 71

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt21

<400> 71

tttggaattc atccaatcca aatg 24

<210> 72

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt22

<400> 72

tttggattgg atgaattcca aatt 24

<210> 73

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt23

<400> 73

tttaatattg atatgcttat acac 24

<210> 74

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt24

<400> 74

tttgtgcata aagtgtaagt gtat 24

<210> 75

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt25

<400> 75

tttatgcaca aaatgtaggg ttat 24

<210> 76

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt26

<400> 76

tttataattc tactttgagt gctg 24

<210> 77

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt27

<400> 77

tttgagtgct gtctccatgt ttga 24

<210> 78

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt28

<400> 78

tttgatgtat ctgagcaggt tgct 24

<210> 79

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt29

<400> 79

tttgaactct tcaatctctt gcac 24

<210> 80

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt30

<400> 80

tttgagtgca agagattgaa gagt 24

<210> 81

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt31

<400> 81

tttacatact ctgcttagaa tttg 24

<210> 82

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt32

<400> 82

tttcccccaa attctaagca gagt 24

<210> 83

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt33

<400> 83

tttctaaatt ttcccccaaa ttct 24

<210> 84

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt34

<400> 84

tttgggggaa aatttagaaa tata 24

<210> 85

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt35

<400> 85

tttagaaata taattgacag gatt 24

<210> 86

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt36

<400> 86

tttccaataa tcctgtcaat tata 24

<210> 87

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt37

<400> 87

tttcattcat tataacaaat ttcc 24

<210> 88

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt38

<400> 88

tttgttataa tgaatgaaac attt 24

<210> 89

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt39

<400> 89

tttgtcatat aagattcata ttta 24

<210> 90

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt40

<400> 90

tttacttctt atacatttga taaa 24

<210> 91

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt41

<400> 91

tttatcaaat gtataagaag taaa 24

<210> 92

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt42

<400> 92

tttgataaag taaggcatgg ttgt 24

<210> 93

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt43

<400> 93

tttatttttg ttccacaagt taaa 24

<210> 94

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt44

<400> 94

tttaacttgt ggaacaaaaa taaa 24

<210> 95

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt45

<400> 95

tttatttaac ttgtggaaca aaaa 24

<210> 96

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt46

<400> 96

tttgttccac aagttaaata aatc 24

<210> 97

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt47

<400> 97

tttatgattt atttaacttg tgga 24

<210> 98

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt48

<400> 98

tttgaaaata aaggggtaat agtg 24

<210> 99

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt49

<400> 99

tttccctgtt tgaaaataaa gggg 24

<210> 100

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt50

<400> 100

tttattttca aacagggaaa cagt 24

<210> 101

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt51

<400> 101

tttcaaacag ggaaacagtc ttca 24

<210> 102

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt52

<400> 102

tttaccaagt ggaacttgaa gact 24

<210> 103

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt53

<400> 103

tttacactgt gagccaaact ctat 24

<210> 104

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt54

<400> 104

tttggctcac agtgtaaagg gcct 24

<210> 105

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt55

<400> 105

tttccagatt aggaatctga tgct 24

<210> 106

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt56

<400> 106

tttgagcatc agattcctaa tctg 24

<210> 107

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt57

<400> 107

tttaacttct ttgagcatca gatt 24

<210> 108

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt58

<400> 108

tttagccagc gttctttcct gcgg 24

<210> 109

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt59

<400> 109

tttcctgcgg gccaggtcat gagg 24

<210> 110

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt60

<400> 110

tttgctccct cttagagtct gcat 24

<210> 111

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt61

<400> 111

tttaatattt tagcaaggaa taga 24

<210> 112

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt62

<400> 112

tttagcaagg aatagatata caat 24

<210> 113

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt63

<400> 113

tttcaggacc ccttcttgga cacc 24

<210> 114

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt64

<400> 114

tttggtgtcc aagaaggggt cctg 24

<210> 115

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt65

<400> 115

tttatagaag ggacttaaat atcc 24

<210> 116

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt66

<400> 116

tttaagtccc ttctataaaa tggt 24

<210> 117

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt67

<400> 117

tttgcatata acctatccac atcc 24

<210> 118

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt68

<400> 118

tttaaagtat acaggaggat gtgg 24

<210> 119

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt69

<400> 119

tttaaatcat ttctagatta cttg 24

<210> 120

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt70

<400> 120

tttctagatt acttgtaata ccta 24

<210> 121

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt71

<400> 121

tttacattgt attaggtatt acaa 24

<210> 122

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt72

<400> 122

tttgcatagc atttacattg tatt 24

<210> 123

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt73

<400> 123

tttcttgtca ttattcctta aaca 24

<210> 124

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt74

<400> 124

tttaaggaat aatgacaaga aaaa 24

<210> 125

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt75

<400> 125

tttactgagc atgtacagac tttt 24

<210> 126

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt76

<400> 126

tttccccagt gtttttgatc catg 24

<210> 127

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt77

<400> 127

tttgatccat ggtttgctga atcc 24

<210> 128

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt78

<400> 128

tttgctgaat ccacagatgt ggag 24

<210> 129

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt79

<400> 129

tttgtcattc aaagtacagc gggc 24

<210> 130

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt80

<400> 130

tttgaatgac aaataacaga ttta 24

<210> 131

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt81

<400> 131

tttaaatctg ttatttgtca ttca 24

<210> 132

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt82

<400> 132

tttaaaattt tcaaggcata gttt 24

<210> 133

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> B2M-tgt83

<400> 133

tttcaaggca tagttttata cctg 24

<210> 134

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt1

<400> 134

tttaattata attataatat aata 24

<210> 135

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt2

<400> 135

tttaaagggg ttggccgggc tccc 24

<210> 136

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt3

<400> 136

tttaaataat ttcaggaatg ggtt 24

<210> 137

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt4

<400> 137

tttcaggaat gggttccaag gaga 24

<210> 138

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt5

<400> 138

tttcaggccc agccagcact ctgg 24

<210> 139

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt6

<400> 139

tttgtggggc agggaagctg aggc 24

<210> 140

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt7

<400> 140

tttacacatg cccaggcagc acct 24

<210> 141

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt8

<400> 141

tttcctgccc tgcccaccac agcc 24

<210> 142

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt9

<400> 142

tttcagggaa ggtcagaaga gctc 24

<210> 143

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt10

<400> 143

tttcgggatg ccactgccag gggc 24

<210> 144

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt11

<400> 144

tttcctcagg agaagcaggc aggg 24

<210> 145

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt12

<400> 145

tttcctagcg gaatgggcac ctca 24

<210> 146

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt13

<400> 146

tttccagtgg cgagagaaga cccc 24

<210> 147

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt14

<400> 147

tttctcctca aagaaggagg accc 24

<210> 148

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt15

<400> 148

tttctctgca gggacaatag gagc 24

<210> 149

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt16

<400> 149

tttggaactg gccggctggc ctgg 24

<210> 150

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt17

<400> 150

tttgtgccct tccagagaga aggg 24

<210> 151

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt18

<400> 151

tttgatctgc gccttggggg ccag 24

<210> 152

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt19

<400> 152

tttagcacga agctctccga tgtg 24

<210> 153

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt20

<400> 153

tttcccttcc gctcacctcc gcct 24

<210> 154

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt21

<400> 154

cttactgcct cagcttccct gccc 24

<210> 155

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> PDCD1-tgt22

<400> 155

cttagcatgc tctcatattt aatt 24

<210> 156

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt1

<400> 156

tttaccctag gtgagcaccc cctt 24

<210> 157

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt2

<400> 157

tttgttccct gacacccaac agta 24

<210> 158

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt3

<400> 158

tttagactgc tgcgctccaa agcg 24

<210> 159

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt4

<400> 159

tttggagcgc agcagtctaa aact 24

<210> 160

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt5

<400> 160

tttgtacgca gaagcagtgc ccgc 24

<210> 161

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt6

<400> 161

tttaggtgta cagcagtggc tggt 24

<210> 162

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt7

<400> 162

tttccggatg tggtcagcct tgtg 24

<210> 163

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt8

<400> 163

tttcactgac agcgtgaaca ggta 24

<210> 164

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt9

<400> 164

tttggctcac tctctgtctg ggct 24

<210> 165

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CISH-tgt10

<400> 165

tttgctggct gtggagcgga ctgg 24

<210> 166

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt1

<400> 166

tttctgccat tcattgagtt tgcc 24

<210> 167

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt2

<400> 167

tttcctcctc gaccaccagg gttt 24

<210> 168

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt3

<400> 168

tttcggggat ttcctcctcg acca 24

<210> 169

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt4

<400> 169

tttgggtatt attgatgcta ttca 24

<210> 170

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt5

<400> 170

tttgggattt tggcacagtc ttac 24

<210> 171

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt6

<400> 171

tttgcctgat acatatcagc attt 24

<210> 172

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt7

<400> 172

tttaaagtac tcattctcac tgag 24

<210> 173

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt8

<400> 173

tttgactttt tcataaggct atca 24

<210> 174

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt9

<400> 174

tttaaagagt cttattgccc gttt 24

<210> 175

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt10

<400> 175

tttcttagct gtgacacatc cagg 24

<210> 176

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt11

<400> 176

tttctgtagt cgtgctttaa cttc 24

<210> 177

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt12

<400> 177

tttggtgcta tatttctgta gtcg 24

<210> 178

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt13

<400> 178

tttcacaata taattcatat tgtt 24

<210> 179

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt14

<400> 179

tttgtcattc tctgcacaaa tctt 24

<210> 180

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt15

<400> 180

tttcagctct gtaagatttg tgca 24

<210> 181

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt16

<400> 181

tttgtgcaga gaatgacaaa gatg 24

<210> 182

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt17

<400> 182

tttgatgtgc acctcttgcc ttac 24

<210> 183

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt17

<400> 183

tttgatgtgc acctcttgcc ttac 24

<210> 184

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt17

<400> 184

tttgatgtgc acctcttgcc ttac 24

<210> 185

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt20

<400> 185

tttctgtcgt tgtgaaataa aagg 24

<210> 186

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt21

<400> 186

tttcaggtgg cggtggagga ggat 24

<210> 187

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt22

<400> 187

tttccacatg atggatgtgt ctac 24

<210> 188

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt23

<400> 188

tttgggacta atcagcttgt ggga 24

<210> 189

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> CBLB-tgt24

<400> 189

tttgaactcg ctgtgattcc aggt 24

<210> 190

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: crRNA (ribonucleic acid)

<220>

<221> misc_feature

<222> (1)..(20)

<223> n is a, c, g or u

<400> 190

nnnnnnnnnn nnnnnnnnnn 20

<210> 191

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d1

<220>

<221> misc_feature

<222> (1)..(1)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (2)..(20)

<223> n is RNA and is a, c, g or u

<400> 191

nnnnnnnnnn nnnnnnnnnn 20

<210> 192

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d2

<220>

<221> misc_feature

<222> (1)..(1)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (2)..(2)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (3)..(20)

<223> n is RNA and is a, c, g or u

<400> 192

nnnnnnnnnn nnnnnnnnnn 20

<210> 193

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d3

<220>

<221> misc_feature

<222> (1)..(2)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (3)..(3)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (4)..(20)

<223> n is RNA and is a, c, g or u

<400> 193

nnnnnnnnnn nnnnnnnnnn 20

<210> 194

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d4

<220>

<221> misc_feature

<222> (1)..(3)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (4)..(4)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (5)..(20)

<223> n is RNA and is a, c, g or u

<400> 194

nnnnnnnnnn nnnnnnnnnn 20

<210> 195

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d5

<220>

<221> misc_feature

<222> (1)..(4)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (6)..(20)

<223> n is RNA and is a, c, g or u

<400> 195

nnnnnnnnnn nnnnnnnnnn 20

<210> 196

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d6

<220>

<221> misc_feature

<222> (1)..(5)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (6)..(6)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (7)..(20)

<223> n is RNA and is a, c, g or u

<400> 196

nnnnnnnnnn nnnnnnnnnn 20

<210> 197

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d7

<220>

<221> misc_feature

<222> (1)..(6)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (7)..(7)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (8)..(20)

<223> n is RNA and is a, c, g or u

<400> 197

nnnnnnnnnn nnnnnnnnnn 20

<210> 198

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d8

<220>

<221> misc_feature

<222> (1)..(7)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (8)..(8)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (9)..(20)

<223> n is RNA and is a, c, g or u

<400> 198

nnnnnnnnnn nnnnnnnnnn 20

<210> 199

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d9

<220>

<221> misc_feature

<222> (1)..(8)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (10)..(20)

<223> n is RNA and is a, c, g or u

<400> 199

nnnnnnnnnn nnnnnnnnnn 20

<210> 200

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d10

<220>

<221> misc_feature

<222> (1)..(9)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (11)..(20)

<223> n is RNA and is a, c, g or u

<400> 200

nnnnnnnnnn nnnnnnnnnn 20

<210> 201

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d11

<220>

<221> misc_feature

<222> (1)..(10)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (11)..(11)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (12)..(20)

<223> n is RNA and is a, c, g or u

<400> 201

nnnnnnnnnn nnnnnnnnnn 20

<210> 202

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d12

<220>

<221> misc_feature

<222> (1)..(11)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (12)..(12)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (13)..(20)

<223> n is RNA and is a, c, g or u

<400> 202

nnnnnnnnnn nnnnnnnnnn 20

<210> 203

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d13

<220>

<221> misc_feature

<222> (1)..(12)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (13)..(13)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (14)..(20)

<223> n is RNA and is a, c, g or u

<400> 203

nnnnnnnnnn nnnnnnnnnn 20

<210> 204

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d14

<220>

<221> misc_feature

<222> (1)..(13)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (14)..(14)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (15)..(20)

<223> n is RNA and is a, c, g or u

<400> 204

nnnnnnnnnn nnnnnnnnnn 20

<210> 205

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d15

<220>

<221> misc_feature

<222> (1)..(14)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (15)..(15)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (16)..(20)

<223> n is RNA and is a, c, g or u

<400> 205

nnnnnnnnnn nnnnnnnnnn 20

<210> 206

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d16

<220>

<221> misc_feature

<222> (1)..(15)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (16)..(16)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (17)..(20)

<223> n is RNA and is a, c, g or u

<400> 206

nnnnnnnnnn nnnnnnnnnn 20

<210> 207

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d17

<220>

<221> misc_feature

<222> (1)..(16)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (17)..(17)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (18)..(20)

<223> n is RNA and is a, c, g or u

<400> 207

nnnnnnnnnn nnnnnnnnnn 20

<210> 208

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d18

<220>

<221> misc_feature

<222> (1)..(17)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (18)..(18)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (19)..(20)

<223> n is RNA and is a, c, g or u

<400> 208

nnnnnnnnnn nnnnnnnnnn 20

<210> 209

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d19

<220>

<221> misc_feature

<222> (1)..(18)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (19)..(19)

<223> n is DNA and is a, c, g or t

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is RNA and is a, c, g or u

<400> 209

nnnnnnnnnn nnnnnnnnnn 20

<210> 210

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA d20

<220>

<221> misc_feature

<222> (1)..(19)

<223> n is RNA and is a, c, g or u

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is DNA and is a, c, g or t

<400> 210

nnnnnnnnnn nnnnnnnnnn 20

<210> 211

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_cr

<400> 211

agugggggug aauucagugu 20

<210> 212

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d1

<400> 212

agugggggug aauucagugu 20

<210> 213

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d2

<400> 213

agugggggug aauucagugu 20

<210> 214

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d3

<400> 214

agtgggggug aauucagugu 20

<210> 215

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d4

<400> 215

agugggggug aauucagugu 20

<210> 216

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d5

<400> 216

agugggggug aauucagugu 20

<210> 217

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d6

<400> 217

agugggggug aauucagugu 20

<210> 218

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d7

<400> 218

agugggggug aauucagugu 20

<210> 219

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d8

<400> 219

agugggggug aauucagugu 20

<210> 220

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d9

<400> 220

agugggggtg aauucagugu 20

<210> 221

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d10

<400> 221

agugggggug aauucagugu 20

<210> 222

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d11

<400> 222

agugggggug aauucagugu 20

<210> 223

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d12

<400> 223

agugggggug aauucagugu 20

<210> 224

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d13

<400> 224

agugggggug aatucagugu 20

<210> 225

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d14

<400> 225

agugggggug aautcagugu 20

<210> 226

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d15

<400> 226

agugggggug aauucagugu 20

<210> 227

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d16

<400> 227

agugggggug aauucagugu 20

<210> 228

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d17

<400> 228

agugggggug aauucagugu 20

<210> 229

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d18

<400> 229

agugggggug aauucagtgu 20

<210> 230

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d19

<400> 230

agugggggug aauucagugu 20

<210> 231

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d20

<400> 231

agugggggug aauucagugt 20

<210> 232

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_cr

<400> 232

gagucucuca gcugguacac 20

<210> 233

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d1

<400> 233

gagucucuca gcugguacac 20

<210> 234

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d2

<400> 234

gagucucuca gcugguacac 20

<210> 235

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d3

<400> 235

gagucucuca gcugguacac 20

<210> 236

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: TR.t12_d4

<400> 236

gagtcucuca gcugguacac 20

<210> 237

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d5

<400> 237

gagucucuca gcugguacac 20

<210> 238

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: TR.t12_d6

<400> 238

gaguctcuca gcugguacac 20

<210> 239

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d7

<400> 239

gagucucuca gcugguacac 20

<210> 240

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: TR.t12_d8

<400> 240

gagucuctca gcugguacac 20

<210> 241

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d9

<400> 241

gagucucuca gcugguacac 20

<210> 242

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d10

<400> 242

gagucucuca gcugguacac 20

<210> 243

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d11

<400> 243

gagucucuca gcugguacac 20

<210> 244

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d12

<400> 244

gagucucuca gcugguacac 20

<210> 245

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: TR.t12_d13

<400> 245

gagucucuca gctgguacac 20

<210> 246

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d14

<400> 246

gagucucuca gcugguacac 20

<210> 247

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d15

<400> 247

gagucucuca gcugguacac 20

<210> 248

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: TR.t12_d16

<400> 248

gagucucuca gcuggtacac 20

<210> 249

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d17

<400> 249

gagucucuca gcugguacac 20

<210> 250

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d18

<400> 250

gagucucuca gcugguacac 20

<210> 251

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d19

<400> 251

gagucucuca gcugguacac 20

<210> 252

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d20

<400> 252

gagucucuca gcugguacac 20

<210> 253

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr

<400> 253

cugauggucc augucuguua 20

<210> 254

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d1

<400> 254

cugauggucc augucuguua 20

<210> 255

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d2

<400> 255

ctgauggucc augucuguua 20

<210> 256

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d3

<400> 256

cugauggucc augucuguua 20

<210> 257

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d4

<400> 257

cugauggucc augucuguua 20

<210> 258

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d5

<400> 258

cugatggucc augucuguua 20

<210> 259

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d6

<400> 259

cugauggucc augucuguua 20

<210> 260

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d7

<400> 260

cugauggucc augucuguua 20

<210> 261

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d8

<400> 261

cugauggtcc augucuguua 20

<210> 262

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d9

<400> 262

cugauggucc augucuguua 20

<210> 263

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d10

<400> 263

cugauggucc augucuguua 20

<210> 264

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d11

<400> 264

cugauggucc augucuguua 20

<210> 265

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d12

<400> 265

cugauggucc atgucuguua 20

<210> 266

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d13

<400> 266

cugauggucc augucuguua 20

<210> 267

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d14

<400> 267

cugauggucc augtcuguua 20

<210> 268

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d15

<400> 268

cugauggucc augucuguua 20

<210> 269

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d16

<400> 269

cugauggucc auguctguua 20

<210> 270

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d17

<400> 270

cugauggucc augucuguua 20

<210> 271

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d18

<400> 271

cugauggucc augucugtua 20

<210> 272

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d19

<400> 272

cugauggucc augucuguta 20

<210> 273

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d20

<400> 273

cugauggucc augucuguua 20

<210> 274

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _crRNA

<400> 274

auauaagugg aggcgucgcg 20

<210> 275

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d1

<400> 275

auauaagugg aggcgucgcg 20

<210> 276

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM_tgt1_act.3' _d2

<400> 276

atauaagugg aggcgucgcg 20

<210> 277

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d3

<400> 277

auauaagugg aggcgucgcg 20

<210> 278

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM_tgt1_act.3' _d4

<400> 278

auataagugg aggcgucgcg 20

<210> 279

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d5

<400> 279

auauaagugg aggcgucgcg 20

<210> 280

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _ d.6

<400> 280

auauaagugg aggcgucgcg 20

<210> 281

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _ d.7

<400> 281

auauaagugg aggcgucgcg 20

<210> 282

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM_tgt1_act.3' _ d.8

<400> 282

auauaagtgg aggcgucgcg 20

<210> 283

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _ d.9

<400> 283

auauaagugg aggcgucgcg 20

<210> 284

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d10

<400> 284

auauaagugg aggcgucgcg 20

<210> 285

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d11

<400> 285

auauaagugg aggcgucgcg 20

<210> 286

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: bm_tgt1_act.3' _d12

<400> 286

auauaagugg aggcgucgcg 20

<210> 287

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d13

<400> 287

auauaagugg aggcgucgcg 20

<210> 288

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d14

<400> 288

auauaagugg aggcgucgcg 20

<210> 289

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d15

<400> 289

auauaagugg aggcgucgcg 20

<210> 290

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM_tgt1_act.3' _d.16

<400> 290

auauaagugg aggcgtcgcg 20

<210> 291

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d17

<400> 291

auauaagugg aggcgucgcg 20

<210> 292

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d18

<400> 292

auauaagugg aggcgucgcg 20

<210> 293

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d19

<400> 293

auauaagugg aggcgucgcg 20

<210> 294

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _d20

<400> 294

auauaagugg aggcgucgcg 20

<210> 295

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_act.3' _crRNA

<400> 295

ucuggaggcu cucaaggacu 20

<210> 296

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.in_t12_cr-3' _d.1

<400> 296

tcuggaggcu cucaaggacu 20

<210> 297

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d2

<400> 297

ucuggaggcu cucaaggacu 20

<210> 298

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, BM.in_t12_cr-3' _d3

<400> 298

uctggaggcu cucaaggacu 20

<210> 299

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d4

<400> 299

ucuggaggcu cucaaggacu 20

<210> 300

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d5

<400> 300

ucuggaggcu cucaaggacu 20

<210> 301

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _ d.6

<400> 301

ucuggaggcu cucaaggacu 20

<210> 302

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _ d.7

<400> 302

ucuggaggcu cucaaggacu 20

<210> 303

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _ d.8

<400> 303

ucuggaggcu cucaaggacu 20

<210> 304

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _ d.9

<400> 304

ucuggaggcu cucaaggacu 20

<210> 305

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, BM.in_t12_cr-3' _d.10

<400> 305

ucuggaggct cucaaggacu 20

<210> 306

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d11

<400> 306

ucuggaggcu cucaaggacu 20

<210> 307

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.in_t12_cr-3' _d12

<400> 307

ucuggaggcu ctcaaggacu 20

<210> 308

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d13

<400> 308

ucuggaggcu cucaaggacu 20

<210> 309

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d.14

<400> 309

ucuggaggcu cucaaggacu 20

<210> 310

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d15

<400> 310

ucuggaggcu cucaaggacu 20

<210> 311

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d16

<400> 311

ucuggaggcu cucaaggacu 20

<210> 312

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d17

<400> 312

ucuggaggcu cucaaggacu 20

<210> 313

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d18

<400> 313

ucuggaggcu cucaaggacu 20

<210> 314

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3' _d19

<400> 314

ucuggaggcu cucaaggacu 20

<210> 315

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, BM.in_t12_cr-3' _d20

<400> 315

ucuggaggcu cucaaggact 20

<210> 316

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_cr

<400> 316

gagucucuca gcugguacac 20

<210> 317

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d20.19

<400> 317

gagucucuca gcugguacac 20

<210> 318

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d20.17

<400> 318

gagucucuca gcugguacac 20

<210> 319

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d19.15

<400> 319

gagucucuca gcugguacac 20

<210> 320

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d11.10

<400> 320

gagucucuca gcugguacac 20

<210> 321

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d20.11.1

<400> 321

gagucucuca gcugguacac 20

<210> 322

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d17.11

<400> 322

gagucucuca gcugguacac 20

<210> 323

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d2.1

<400> 323

gagucucuca gcugguacac 20

<210> 324

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d15.10.11

<400> 324

gagucucuca gcugguacac 20

<210> 325

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d20.17.10.1

<400> 325

gagucucuca gcugguacac 20

<210> 326

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d18.15.2

<400> 326

gagucucuca gcugguacac 20

<210> 327

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d19.15.11.10.3

<400> 327

gagucucuca gcugguacac 20

<210> 328

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d20.17.15.10.1

<400> 328

gagucucuca gcugguacac 20

<210> 329

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr.t12_d_7

<400> 329

gagucucuca gcugguacac 20

<210> 330

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_act.3' _crRNA

<400> 330

auauaagugg aggcgucgcg 20

<210> 331

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d20.17

<400> 331

agugggggug aauucagugt 20

<210> 332

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d15.11

<400> 332

agugggggug aauucagugu 20

<210> 333

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d15.14

<400> 333

agugggggug aautcagugu 20

<210> 334

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d11.10

<400> 334

agugggggug aauucagugu 20

<210> 335

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, BM.t12_d20.11.1

<400> 335

agugggggug aauucagugt 20

<210> 336

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d17.11

<400> 336

agugggggug aauucagugu 20

<210> 337

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.t12_d2.1

<400> 337

agugggggug aauucagugu 20

<210> 338

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, BM.t12_d20.17.15.2

<400> 338

agugggggug aauucagugt 20

<210> 339

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, BM.t12_d15.14.11.10

<400> 339

agugggggug aautcagugu 20

<210> 340

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d_6a

<400> 340

agugggggug aauucagugt 20

<210> 341

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d_8

<400> 341

agtgggggtg aautcagugu 20

<210> 342

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d_6b

<400> 342

agugggggug aatucagugu 20

<210> 343

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.t12_d16.9.1-3

<400> 343

agtgggggtg aauucagugu 20

<210> 344

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: BM.t12_d_10

<400> 344

agugggggug aattcagtgt 20

<210> 345

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_cr-3'

<400> 345

auauaagugg aggcgucgcg 20

<210> 346

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_cr-3' _d20.11.1

<400> 346

auauaagugg aggcgucgcg 20

<210> 347

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM_tgt1_cr-3' _d.19.14.8

<400> 347

auauaagtgg aggcgucgcg 20

<210> 348

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM_tgt1_cr-3' _d.19.17.14.8

<400> 348

auauaagtgg aggcgucgcg 20

<210> 349

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_cr-3' _d.12.11.8

<400> 349

auauaagugg aggcgucgcg 20

<210> 350

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM_tgt1_cr-3' _d.18.16.10

<400> 350

auauaagugg aggcgtcgcg 20

<210> 351

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM_tgt1_cr-3' _d.19.17.15.1

<400> 351

auauaagugg aggcgucgcg 20

<210> 352

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM_tgt1_cr-3' _d.19-16

<400> 352

auauaagugg aggcgtcgcg 20

<210> 353

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BM.in_t12_cr-3'

<400> 353

ucuggaggcu cucaaggacu 20

<210> 354

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.in_t12_cr-3' _d.01.11.20

<400> 354

tcuggaggcu cucaaggact 20

<210> 355

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.in_t12_cr-3' _d.11.17.20

<400> 355

ucuggaggcu cucaaggact 20

<210> 356

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.in_t12_cr-3' _d.08.09.10.11

<400> 356

ucuggaggct cucaaggacu 20

<210> 357

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.in_t12_cr-3' _d.01.08.10.17

<400> 357

tcuggaggct cucaaggacu 20

<210> 358

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.in_t12_cr-3' _d.17.19.20

<400> 358

ucuggaggcu cucaaggact 20

<210> 359

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.in_t12_cr-3' _d.08.09.19.20

<400> 359

ucuggaggcu cucaaggact 20

<210> 360

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA BM.in_t12_cr-3' _d01.10.11.17.19.20

<400> 360

tcuggaggct cucaaggact 20

<210> 361

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DNMt_crRNA

<400> 361

cugauggucc augucuguua 20

<210> 362

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_d1.20

<400> 362

cugauggucc augucuguua 20

<210> 363

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d14.20

<400> 363

cugauggucc augtcuguua 20

<210> 364

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d8.19

<400> 364

cugauggtcc augucuguta 20

<210> 365

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d8.14

<400> 365

cugauggtcc augtcuguua 20

<210> 366

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d1.8.20

<400> 366

cugauggtcc augucuguua 20

<210> 367

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d8-10

<400> 367

cugauggtcc augucuguua 20

<210> 368

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d8.9.15

<400> 368

cugauggtcc augucuguua 20

<210> 369

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_d1.8.19

<400> 369

cugauggtcc augucuguta 20

<210> 370

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> RPL32_on

<400> 370

tttggggtga tcagacccaa cagc 24

<210> 371

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> RPL_32-off.1

<400> 371

tttggggtga tcagacccaa cacc 24

<210> 372

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> RPL_32-off.2

<400> 372

tttggggtga tcagacccaa cacc 24

<210> 373

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> DNMT1_on

<400> 373

tttcctgatg gtccatgtct gtta 24

<210> 374

<211> 24

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(24)

<223> DNMT1_off-1

<400> 374

tttcctgatg gtccatgtct gaat 24

<210> 375

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: RP_cr

<400> 375

gggugaucag acccaacagc 20

<210> 376

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.1

<400> 376

gggugaucag acccaacagc 20

<210> 377

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.8

<400> 377

gggugaucag acccaacagc 20

<210> 378

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.9

<400> 378

gggugaucag acccaacagc 20

<210> 379

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.10

<400> 379

gggugaucag acccaacagc 20

<210> 380

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.11

<400> 380

gggugaucag acccaacagc 20

<210> 381

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.12

<400> 381

gggugaucag acccaacagc 20

<210> 382

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.14

<400> 382

gggugaucag acccaacagc 20

<210> 383

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.15

<400> 383

gggugaucag acccaacagc 20

<210> 384

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.16

<400> 384

gggugaucag acccaacagc 20

<210> 385

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.17

<400> 385

gggugaucag acccaacagc 20

<210> 386

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.18

<400> 386

gggugaucag acccaacagc 20

<210> 387

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.19

<400> 387

gggugaucag acccaacagc 20

<210> 388

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_2_d.20

<400> 388

gggugaucag acccaacagc 20

<210> 389

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d13

<400> 389

gggugaucag acccaacagc 20

<210> 390

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d11.12

<400> 390

gggugaucag acccaacagc 20

<210> 391

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d12.14

<400> 391

gggugaucag acccaacagc 20

<210> 392

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d14.15

<400> 392

gggugaucag acccaacagc 20

<210> 393

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d11.15

<400> 393

gggugaucag acccaacagc 20

<210> 394

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d11.12.14

<400> 394

gggugaucag acccaacagc 20

<210> 395

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d12.14.15

<400> 395

gggugaucag acccaacagc 20

<210> 396

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d11.14.15

<400> 396

gggugaucag acccaacagc 20

<210> 397

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: rp_cr_3' _d11.12.14.15

<400> 397

gggugaucag acccaacagc 20

<210> 398

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, RP_cr_3' _sp.20

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is an abasic site lacking the 2' -hydroxyl group

<400> 398

gggugaucag acccaacagn t 21

<210> 399

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, RP_cr_3' _d14_sp20

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is an abasic site lacking the 2' -hydroxyl group

<400> 399

gggugaucag acccaacagn t 21

<210> 400

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, RP_cr_3' _d15_sp20

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is an abasic site lacking the 2' -hydroxyl group

<400> 400

gggugaucag acccaacagn t 21

<210> 401

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, RP_cr_3' _d12_sp20

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is an abasic site lacking the 2' -hydroxyl group

<400> 401

gggugaucag acccaacagn t 21

<210> 402

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, RP_cr_3' _d11_s20

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is an abasic site lacking the 2' -hydroxyl group

<400> 402

gggugaucag acccaacagn t 21

<210> 403

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA, RP_cr_3' _d14.15_s20

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is an abasic site lacking the 2' -hydroxyl group

<400> 403

gggugaucag acccaacagn t 21

<210> 404

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DNMT1-crRNA

<400> 404

cugauggucc augucuguua 20

<210> 405

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DNMT1-d1.20

<400> 405

cugauggucc augucuguua 20

<210> 406

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DNMT1-d8.19

<400> 406

cugauggtcc augucuguta 20

<210> 407

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DNMT1-d9

<400> 407

cugauggucc augucuguua 20

<210> 408

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DNMT1-d8.14

<400> 408

cugauggtcc augtcuguua 20

<210> 409

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DNMT1-d10.17

<400> 409

cugauggucc augucuguua 20

<210> 410

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DNMT1-d1.8.20

<400> 410

cugauggtcc augucuguua 20

<210> 411

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DNMT1-d1.8.19

<400> 411

cugauggtcc augucuguta 20

<210> 412

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DNMT1-d8.9.15

<400> 412

cugauggtcc augucuguua 20

<210> 413

<211> 3147

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: anti-BCMA CAR constructs

<400> 413

cataaacctc ccattctgct aatgcccagc ctaagttggg gagaccactc cagattccaa 60

gatgtacagt ttgctttgct gggccttttt cccatgcctg cctttactct gccagagtta 120

tattgctggg gttttgaaga agatcctatt aaataaaaga ataagcagta ttattaagta 180

gccctgcatt tcaggtttcc ttgagtggca ggccaggcct ggccgtgaac gttcactgaa 240

atcatggcct cttggccaag attgatagct tgtgcctgtc cctgagtccc agtccatcac 300

gagcagctgg tttctaagat gctatttccc gtataaagca tgagaccgtg acttgccagc 360

cccacagagc cccgcccttg tccatcactg gcatctggac tccagcctgg gttggggcaa 420

agagggaaat gagatcatgt cctaaccctg atcctcttgt cccacagata tccagaaccc 480

tgaccctgcc gtgtaccagc ttaattaatt agtccataga gcccaccgca tccccagcat 540

gcctgctatt gtcttcccaa tcctccccct tgctgtcctg ccccacccca ccccccagaa 600

tagaatgaca cctactcaga caatgcgatg caatttcctc attttattag gaaaggacag 660

tgggagtggc accttccagg gtcaaggaag gcacggggga ggggcaaaca acagatggct 720

ggcaactaga aggcacagtt attacctcgg tggcagggcc tgcatatgga gggcatcgta 780

tgtatctttc gtggccgtac tcaggccttg gtagagaccg tcgtggcctt tccctctgcg 840

tctctctccc ttcatcccga tctcgctgta agcctccgcc atcttatctt tctgcagttc 900

attataaagc ccctcttgcg ggttttttct cctcggtttt cctcccatct ctgggtccct 960

ccctcggcgc ttatccaata catcatattc ctctcgcctc cccaggttaa gctcattgta 1020

aagttggttt tgcccttgct gataggccgg agcgtcagca gaccggctaa atttcactct 1080

cagttcgcaa ccaccctcct cttcttcggg gaatcggcag ctacatccat cctcctcttg 1140

cgtagtttgg accgggcgca taaatggttg cttaaaaata tacagcaact tttttcttcc 1200

tcttttgcag taaagagtaa taacgaggga cagcagcaag accccgcacg ttccggcaag 1260

cggtgcccag atgtagatgt cgcaagcaaa gtccagcccg cgagtatgaa ccgcgcctcc 1320

cgctgcgggg cgacaagcct ccggccgaag agagagtggc tgggaagcga tagtgggtgc 1380

aggcgtgggt ggccgagggg caggcgtggt tgtggcagcg gctttaattt ccactttggt 1440

gccgccgcca aaggtcggcg gaaagctatg gccgttctgg caataataca ccgcaaaatc 1500

ttccggttcc aggctgctaa tggtcagggt aaaatcggtg ccgctgccgc tgccgctaaa 1560

gcgcgccgga atgccggtaa tgctctggct cgcataataa atcagcaggc gcggcgcctg 1620

gcccggtttc tgctgatacc aatgcagata atcgctaatg ctctggctcg cgcggcagct 1680

cagggtcgcg cgttcgcccg ggctcaggct cagggtcgcc gggctctggg tcagcacaat 1740

ttcgctgccg ccgccgccgc tgccgccgcc gccgctgccg ccgccgccgc tgctcacggt 1800

caccagggtg ccctggcccc acacatcaaa atagccatca tagttatagc gcgcgcaata 1860

atacaccgcg gtatcttcgc tgcgcaggct gctcagttcc atatacgcgg tgctggtgct 1920

tttatccgcg gtaatggtca cgcggccttt aaatttttcg ttatatttgg tcgcatcgtt 1980

atacggaata atatagccca tccattccag gccctggccc ggcgcctggc gcacccaatg 2040

catcacatag ctggtaaagg tatagccgct cgctttgcag ctcactttca cgctgctgcc 2100

cggttttttc acttccgcgc cgctctgcac cagctgcacc tgcggtcttg ccgcgtggag 2160

caggagtgcc aatggaagca gaagtgcggt cacgggcaac gccatggtgg ctatgacgcg 2220

tcgcgccgag tgaggggttg tgggctcttt tattgagctc ggggagcaga agcgcgcgaa 2280

cagaagcgag aagcgaactg attggttagt tcaaataagg cacagggtca tttcaggtcc 2340

ttggggcacc ctggaaacat ctgatggttc tctagaaact gctgagggcg ggaccgcatc 2400

tggggaccat ctgttcttgg ccctgagccg gggcaggaac tgcttaccac agatatcctg 2460

tttggcccat attctgctgt tccaactgtt cttggccctg agccggggca ggaactgctt 2520

accacagata tcctgtttgg cccatattct gctgtctctc tgttcctaac cttgatccta 2580

gcttgccaaa cctacaggtg gggtctttca ttcccccctt tttctggaga ctaaataaag 2640

tttaaactga gagactctaa atccagtgac aagtctgtct gcctattcac cgattttgat 2700

tctcaaacaa atgtgtcaca aagtaaggat tctgatgtgt atatcacaga caaaactgtg 2760

ctagacatga ggtctatgga cttcaagagc aacagtgctg tggcctggag caacaaatct 2820

gactttgcat gtgcaaacgc cttcaacaac agcattattc cagaagacac cttcttcccc 2880

agcccaggta agggcagctt tggtgccttc gcaggctgtt tccttgcttc aggaatggcc 2940

aggttctgcc cagagctctg gtcaatgatg tctaaaactc ctctgattgg tggtctcggc 3000

cttatccatt gccaccaaaa ccctcttttt actaagaaac agtgagcctt gttctggcag 3060

tccagagaat gacacgggaa aaaagcagat gaagagaagg tggcaggaga gggcacgtgg 3120

cccagcctca gtctctccaa ctgagtt 3147

<210> 414

<211> 2911

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: b2MHLA-e constructs

<400> 414

tgagtgctga gagggcatca gaagtccttg agagcctcca gagaaaggct cttaaaaatg 60

cagcgcaatc tccagtgaca gaagatactg ctagaaatct gctagaaaaa aaacaaaaaa 120

ggcatgtata gaggaattat gagggaaaga taccaagtca cggtttattc ttcaaaatgg 180

aggtggcttg ttgggaaggt ggaagctcat ttggccagag tggaaatgga attgggagaa 240

atcgatgacc aaatgtaaac acttggtgcc tgatatagct tgacaccaag ttagccccaa 300

gtgaaatacc ctggcaatat taatgtgtct tttcccgata ttcctcaggt actccaaaga 360

ttcaggttta ctcacgtcat ccagcagaga atggaaagtc aaatttcctg aattgctatg 420

tgtctgggtt tcatccatcc gacattgaag ttgacttact gaagaatgga gagagaattg 480

aaaaagtgga gcattcagac ttgtctttca gcaaggactg gtctttctat ctcttgtact 540

acactgaatt tggttctgga gcaaccaact tctccttgct gaaacaggcc ggtgacgtgg 600

aggagaatcc cggccctatg agcagaagtg tcgccttagc tgtgctcgcg ctactctctc 660

tttctggcct ggaggctgta atggcaccac ggaccctctt tctgggtgga ggtgggagcg 720

gaggaggcgg tagcggaggc ggcggctcca tccagcgtac tccaaagatt caggtttact 780

cacgtcatcc agcagagaat ggaaagtcaa atttcctgaa ttgctatgtg tctgggtttc 840

atccatccga cattgaagtt gacttactga agaatggaga gagaattgaa aaagtggagc 900

attcagactt gtctttcagc aaggactggt ctttctatct cttgtactat acagagttta 960

cacctacgga gaaagatgag tatgcctgcc gtgtgaacca tgtgactttg tcacagccca 1020

agatcgtgaa atgggatcga gacatgggtg gcggagggtc tggcggaggc ggttctggag 1080

gagggggatc tggtggcgga gggtctggat cccactcctt gaagtatttc cacacttccg 1140

tgtcccggcc cggccgcggg gagccccgct tcatctctgt gggctacgtg gacgacaccc 1200

agttcgtgcg cttcgacaac gacgccgcga gtccgaggat ggtgccgcgg gcgccgtgga 1260

tggagcagga ggggtcagag tattgggacc gggagacacg gagcgccagg gacaccgcac 1320

agattttccg agtgaatctg cggacgctgc gcggctacta caatcagagc gaggccgggt 1380

ctcacaccct gcagtggatg catggctgcg agctggggcc cgacgggcgc ttcctccgcg 1440

ggtatgaaca gttcgcctac gacggcaagg attatctcac cctgaatgag gacctgcgct 1500

cctggaccgc ggtggacacg gcggctcaga tctccgagca aaagtcaaat gatgcttctg 1560

aggcggagca ccagagagcc tacctggaag acacatgcgt ggagtggctc cacaaatacc 1620

tggagaaggg gaaggagacg ctgcttcacc tggagccccc aaagacacac gtgactcacc 1680

accccatctc tgaccatgag gccaccctga ggtgctgggc cctgggcttc taccctgcgg 1740

agatcacact gacctggcag caggatgggg agggccatac ccaggacacg gagctcgtgg 1800

agaccaggcc tgcaggggat ggaaccttcc agaagtgggc agctgtggtg gtgccttctg 1860

gagaggagca gagatacacg tgccatgtgc agcatgaggg gctacccgag cccgtcaccc 1920

tgagatggaa gccggcttcc cagcccacca tccccatcgt gggcatcatt gctggcctgg 1980

ttctccttgg atctgtggtc tctggagctg tggttgctgc tgtgatatgg aggaagaaga 2040

gctcaggtgg aaaaggaggg agctactcta aggctgagtg gagcgacagt gcccaggggt 2100

ctgagtctca cagcttgtaa taactgtgcc ttctagttgc cagccatctg ttgtttgccc 2160

ctcccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa 2220

tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg 2280

gcaggacagc aagggggagg attgggaaga caatagcagg catgctgggg atgcggtggg 2340

ctctatggac taattaatta acacccccac tgaaaaagat gagtatgcct gccgtgtgaa 2400

ccatgtgact ttgtcacagc ccaagatagt taagtggggt aagtcttaca ttcttttgta 2460

agctgctgaa agttgtgtat gagtagtcat atcataaagc tgctttgata taaaaaaggt 2520

ctatggccat actaccctga atgagtccca tcccatctga tataaacaat ctgcatattg 2580

ggattgtcag ggaatgttct taaagatcag attagtggca cctgctgaga tactgatgca 2640

cagcatggtt tctgaaccag tagtttccct gcagttgagc agggagcagc agcagcactt 2700

gcacaaatac atatacactc ttaacacttc ttacctactg gcttcctcta gcttttgtgg 2760

cagcttcagg tatatttagc actgaacgaa catctcaaga aggtataggc ctttgtttgt 2820

aagtcctgct gtcctagcat cctataatcc tggacttctc cagtactttc tggctggatt 2880

ggtatctgag gctagtagga agggcttgtt c 2911

<210> 415

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TRAC_cr3' _tgtgt.12-d 20.11.1

<400> 415

taauuucuac ucutguagau gagucucuca gcugguacac 40

<210> 416

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA B2M_cr3' _tgtgt.12-d20.11.1

<400> 416

taauuucuac ucutguagau agugggggug aauucagugt 40

<210> 417

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: crRNA (ribonucleic acid)

<400> 417

uaauuucuac ucuuguagau 20

<210> 418

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d1

<400> 418

taauuucuac ucuuguagau 20

<210> 419

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d2

<400> 419

uaauuucuac ucuuguagau 20

<210> 420

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d3

<400> 420

uaauuucuac ucuuguagau 20

<210> 421

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d4

<400> 421

uaatuucuac ucuuguagau 20

<210> 422

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d5

<400> 422

uaautucuac ucuuguagau 20

<210> 423

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d6

<400> 423

uaauutcuac ucuuguagau 20

<210> 424

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d7

<400> 424

uaauuucuac ucuuguagau 20

<210> 425

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d8

<400> 425

uaauuuctac ucuuguagau 20

<210> 426

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d9

<400> 426

uaauuucuac ucuuguagau 20

<210> 427

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d10

<400> 427

uaauuucuac ucuuguagau 20

<210> 428

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d11

<400> 428

uaauuucuac tcuuguagau 20

<210> 429

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d12

<400> 429

uaauuucuac ucuuguagau 20

<210> 430

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d13

<400> 430

uaauuucuac uctuguagau 20

<210> 431

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d14

<400> 431

uaauuucuac ucutguagau 20

<210> 432

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d15

<400> 432

uaauuucuac ucuuguagau 20

<210> 433

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d16

<400> 433

uaauuucuac ucuugtagau 20

<210> 434

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d17

<400> 434

uaauuucuac ucuuguagau 20

<210> 435

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d18

<400> 435

uaauuucuac ucuuguagau 20

<210> 436

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CRISPR-d19

<400> 436

uaauuucuac ucuuguagau 20

<210> 437

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISPR-d20

<400> 437

uaauuucuac ucuuguagat 20

<210> 438

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_crRNA

<400> 438

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 439

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d1

<400> 439

taauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 440

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d2

<400> 440

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 441

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d3

<400> 441

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 442

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d4

<400> 442

uaatuucuac ucuuguagau cugauggucc augucuguua 40

<210> 443

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d5

<400> 443

uaautucuac ucuuguagau cugauggucc augucuguua 40

<210> 444

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d6

<400> 444

uaauutcuac ucuuguagau cugauggucc augucuguua 40

<210> 445

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d7

<400> 445

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 446

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d8

<400> 446

uaauuuctac ucuuguagau cugauggucc augucuguua 40

<210> 447

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d9

<400> 447

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 448

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d10

<400> 448

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 449

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d11

<400> 449

uaauuucuac tcuuguagau cugauggucc augucuguua 40

<210> 450

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d12

<400> 450

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 451

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d13

<400> 451

uaauuucuac uctuguagau cugauggucc augucuguua 40

<210> 452

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d14

<400> 452

uaauuucuac ucutguagau cugauggucc augucuguua 40

<210> 453

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d15

<400> 453

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 454

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d16

<400> 454

uaauuucuac ucuugtagau cugauggucc augucuguua 40

<210> 455

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d17

<400> 455

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 456

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d18

<400> 456

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 457

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: DMT.t3_cr-d19

<400> 457

uaauuucuac ucuuguagau cugauggucc augucuguua 40

<210> 458

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA DMT.t3_cr-d20

<400> 458

uaauuucuac ucuuguagat cugauggucc augucuguua 40

<210> 459

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISRP-3'

<400> 459

taauuucuac ucutguagau 20

<210> 460

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISRP-2

<400> 460

taauuucuac ucuugtagau 20

<210> 461

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISRP-6

<400> 461

taauuucuac uctugtagau 20

<210> 462

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISRP-401

<400> 462

uaauuucuac ucutguagau 20

<210> 463

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISRP-402

<400> 463

taauuucuac ucutgtagau 20

<210> 464

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISRP-403

<400> 464

uaauuucuac ucutguagau 20

<210> 465

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CRISRP-404

<400> 465

taauuucuac ucutguagau 20

<210> 466

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: tr_cr_tgt.12-d20.11.1

<400> 466

uaauuucuac ucuuguagau gagucucuca gcugguacac 40

<210> 467

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TR_cr3' _tgtgt.12-d 20.11.1

<400> 467

taauuucuac ucutguagau gagucucuca gcugguacac 40

<210> 468

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TR_cr-2_tgt.12-d20.11.1

<400> 468

taauuucuac ucuugtagau gagucucuca gcugguacac 40

<210> 469

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TR_cr-6_tgt.12-d20.11.1

<400> 469

taauuucuac uctugtagau gagucucuca gcugguacac 40

<210> 470

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TR_cr-401_tgt.12-d20.11.1

<400> 470

uaauuucuac ucutguagau gagucucuca gcugguacac 40

<210> 471

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TR_cr-403_tgt.12-d20.11.1

<400> 471

taauuucuac ucutgtagau gagucucuca gcugguacac 40

<210> 472

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TR_cr-404_tgt.12-d20.11.1

<400> 472

uaauuucuac ucutguagau gagucucuca gcugguacac 40

<210> 473

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TR_cr-405_tgt.12-d20.11.1

<400> 473

taauuucuac ucutguagau gagucucuca gcugguacac 40

<210> 474

<211> 117

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BCMA scFv chain 1

<400> 474

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Val Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Tyr Ile Ile Pro Tyr Asn Asp Ala Thr Lys Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Asn Tyr Asp Gly Tyr Phe Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser

115

<210> 475

<211> 107

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BCMA scFv chain 2

<400> 475

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Ser Asp Tyr

20 25 30

Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Tyr Ala Ser Gln Ser Ile Thr Gly Ile Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Asn Gly His Ser Phe Pro Pro

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210> 476

<211> 15

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BCMA scFv linker

<400> 476

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 477

<211> 240

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: BCMA scFv

<400> 477

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Val Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Tyr Ile Ile Pro Tyr Asn Asp Ala Thr Lys Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Tyr Asn Tyr Asp Gly Tyr Phe Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu

130 135 140

Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln

145 150 155 160

Ser Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala

165 170 175

Pro Arg Leu Leu Ile Tyr Tyr Ala Ser Gln Ser Ile Thr Gly Ile Pro

180 185 190

Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

195 200 205

Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Asn Gly

210 215 220

His Ser Phe Pro Pro Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

225 230 235 240

<210> 478

<211> 63

<212> DNA

<213> Homo sapiens (Homo sapiens)

<220>

<221> misc_feature

<222> (1)..(63)

<223> CD 8-alpha Signal sequence

<400> 478

atggcgttgc ccgtgaccgc acttctgctt ccattggcac tcctgctcca cgcggcaaga 60

ccg 63

<210> 479

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: GS_SV40-NLS

<400> 479

Gly Ser Pro Lys Lys Lys Arg Lys Val

1 5

<210> 480

<211> 18

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: GS_S40-NLS_GS_S40-NLS

<400> 480

Gly Ser Pro Lys Lys Lys Arg Lys Val Gly Ser Pro Lys Lys Lys Arg

1 5 10 15

Lys Val

<210> 481

<211> 18

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: GS_NPL-NLS

<400> 481

Gly Ser Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys

1 5 10 15

Lys Lys

<210> 482

<211> 36

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: GS_NPL-NLS_GS_NPL-NLS

<400> 482

Gly Ser Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys

1 5 10 15

Lys Lys Gly Ser Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala

20 25 30

Lys Lys Lys Lys

35

<210> 483

<211> 27

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: GS_SV40-NLS_GS_NPL-NLS

<400> 483

Gly Ser Pro Lys Lys Lys Arg Lys Val Gly Ser Lys Arg Pro Ala Ala

1 5 10 15

Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

20 25

<210> 484

<211> 27

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: GS_NPL-NLS_GS_S40-NLS

<400> 484

Gly Ser Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys

1 5 10 15

Lys Lys Gly Ser Pro Lys Lys Lys Arg Lys Val

20 25

<210> 485

<211> 35

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: (GGGGS) 2_SV40-NLS_GS_NPL-NLS

<400> 485

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro Lys Lys Lys Arg Lys

1 5 10 15

Val Gly Ser Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys

20 25 30

Lys Lys Lys

35

<210> 486

<211> 35

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: (GGGGS) 2_NPL-NLS_GS_S40-NLS

<400> 486

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Lys Arg Pro Ala Ala Thr

1 5 10 15

Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Pro Lys Lys Lys

20 25 30

Arg Lys Val

35

<210> 487

<211> 17

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: (GGGGS) 2_SV40-NLS

<400> 487

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro Lys Lys Lys Arg Lys

1 5 10 15

Val

<210> 488

<211> 26

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: (GGGGS) 2_SV40-NLS_GS_S40-NLS

<400> 488

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro Lys Lys Lys Arg Lys

1 5 10 15

Val Gly Ser Pro Lys Lys Lys Arg Lys Val

20 25

<210> 489

<211> 26

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: (GGGGS) 2_NPL-NLS

<400> 489

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Lys Arg Pro Ala Ala Thr

1 5 10 15

Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

20 25

<210> 490

<211> 44

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: (GGGGS) 2_NPL-NLS_GS_NPL-NLS

<400> 490

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Lys Arg Pro Ala Ala Thr

1 5 10 15

Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Lys Arg Pro Ala

20 25 30

Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

35 40

<210> 491

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: TRAC-tgt25

<400> 491

cagauacgaa ccuaaacuuu 20

<210> 492

<211> 20

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: TRAC-tgt28

<400> 492

aggaggagga uucggaaccc 20

<210> 493

<211> 21

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: 53BP1

<400> 493

Gly Lys Arg Lys Leu Ile Thr Ser Glu Glu Glu Arg Ser Pro Ala Lys

1 5 10 15

Arg Gly Arg Lys Ser

20

<210> 494

<211> 6

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: VACM-1/CUL5

<400> 494

Pro Lys Leu Lys Arg Gln

1 5

<210> 495

<211> 4

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: CXCR4

<400> 495

Arg Pro Arg Lys

1

<210> 496

<211> 8

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: VP1

<400> 496

Arg Arg Ala Arg Arg Pro Arg Gly

1 5

<210> 497

<211> 22

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: ING4

<400> 497

Lys Gly Lys Lys Gly Arg Thr Gln Lys Glu Lys Lys Ala Ala Arg Ala

1 5 10 15

Arg Ser Lys Gly Lys Asn

20

<210> 498

<211> 28

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: IER5

<400> 498

Arg Lys Arg Cys Ala Ala Gly Val Gly Gly Gly Pro Ala Gly Cys Pro

1 5 10 15

Ala Pro Gly Ser Thr Pro Leu Lys Lys Pro Arg Arg

20 25

<210> 499

<211> 36

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: ERK5

<400> 499

Arg Lys Pro Val Thr Ala Gln Glu Arg Gln Arg Glu Arg Glu Glu Lys

1 5 10 15

Arg Arg Arg Arg Gln Glu Arg Ala Lys Glu Arg Glu Lys Arg Arg Gln

20 25 30

Glu Arg Glu Arg

35

<210> 500

<211> 27

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: UL79

<400> 500

Thr Leu Leu Leu Arg Glu Thr Met Asn Asn Leu Gly Val Ser Asp His

1 5 10 15

Ala Val Leu Ser Arg Lys Thr Pro Gln Pro Tyr

20 25

<210> 501

<211> 18

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: EWS

<400> 501

Pro Gly Lys Met Asp Lys Gly Glu His Arg Gln Glu Arg Arg Asp Arg

1 5 10 15

Pro Tyr

<210> 502

<211> 27

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: hrp1

<400> 502

Arg Ser Gly Gly Asn His Arg Arg Asn Gly Arg Gly Gly Arg Gly Gly

1 5 10 15

Tyr Asn Arg Arg Asn Asn Gly Tyr His Pro Tyr

20 25

<210> 503

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: cMyc (1)

<400> 503

Pro Ala Ala Lys Arg Cys Lys Leu Asp

1 5

<210> 504

<211> 11

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: cMyc (2)

<400> 504

Arg Gln Arg Arg Asn Glu Leu Lys Arg Ser Pro

1 5 10

<210> 505

<211> 12

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: mouse c-able IV

<400> 505

Ser Ala Leu Ile Lys Lys Lys Lys Lys Asn Ala Pro

1 5 10

<210> 506

<211> 5

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: matalpha2

<400> 506

Lys Ile Pro Ile Lys

1 5

<210> 507

<211> 6

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: MINIYO

<400> 507

Lys Ser Gly Ser Arg Lys

1 5

<210> 508

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TRAC-tgt25 chRDNA

<400> 508

taauuucuac ucutguagau cagauacgaa ccuaaacuut 40

<210> 509

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CISH-tgt3 chRDNA

<400> 509

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 510

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA CBLB-tgt3 chRDNA

<400> 510

taauuucuac ucutguagau ccugauacau aucagcauuu 40

<210> 511

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: TRAC-tgt12 crRNA

<400> 511

uaauuucuac ucuuguagau gagucucuca gcugguacac 40

<210> 512

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: TRAC-tgt12 ps-r1.2_s19.20

<220>

<221> misc_feature

<222> (1)..(3)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (38)..(40)

<223> phosphorothioate chemical bond

<400> 512

uaauuucuac ucuuguagau gagucucuca gcugguacac 40

<210> 513

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TRAC-tgt12 ps-r2_r1-d

<220>

<221> misc_feature

<222> (1)..(3)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (38)..(40)

<223> phosphorothioate chemical bond

<400> 513

taauuucuac ucuuguagau gagucucuca gcugguacac 40

<210> 514

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: TRAC-tgt12 ps-r1.2_r7

<220>

<221> misc_feature

<222> (1)..(3)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (7)..(8)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (38)..(40)

<223> phosphorothioate chemical bond

<400> 514

uaauuucuac ucuuguagau gagucucuca gcugguacac 40

<210> 515

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: TRAC-tgt12 ps-r1.2_rd10

<220>

<221> misc_feature

<222> (1)..(3)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (10)..(11)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (38)..(40)

<223> phosphorothioate chemical bond

<400> 515

uaauuucuac ucuuguagau gagucucuca gcugguacac 40

<210> 516

<211> 40

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthesized: TRAC-tgt12 ps-r 1.2_rd12

<220>

<221> misc_feature

<222> (1)..(3)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (12)..(13)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (38)..(40)

<223> phosphorothioate chemical bond

<400> 516

uaauuucuac ucuuguagau gagucucuca gcugguacac 40

<210> 517

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA TRAC-tgt12 ps-r1.2_r-d14

<220>

<221> misc_feature

<222> (1)..(3)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (14)..(15)

<223> phosphorothioate chemical bond

<220>

<221> misc_feature

<222> (38)..(40)

<223> phosphorothioate chemical bond

<400> 517

uaauuucuac ucutguagau gagucucuca gcugguacac 40

<210> 518

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d1

<400> 518

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 519

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d8

<400> 519

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 520

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d9

<400> 520

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 521

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d10

<400> 521

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 522

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d11

<400> 522

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 523

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d12

<400> 523

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 524

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d14

<400> 524

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 525

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d15

<400> 525

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 526

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d17

<400> 526

taauuucuac ucutguagau gguguacagc aguggctggu 40

<210> 527

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d18

<400> 527

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 528

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d19

<400> 528

taauuucuac ucutguagau gguguacagc aguggcuggu 40

<210> 529

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic DNA/RNA: CSH-tgt3_3' _d20

<400> 529

taauuucuac ucutguagau gguguacagc aguggcuggt 40

Claims (43)

1. A crispr guide molecule comprising:

   targeting regions capable of binding to target nucleic acid sequences

   An activation region comprising an RNA sequence UAAUUUCUACUCUUGUAGAU comprising at least one deoxyribonucleotide in place of a ribonucleotide, wherein the activation region is capable of forming a nucleoprotein complex with a Cas12 protein.
2. 2. The CRISPR guide molecule of claim 1, wherein one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in the activation region comprises a deoxyribonucleotide base.
3. 3. The CRISPR guide molecule of claim 1, wherein ten or less of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18 and 19 in the activation region comprise deoxyribonucleotide bases.
4. 4. The CRISPR guide molecule of claim 1 comprising one or more chemical modifications selected from the group consisting of: base modifications including inosine, deoxyinosine, deoxyuracil, xanthosine, C3 spacer, 5-methyl dC, 5-hydroxybutyyne-2' -deoxyuridine, 5-nitroindole, 5-methylisodeoxycytosine, isodeoxyguanosine, deoxyuridine, isodeoxycytidine, and abasic sites; and backbone modifications, including phosphorothioate modifications.
5. 5. The CRISPR guide molecule of claim 1, wherein said targeting region targets a B2M gene and comprises an RNA sequence AGUGGGGGUGAAUUCAGUGU, wherein optionally at least one base in said sequence is replaced by a base analogue or an abasic site.
6. 6. The CRISPR guide molecule of claim 5, wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in the targeting region comprises a deoxyribonucleotide base.
7. 7. The CRISPR guide molecule of claim 5, wherein five or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in the targeting region comprise a deoxyribonucleotide base.
8. 8. The CRISPR guide molecule according to claim 5, wherein said targeting region is capable of hybridizing to a sequence selected from SEQ ID NOs 51-133.
9. 9. The CRISPR guide molecule of claim 5 comprising a sequence selected from SEQ ID NOs 212-231, 275-315 and 331-350.
10. 10. The CRISPR guide molecule of claim 5 comprising the sequence of SEQ ID No. 416.
11. 11. The CRISPR guide molecule of claim 1, wherein said targeting region targets a TRAC gene and comprises an RNA sequence GAGUCUCUCAGCUGGUACAC, wherein optionally at least one base in said sequence is replaced by a base analogue or an abasic site.
12. 12. The CRISPR guide molecule of claim 11, wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in the targeting region comprises a deoxyribonucleotide base.
13. 13. The CRISPR guide molecule of claim 11, wherein five or less of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 and 20 in the targeting region comprise a deoxyribonucleotide base.
14. 14. The CRISPR guide molecule according to claim 11, wherein said targeting region is capable of hybridising to a sequence selected from SEQ ID NOs 15 to 20.
15. 15. The CRISPR guide molecule of claim 11 comprising a sequence selected from SEQ id nos 233-252, 317-329, 491-492 and 508.
16. 16. The CRISPR guide molecule of claim 11, further comprising a chemical modification, wherein the CRISPR guide molecule comprises a sequence selected from SEQ ID nos 512-517.
17. 17. The CRISPR guide molecule of claim 11 comprising the sequence of SEQ ID No. 415.
18. 18. The CRISPR guide molecule of claim 1, wherein said targeting region targets a CISH gene and is capable of hybridizing to a sequence selected from SEQ ID NOs 157-165.
19. 19. The CRISPR guide molecule of claim 18, comprising a sequence selected from SEQ ID NOs 509 and 519-529.
20. 20. The CRISPR guide molecule of claim 1, wherein said targeting region targets the PDCD1 gene and is capable of hybridizing to a sequence selected from SEQ ID NOs 135-155.
21. 21. The CRISPR guide molecule of claim 1, wherein said targeting region targets the CBLB gene and is capable of hybridizing to a sequence selected from SEQ ID NOs 167-189.
22. 22. The CRISPR guide molecule of claim 21 comprising the sequence of SEQ ID No. 510.
23. A CRISPR nucleic acid/protein composition comprising the CRISPR guide molecule of claim 1 and a Cas12 protein.
24. 24. The CRISPR nucleic acid/protein composition of claim 23, wherein the Cas12 protein is a Cas12a protein comprising at the C-terminus a sequence comprising a linker and a Nuclear Localization Signal (NLS) having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs 479-490.
25. 25. A cell comprising the CRISPR nucleic acid/protein composition of claim 1, wherein said cell is a lymphocyte, a Chimeric Antigen Receptor (CAR) T cell, a T Cell Receptor (TCR) cell, a TCR-engineered CAR-T cell, a tumor-infiltrating lymphocyte (TIL), a CAR TIL, a Dendritic Cell (DC), a CAR-DC, a macrophage, a CAR-macrophage (CAR-M), a Natural Killer (NK) cell, an Induced Pluripotent Stem Cell (iPSC), a cell differentiated from an iPSC cell, or a CAR-NK cell.
26. 26. A method for producing a cell expressing a Chimeric Antigen Receptor (CAR), the method comprising:

    a) Contacting a first target nucleic acid comprising a TRAC sequence in a cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a first CRISPR guide molecule having a targeting region capable of binding to the first target nucleic acid sequence and an activation region capable of forming a nucleoprotein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises a ribonucleotide base and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the nucleoprotein complex is capable of cleaving the first target nucleic acid sequence;

    b) Contacting a second target nucleic acid sequence comprising a B2M sequence in the same cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a second CRISPR guide molecule having a targeting region capable of binding to the second target nucleic acid sequence and an activation region capable of forming a nucleoprotein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises a ribonucleotide base and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the nucleoprotein complex is capable of cleaving the second target nucleic acid sequence;

    c) Providing a first donor polynucleotide encoding a CAR, the CAR comprising an scFv, a transmembrane domain, a costimulatory domain, and an activation domain, wherein the CAR is capable of being inserted into a cleavage site in the first target nucleic acid sequence;

    d) Providing a second donor polynucleotide encoding a B2M-HLA-E fusion construct comprising a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence, wherein the B2M-HLA-E fusion construct is capable of being inserted into a cleavage site in the second target nucleic acid sequence;

    e) Cleaving the first target nucleic acid sequence and inserting at least a portion of the first donor polynucleotide into the cleavage site; and

    f) Cleaving the second target nucleic acid sequence and inserting at least a portion of the second donor polynucleotide into the cleavage site.
27. 27. The method of claim 26, wherein the second donor polynucleotide further comprises a P2A sequence 5' to the B2M-HLA-E fusion construct.
28. 28. The method of claim 26, wherein the first donor polynucleotide comprises SEQ ID No. 413.
29. 29. The method of claim 26, wherein the second donor polynucleotide comprises SEQ ID No. 414.
30. 30. The method of claim 26, wherein the scFv in the CAR is capable of binding to a cellular target selected from the group consisting of: CD37, CD38, CD47, CD73, CD4, CS1, PD-L1, NGFR, ENPP3, PSCA, CD79B, TACI, VEGFR2, B7-H3, B7-H6, B Cell Maturation Antigen (BCMA), CD123, CD138, CD171/L1CAM, CD19, CD20, CD22, CD30, CD33, CD70, CD371, CEA, sealing protein 18.1, sealing protein 18.2, CSPG4, EFGRvIII, epCAM, ephA2, epidermal growth factor receptor, erbB2 (HER 2), FAP, FR alpha, GD2, GD3, glypican 3, IL-11 Ralpha, IL-13 Ralpha 2, IL13 receptor alpha, lewis Y/LeY, mesothelin, MUC1, MUC16, NKG2D ligand, PD1, PSMA, ROR-1, SLAMF7, TAG72, ULBP and MICA/B proteins, VEGF2 and WT1.
31. 31. The method of claim 26, wherein the scFv is capable of binding BCMA and comprises a first variable region comprising the amino acid sequence of SEQ ID No. 474, a second variable region comprising the amino acid sequence of SEQ ID No. 475, and a linker between the first variable region and the second variable region comprising the amino acid sequence of SEQ ID No. 476.
32. 32. The method of claim 26, wherein the scFv comprises the amino acid sequence of SEQ ID No. 477.
33. 33. The method of claim 26, wherein the transmembrane domain of the CAR is derived from the T cell receptor alpha chain, T cell receptor beta chain, CD3 zeta chain, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or GITR.
34. 34. The method of claim 26, wherein the co-stimulatory domain of the CAR is derived from CD28, 4-1BB, GITR, ICOS-1, CD27, OX-40 or DAP10.
35. 35. The method of claim 26, wherein the CAR comprises a transmembrane domain derived from CD8, a 4-1BB co-stimulatory domain, and a cd3ζ activation domain.
36. 36. The method of claim 26, wherein the vector comprising the CAR sequence comprises a leader sequence having the nucleic acid sequence of SEQ ID No. 478.
37. 37. The method of claim 26, wherein the catalytically active Cas12 protein comprises at the C-terminus a sequence comprising a linker and a Nuclear Localization Signal (NLS) that has at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs 479-490.
38. 38. The method of claim 26, further comprising:

    a. contacting a third target nucleic acid sequence in the same cell with a nucleoprotein complex comprising a catalytically active Cas12 protein and a third CRISPR guide molecule having a targeting region capable of binding to the third target nucleic acid sequence and an activation region capable of forming a nucleoprotein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises a ribonucleotide base and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the nucleoprotein complex is capable of cleaving the third target nucleic acid sequence;

    b. Cleaving said third target nucleic acid sequence and deleting one or more nucleotides from said third target nucleic acid sequence at said cleavage site,

    wherein the third target nucleic acid sequence is selected from the group consisting of a PDCD gene, a CISH gene, and a CBLB gene.
39. 39. The method of claim 26, wherein the CAR-expressing cells are allogeneic or autologous CAR-T cells produced by T lymphocytes.
40. 40. A CAR-expressing cell produced by the method of claim 26, wherein the cell is selected from the group consisting of a lymphocyte, a CAR-T cell, a TCR-engineered CAR-T cell, a TIL, a CAR-TIL, a dendritic cell, a CAR-DC, a macrophage, a CAR-M, iPSC cell, a cell differentiated from an iPSC cell, an NK cell, or a CAR-NK cell.
41. 41. A method of adoptive cell therapy, said method comprising administering to a subject in need thereof a CAR-expressing cell of claim 40.
42. 42. The method of claim 41, wherein the adoptive cell therapy comprises killing BCMA positive cancer cells.
43. 43. The method of claim 42, wherein said BCMA positive cancer cells comprise multiple myeloma cancer cells.