CN116479168A - Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit - Google Patents

Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit Download PDF

Info

Publication number
CN116479168A
CN116479168A CN202211062516.XA CN202211062516A CN116479168A CN 116479168 A CN116479168 A CN 116479168A CN 202211062516 A CN202211062516 A CN 202211062516A CN 116479168 A CN116479168 A CN 116479168A
Authority
CN
China
Prior art keywords
fluorescent
nucleic acid
quantitative pcr
seq
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211062516.XA
Other languages
Chinese (zh)
Inventor
王频佳
谢成彬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chengdu Medical College
Original Assignee
Chengdu Medical College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chengdu Medical College filed Critical Chengdu Medical College
Priority to CN202211062516.XA priority Critical patent/CN116479168A/en
Publication of CN116479168A publication Critical patent/CN116479168A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a nucleic acid composition for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses, a kit and a use method of the kit, belonging to the technical field of molecular biology, wherein the nucleic acid composition for detecting the multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses comprises amplification primer pairs and fluorescent probes of various viruses; the detection kit comprises 5 amplification primer pairs of diarrhea viruses, fluorescent probes, internal standard control, positive control, negative control and one-step fluorescent quantitative PCR reaction premix. The nucleic acid composition and the kit can realize the simultaneous detection of group A rotavirus, norovirus GI type, norovirus GII type, astrovirus and zha virus, and have the advantages of high PCR reaction amplification efficiency, high detection sensitivity, good specificity and good repeatability.

Description

Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit
Technical Field
The invention relates to the technical field of biological detection, in particular to a nucleic acid composition for detecting multiple real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, a kit and a method for using the kit.
Background
Infectious diarrhea, one of public health problems, is a global, very dangerous disease. There are about 20 million diarrhea cases annually worldwide, as counted by WHO. Statistical analysis of global childhood death causes from 2000 to 2010 shows that diarrhea is the third leading cause of death in children under 5 years after pneumonia and perinatal disease. In our country, infectious diarrhea is the first 3 in incidence in legal infectious disease reports. Research on causes of diarrhea at home and abroad shows that viral diarrhea accounts for about 50% or more of diarrhea cases in developed and developing countries, with rotaviruses being the most common, and norovirus, astrovirus and sapovirus (also called sapovirus).
Accurate medical treatment is a new medical concept and medical model developed in recent years, and the fundamental purpose is to select treatment most likely to obtain the greatest clinical benefit (including disease improvement and economic burden) according to different conditions of a patient's disease. In the field of infectious diseases, accurate diagnosis is a precondition for realizing accurate prevention and control, and unfortunately, the accurate target of anti-infection treatment is not really achieved, and the empirical use of antibacterial drugs is still one of important medical practice bases. The use of a large number of broad-spectrum antibacterial agents in the absence of etiology information for patients with viral diarrhea, and the use of antibacterial agents is not standardized, has led to the constant emergence of "superbacteria" with multiple drug resistance in hospitals. Empirical treatment may also become historical provided that the causative agent of infectious diarrhea can be quickly identified.
In the diarrhea pathogen detection method, the classical pathogen detection technique is isolated culture, but this is not applicable to clinical detection of viruses. Immunological detection techniques have been widely used in the detection of clinical viral diseases, but the stringent requirements for accurate recognition of specific monoclonal antibodies and the lack of integration of most systems have limited the rapid and high throughput of diagnosis. Molecular biological detection methods have significant advantages in terms of sensitivity and specificity. The real-time fluorescence quantitative PCR is a nucleic acid fragment qualitative and quantitative analysis method by monitoring fluorescence signals in real time, and has the characteristics of high specificity, high sensitivity, high efficiency and low cost. However, recently, multiplex real-time fluorescent quantitative PCR techniques widely used for detection of pathogenic microorganisms have found little application in the detection of viral diarrhea.
According to the registration information of the detection kit of the 5 diarrhea viruses published on the website of the national food and drug administration (https:// www.nmpa.gov.cn /), the detection kit without astroviruses and sheaf viruses is found; in addition, except for the PCR detection kit of the norovirus, the detection method of the rotavirus is an immunological method; currently, only one kit capable of jointly detecting 2 or more diarrhea viruses is available in the kit, namely, a kit for detecting group A rotavirus, adenovirus and norovirus antigens by using a latex chromatography method (specifically, see Table 1).
Table 1 method for detecting kit of diarrhea-causing virus published by national food and drug administration
Note that: v, homemade registration reagent; the following steps: and (5) inputting registration reagent.
Disclosure of Invention
Based on the lack or insufficient application of the prior art to the method for simultaneously detecting 5 diarrhea viruses, the invention provides a nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR of 5 diarrhea viruses.
In addition, a kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses, which has good specificity and high sensitivity, is also provided.
In addition, in order to meet the condition that most of the common clinical fluorescent quantitative PCR instruments have four optical detection channels, the invention also provides a use method of a kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses, so as to realize the detection of the five-fold fluorescent quantitative PCR.
According to a first aspect of the present invention, there is provided a nucleic acid composition for multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses, comprising an amplification primer pair and a fluorescent probe corresponding to the amplification primer pair. The amplification primer pair comprises: the sequence of the amplification primer pair of the group A rotavirus is shown as SEQ ID No.1 and SEQ ID No.2, the sequence of the amplification primer pair of the norovirus GI type is shown as SEQ ID No.3 and SEQ ID No.4, the sequence of the amplification primer pair of the norovirus GII type is shown as SEQ ID No.5 and SEQ ID No.6, the sequence of the amplification primer pair of the astrovirus is shown as SEQ ID No.7 and SEQ ID No.8, and the sequence of the amplification primer pair of the sapovirus is shown as SEQ ID No.9 and SEQ ID No. 10. The sequences of the fluorescent probes corresponding to the amplification primer pairs are respectively shown as SEQ ID No. 11-SEQ ID No. 15; the 5 'end of the fluorescent probe is connected with a fluorescent group, and the 3' end of the fluorescent probe is connected with a fluorescence quenching group.
The above nucleic acid compositions for multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses fall into two groups A, B: the group A nucleic acid composition comprises an amplification primer pair of group A rotavirus and a corresponding fluorescent probe, an amplification primer pair of norovirus GI type and a corresponding fluorescent probe, and an amplification primer pair of norovirus GII type and a corresponding fluorescent probe; the group B nucleic acid composition comprises an amplification primer pair of astrovirus and a corresponding fluorescent probe, an amplification primer pair of zha virus and a corresponding fluorescent probe; the fluorescent groups attached to the 5' ends of different fluorescent probes within the same set are different.
Preferably, the fluorescent groups on the fluorescent probes within each group are selected from one of FAM, HEX, CY.
Further, the fluorescent groups on the fluorescent probes in the group A are FAM, HEX and CY5; the fluorescent groups on the fluorescent probes in the group B are FAM and HEX.
Preferably, the fluorescent probe for group A rotavirus in group A has a FAM fluorescent group at the 5 'end and a BHQ2 quenching group at the 3' end; aiming at the fluorescent probe of the GI type of the norovirus, the fluorescent group at the 5 'end is HEX, and the quenching group at the 3' end is BHQ2; the fluorescent probe for the norovirus GII type has a CY5 fluorescent group at the 5 'end and a BHQ2 quenching group at the 3' end.
Preferably, the fluorescent probe for astrovirus in group B has FAM as 5 'end fluorescent group and BHQ2 as 3' end quenching group; the fluorescent probe for zhi has HEX as the 5 '-end fluorescent group and BHQ2 as the 3' -end quenching group.
According to a second aspect of the invention, the invention provides a kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses, which comprises amplification primer pairs for detecting group A rotaviruses, norovirus GI types, norovirus GII types, astroviruses and zha viruses and fluorescent probes matched with the amplification primer pairs, wherein the nucleotide sequences of the amplification primer pairs are shown as SEQ ID No. 1-SEQ ID No.10, and the nucleotide sequences of the fluorescent probes are shown as SEQ ID No.11 and SEQ ID No. 15.
Further, the kit also comprises a one-step reverse transcription real-time fluorescence quantitative PCR reaction premix for the PCR-fluorescence probe method; the PCR reaction premix is a reagent for reverse transcription and PCR amplification of viral RNA, which contains reverse transcriptase, taq DNA polymerase, nucleotide mixture, RNase inhibitor, magnesium ion and the like.
Further, the kit also comprises an internal standard control, wherein the internal standard control is an amplification primer pair and a fluorescent probe for detecting an endogenous reference gene, namely a gene encoding human glyceraldehyde-3-phosphate dehydrogenase (GAPDH); the internal standard control is used for monitoring the sampling, nucleic acid extraction and amplification processes of the specimen by detecting whether the endogenous reference gene is normal or not, so that false negative results are avoided.
Further, the amplification primer pair sequences of the internal standard control are shown as SEQ ID No.16 and SEQ ID No.17, and the fluorescent probe sequences corresponding to the amplification primer pair are shown as SEQ ID No. 18; the fluorescent probe has a fluorescent group at the 5 'end of ROX and a quenching group at the 3' end of BHQ2.
Further, the kit also comprises a positive control and a negative control, which are used as quality control of detection to prevent false negative and false positive results in the amplification process; the positive control is in vitro transcribed RNA containing target genes and reference gene fragments of the 5 diarrhea causing viruses; the negative control is DEPC treated water.
Further, the positive control in the kit contains a target gene fragment of group A rotavirus as shown in SEQ ID No.19, a target gene fragment of the GI type of the norovirus as shown in SEQ ID No.20, a target gene fragment of the GII type of the norovirus as shown in SEQ ID No.21, a target gene fragment of the astrovirus as shown in SEQ ID No.22, a target gene fragment of the sapo virus as shown in SEQ ID No.23, and an internal reference gene fragment as shown in SEQ ID No. 24.
According to a third aspect of the present invention, there is provided a method of using a kit for multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses, comprising the steps of: extracting nucleic acid from a sample to be detected to obtain a nucleic acid sample of the sample to be detected; preparing a diarrhea virus nucleic acid composition, an internal standard control and a one-step reverse transcription real-time fluorescent quantitative PCR reaction premix in the kit into two reaction systems, namely an A reaction system (A tube) and a B reaction system (B tube); the A tube comprises a group A nucleic acid composition, an internal standard control and a one-step reverse transcription real-time fluorescence quantitative PCR reaction premix; the B tube comprises a B group nucleic acid composition, an internal standard control and a one-step reverse transcription real-time fluorescence quantitative PCR reaction premix; respectively adding nucleic acid of a sample to be detected, positive control and negative control into the tube A and the tube B, and carrying out reverse transcription real-time fluorescence quantitative PCR reaction; the fluorescent quantitative PCR instrument automatically draws a real-time amplification curve according to the detected fluorescent signals and calculates a sample Ct value (the number of cycles undergone by the fluorescent signals in each reaction tube when reaching a set threshold value);
preferably, the validity of the experiment is judged by the results of the internal standard control, the positive control and the negative control, and the accuracy of the results is ensured.
Preferably, the amplification conditions of the real-time fluorescent quantitative PCR are: the first step: reverse transcription reaction: 50 ℃ for 15min; and a second step of: pre-deformation: 95 ℃ for 2min; and a third step of: amplification: 95℃10s,58℃40s,40 cycles.
The embodiment of the invention has the following advantages:
first, the detection specificity is good. The nucleic acid composition for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses is designed according to the conserved sequence of each virus, and the amplification primers and fluorescent probes of various viruses are finally determined through the prediction of the secondary structure of an amplification product, so that the detection specificity is ensured.
Second, the detection sensitivity is high, the amplification efficiency is good, and the repeatability is good. The formulation of the components in the PCR reaction tube, particularly the concentration of the amplification primer pair and the fluorescent probe and the proportion between the amplification primer pair and the fluorescent probe, and the setting of the annealing temperature in the amplification condition are all the results of multiple experimental optimization, so that the high sensitivity, the high amplification efficiency and the good repeatability of the detection are ensured.
Thirdly, the accuracy of the detection result is good. The internal standard control provided by the embodiment of the invention is an amplification primer and a fluorescent probe of an endogenous reference gene human GAPDH, but not an exogenous internal standard, and the internal standard control is used for detecting the reference gene at the same time of detecting the nucleic acid of a sample to be detected, and has the advantages that: the whole process from sample sampling, nucleic acid extraction and nucleic acid amplification is monitored by detecting whether the internal reference gene is normal, so that false negative results are avoided, and the exogenous internal standard cannot monitor the effect of sample sampling; in addition, positive control and negative control are provided in the kit, detection is carried out together with the sample to be detected in the same experiment, and the process of adding samples to nucleic acid amplification is monitored through the detection results of the positive control and the negative control, so that false negative and false positive results are avoided. The positive control provided in the kit is an RNA fragment, not plasmid DNA, which has the advantage that: the 5 diarrheal viruses are all RNA viruses, so that the PCR reverse transcription process can be monitored using the RNA fragments as positive controls, which is lacking in plasmid DNA as positive control.
Fourth, the kit can be applied to most real-time fluorescent quantitative PCR instruments. The application method of the kit for detecting the multiple real-time fluorescent quantitative PCR of the 5 diarrhea viruses provided by the embodiment of the invention comprises the steps of adding the nucleic acid detection of the sample to be detected into the tube A and the tube B, and dividing the sample into two reaction tubes to simultaneously perform the real-time fluorescent quantitative PCR, thereby realizing the purpose that the four-channel fluorescent quantitative PCR instrument is used for detecting the nucleic acid of the 5 diarrhea viruses.
Drawings
FIG. 1 is a schematic diagram showing the predicted result of the secondary structure of the amplification product of the present invention. FIG. 2 is a graph showing the annealing temperature optimization of the present invention: wherein A: amplification curve graph at annealing temperature of 55-58 ℃; b: amplification plot at annealing temperature 58-62 ℃. FIG. 3 is a graph showing comparison of multiplex PCR results for annealing temperatures set at 55℃and 58℃according to the present invention: wherein A: amplification graph and Ct value at 55 ℃ of annealing temperature; b: amplification plot and Ct value at 58℃of annealing temperature. FIG. 4 is a graph showing amplification curves of the A and B tubes according to the present invention: wherein A: amplification curve graph of A tube; b: amplification plot of tube B. FIG. 5 is a graph showing amplification curves of sensitivity detection according to the present invention. FIG. 6 is a graph showing amplification curves for verification of precision according to the present invention: wherein A: amplification plot of repeatability test; b: amplification plot of intermediate compactness. FIG. 7 is a graph showing a standard curve of fluorescent quantitative PCR according to the present invention: a: group a rotavirus standard curve graph; b: norovirus GI type standard curve; c: norovirus GII type standard curve graph; d: astrovirus standard curve; e: astrovirus standard graph.
Detailed Description
The invention is further illustrated by the following examples, which are provided to illustrate the invention and are not intended to limit the scope of the invention. Those skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. The experimental materials used in the examples described below are all commercially available unless otherwise specified.
Example 1: design of primers and probes
The design of primers and probes in the present invention focuses on the following two aspects:
first, guarantee of amplification specificity. According to literature reports, the conserved sequences of the 5 viruses are determined. The conserved sequences of group A rotaviruses used in this study are the NSP3 gene sequences, the conserved sequences of the GI type of norovirus are the nonstructural polyprotein, rdRp region, (ORF 1) and VP1 (ORF 2) gene sequences, the conserved sequences of the GII type of norovirus are the nonstructural polyprotein, rdRp region, (ORF 1) and VP1 (ORF 2) gene sequences, the conserved sequences of the astroviruses are the genome sequences, and the conserved sequences of the sheaf viruses are the polyprotein and fictitious protein gene sequences.
Further, the conserved sequences of the 5 diarrhea viruses are downloaded in a GenBank database, the conserved sequences of the same viruses of different types are imported into DNAMAN 9 software for the consistency comparison of the nucleotide sequences, and the range of the nucleotide sequence region with higher consistency is determined.
Further, the nucleotide sequences with higher consistency of the 5 viruses obtained above are introduced into Beacon Designer 8 software for designing multiplex fluorescence quantitative PCR primers and probes. The primer parameters were set as follows: the length is 18-25 bp, the Tm is 59+ -5 ℃, and the length of amplified products is 100-150 bp; the settings of the probe parameters were: the length is 20-27 bp, and Tm=primer Tm+5-15 ℃. The designed primer, probe and fragment to be amplified pass Blast verification, and 2-3 candidate schemes are selected from the primer, probe and fragment to be amplified.
Second, the amplification efficiency is ensured. Too complex secondary structure of the amplified product will result in reverse transcription of RNA and low or even failure of PCR amplification. The secondary structure of each candidate amplification product obtained in the previous step is predicted, and a local area in which the secondary structure is relatively simple is selected as a target sequence to be amplified (shown in FIG. 1).
Further, by combining the characteristics of the primer and the probe and the prediction result of the secondary structure of the amplified product, the nucleic acid composition of multiplex real-time fluorescent quantitative PCR for detecting 5 diarrhea viruses, which has good specificity, less mutual interference and ideal amplification efficiency, is finally determined, as shown in tables 2 and 3.
The multiplex real-time fluorescent quantitative PCR primer and probe for detecting 5 diarrhea viruses comprise primer pairs and probes designed aiming at conserved sequences of group A rotaviruses, norovirus GI type, norovirus GII type, astrovirus and zha virus, wherein the nucleotide sequences of the amplification primer pairs of the group A rotaviruses are shown as SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequences of the fluorescent probes of the group A rotaviruses are shown as SEQ ID NO. 11; the nucleotide sequence of the amplification primer pair of the GI type of the norovirus is shown as SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of the fluorescent probe of the GI type of the norovirus is shown as SEQ ID NO. 12; the nucleotide sequence of the amplification primer pair of the norovirus GII is shown as SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequence of the fluorescent probe of the norovirus GII is shown as SEQ ID NO. 13; the nucleotide sequence of the amplification primer pair of the astrovirus is shown as SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the fluorescent probe of the astrovirus is shown as SEQ ID NO. 14; the nucleotide sequences of amplification primer pairs of the sheaf virus are shown as SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of a fluorescent probe of the sheaf virus is shown as SEQ ID NO. 15.
Preferably, the fluorescent probe of group A rotavirus has FAM as the 5 '-end fluorescent group and BHQ2 as the 3' -end quenching group; the fluorescent probe of the GI type of the norovirus has HEX as a fluorescent group at the 5 'end and BHQ2 as a quenching group at the 3' end; the fluorescent probe of the type GII of the norovirus has a fluorescent group at the 5 'end of CY5 and a quenching group at the 3' end of BHQ2; the fluorescent probe of the astrovirus has FAM as the 5 '-end fluorescent group and BHQ2 as the 3' -end quenching group; the fluorescent probe of zhi has HEX as the 5 '-end fluorescent group and BHQ2 as the 3' -end quenching group.
Table 25 nucleotide sequences of amplification primers for diarrhea Virus
Table 3 5 nucleotide sequences of fluorescent probes for diarrhea viruses
Example 2: design of internal standard control amplification primer and fluorescent probe
The invention provides a kit for detecting diarrhea virus, which comprises an internal standard control, wherein the internal standard control is an amplification primer and a fluorescent probe of a human endogenous reference gene GAPDH, but not an exogenous internal standard, and the internal standard control is used for detecting nucleic acid of a sample to be detected and detecting the reference gene at the same time, and has the advantages that: the whole process from sample sampling, nucleic acid extraction and nucleic acid amplification is monitored by detecting whether the internal reference gene is normal, false negative results are avoided, and the exogenous internal standard cannot monitor the sample sampling effect. GAPDH is an abbreviation for glyceraldehyde-3-phosphate dehydrogenase, an enzyme in classical glycolysis reactions. The enzyme is widely existing in a plurality of organisms and is abundant in cells, and accounts for 10% -20% of total protein. The GAPDH gene has a highly conserved sequence and the amount of protein expressed in the same cell or tissue is generally constant. Therefore, the gene has been widely used as a reference gene for quantitative PCR for a long time. The invention designs an amplification primer and a fluorescent probe according to the mRNA sequence of the human GAPDH gene. The sequence of the amplification primer pair of the reference gene is shown as SEQ ID No.16 and SEQ ID No.17, and the sequence of the fluorescent probe corresponding to the amplification primer pair is shown as SEQ ID No. 18; the fluorescent probe has a fluorescent group at the 5 'end of ROX and a quenching group at the 3' end of BHQ2. See table 4.
Table 4 amplification primers and fluorescent probe nucleotide sequences for internal control
Example 3: design of positive control
The invention provides a kit for detecting diarrhea causing virus, which comprises a positive control. The positive control is in vitro transcribed RNA comprising the target gene and reference gene fragments of the 5 diarrhea viruses, and is used for preventing false negative results in the amplification process. The positive control provided in the present kit is an RNA fragment, not a plasmid DNA, which has the advantage that: the 5 diarrheal viruses are all RNA viruses, so that the PCR reverse transcription process can be monitored using the RNA fragments as positive controls, which is lacking in plasmid DNA as positive control.
Further, the nucleotide sequences of the target genes and the internal reference gene fragments of the 5 diarrhea causing viruses contained in the positive control are shown in SEQ ID No. 19-SEQ ID No. 24.
Specifically, the target gene sequence of the group A rotavirus is shown as SEQ ID No.19, and the specific sequence is as follows: TGCTTTTCAGTGGTTGATGCTCAAGATGGAGTCTACTCAGCAGATGGCATCTTCTATTATTAACTCTTCTTTTGAAGCTGCAGTTGTCGCTGCAACTTCTACATTAGAATTAATGGGTATTCAATATGATTATAATGAAGTATATACTAGAGTTAAAAGTAAGTTTGATTTTGTAATGGATGATTCTGGTGTTAAGAATAATCTAATAGGTAAGGCAGTTACAATTGATCAGGCTTTGAA
Specifically, the target gene sequence of the GI type norovirus is shown as SEQ ID No.20, and the specific sequence is GGCCATGTTCCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGTAAATGATGATGGCGTCTAAGGACGCTACATCAAGCGTGGATGGCGCTAGTGGCGCTGGTCAGTTGGTACCGGAGGTTAATGCTTCTGACCCTCTTGCAATGGATCCTGTAGCAGGTTCTTCGACAGCAGTCGCGACTGCTGGACAAGTTAATCCTATTGATCCCT
Specifically, the target gene sequence of the norovirus GII type is shown as SEQ ID No.21, and the specific sequence is as follows: CGGCCCAGCATTCTACAGCAAAATTAGCAAGCTAGTCATTGCAGAACTGAAGGAAGGTGGCATGGATTTTTACGTGCCCAGACAAGAGCCAATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGCTTTGTGAATGAAGATGGCGTCGAATGACGCCAACCCATCTGATGGGTCCGCAGCCAACCTCGTCCCAGAGGTCAATAATGAGGTTATGGCTCTGGAGCCCGTTGTTGGTGCCGCTATTGCGGCACCTGTGGCGGGCCAACAAA
Specifically, the nucleotide sequence of the target gene of the astrovirus is shown as SEQ ID No.22, and the specific sequence is as follows: AAGGGCCCGTTCACAATCTAGGGGCCGAGACAAATCAGTCAAGATCACAGTCAATTCAAGAAACAGAGCCAGGAGACAGCCCGGACGCGACAAACGTCAATCTTCTCAACGTGTCCGTAACATTGTCAATAAGCAACTCAGGAAACAGGGTGTCACAGGACCAAAACCTGCAATATGTCAGAGAGCAACAGCAACCCTTGGGACAGTCGGGTCAAACACCAGTGGCACCACTGAGATTGAGGCGTGTATTCTCCTCAACCCTGTCCTCGTTAAGGACGCTACTGGAAGCACTCAGTTTGGCCCTGTGCAGGCGCTAGGTGCACAGTATTCCATGTGGAAGTTGAAGTATTTGAATGTCAA
Specifically, the nucleotide sequence of the target gene of the sheaf virus is shown as SEQ ID No.23, and the specific sequence is as follows: GAGCAACCCAATGGGGCCGCACAGCGCCTGGAGTTGGCTGTTGCCACTGGTGCAATCCAATCCAATGTCCCTGAGGCAATACGCAACTGCTTTGCAGTCTTTCGTACTTTTGCTTGGAACGACAGGATGCCCACGGGAACTTTTCTTGGATCTATATCGCTTCATCCCAACATTAACCCGTACACTTCTCACCTCTCTGGGATGTGGGCCGGGTGGGGCGGTAGTTTTGAGGTCCGGCTATCGATCTCTGGTTCTGGCGTGTTCGCTGGGCGCATCATTGCTTCTGTCATACCACCAGGGGTTGATCCCTCGTCCATCAGGGACCCAGGCGTGTTGCCTCACGCTTTCGTTGATGCTCGC
Specifically, the nucleotide sequence of the reference gene is shown as SEQ ID No.24, and the specific sequence is as follows: CAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTG
Example 4: optimization of PCR amplification annealing temperature
In order to clarify the influence of different annealing temperatures on the amplification efficiency, a gradient PCR instrument and a single PCR reaction are utilized, and under the condition that other reaction systems and reaction conditions are the same, a proper annealing temperature range is studied. As shown in FIG. 2, the amplification curve exhibited a standard S-shape at the annealing temperatures of 55℃and 58℃and the amplification sensitivity was high.
Further, when the annealing temperatures are compared to 55℃and 58℃as shown in FIG. 3, the sensitivity of multiplex PCR is higher when the annealing temperature is set to 58℃and thus the amplification temperature of the kit PCR is set to 58 ℃.
Example 5: optimization of amplification primer and probe concentration in PCR reaction system
Under the condition that other reaction systems and reaction conditions are the same, the optimal concentration combination of the amplification primer and the fluorescent probe in the PCR reaction system is discussed so as to find the optimal reaction conditions with good curve shape, no non-specific amplification, high detection sensitivity and good stability. The concentrations examined according to the conventional empirical determination are shown in Table 5 (the concentrations below are the final concentrations of the components in the system):
TABLE 5 discussion of amplification primer and Probe concentrations in PCR reaction System
Amplification primer (mu M) Fluorescent probe (mu M)
0.1 0.05
0.2 0.1
0.4 －
The concentrations were combined by permutation and subjected to a full test (3×2 factorial analysis).
Further, the optimal concentration combination is determined according to the amplification curve and Ct value, namely, when the final concentration of the amplification primer is 0.4 mu M, the concentration of the probe is 0.05 mu M, and the concentration ratio of the amplification primer to the probe is 8:1, the shape of the amplification curve is good, and the amplification sensitivity is high.
Example 6: composition design of multiplex real-time fluorescent quantitative PCR kit for detecting 5 diarrhea viruses
The main components of the multiplex real-time fluorescent quantitative PCR kit for detecting 5 diarrhea viruses are shown in table 6, and the one-step reverse transcription real-time fluorescent quantitative PCR reaction premix can be prepared by using HisScript@ I One Step qPCR Probe Kit of Nanjinouzan biotechnology Co., ltd., product model: q222-01:
TABLE 6 major components of multiplex real-time fluorescent quantitative PCR kit for detecting 5 diarrhea viruses
Example 7: application method of multiplex real-time fluorescent quantitative PCR kit for detecting 5 diarrhea viruses
1. Nucleic acid extraction
And extracting RNA in the sample to be detected by using the nucleic acid extraction kit, wherein the specific extraction steps are described in the specification of the extraction kit.
2. Preparation of the reaction System
According to the optimized results of the concentration of the amplification primer and the probe in the PCR reaction system of example 5, preparing the A group/B group nucleic acid composition, the internal standard control and the one-step reverse transcription real-time fluorescent quantitative PCR reaction premix into two reaction systems, namely an A reaction system (A tube) and a B reaction system (B tube); the A tube comprises a group A nucleic acid composition, an internal standard control and a one-step reverse transcription real-time fluorescence quantitative PCR reaction premix; the B tube comprises a B group nucleic acid composition, an internal standard control and a one-step reverse transcription real-time fluorescence quantitative PCR reaction premix. 5 μl of sample RNA to be tested, positive control, negative control were added to each of the A and B tubes, and the total reaction volume per tube was 50 μl. The specific formulation is shown in tables 7 and 8.
Table 7A tube formulation
Table 8B group formulation protocol
3. Fluorescent quantitative PCR setup
The detection channels are set as FAM, HEX, CY and ROX respectively. FAM corresponds to group a rotavirus of tube a and astrovirus of tube B, HEX corresponds to norovirus GI type of tube a and sapovirus of tube B, CY5 corresponds to norovirus GII type of tube a, ROX corresponds to internal standard control of tube a and tube B.
Each reaction tube was placed in a PCR apparatus, and PCR conditions were set according to the results of optimizing the annealing temperature for PCR amplification in example 4. As shown in table 9.
TABLE 9 fluorescent quantitative PCR reaction conditions
4. The reaction program was run according to table 9 and the results were checked as shown in fig. 4. The amplification curves of the 3 viruses in the A group and the 2 viruses in the B group are S type, and the nucleic acid of the 5 viruses can be well amplified.
5. Result judgment
(1) Quality control (negative and positive comparison result)
Table 10 shows the quality control criteria, which are required to be satisfied simultaneously in the same experiment (both Ct for negative control and Ct for positive control), otherwise the experiment is not effective.
TABLE 10 quality control in-control judgment criteria
(2) Judgment of specimen result to be measured
Under the condition of quality control, judging the result of the sample to be detected, and judging the positive or negative detection result according to the judging standard in the table 11.
Table 11 judging standard of specimen result to be measured
Example 9: specific detection of multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses
The invention is not responsive to other enteropathogens including enteroadenoviruses, enteroviruses, escherichia coli, staphylococcus aureus, salmonella, shigella, bacillus cereus, yersinia, campylobacter jejuni.
Example 10: sensitive detection of multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses
Positive control was serially diluted 10-fold (as shown in FIG. 5)Using the method of use of the detection kit of example 5, fluorescent quantitative PCR detection was performed on serially diluted nucleic acid samples. When the positive control (original concentration 1.0-1.5X10) 13 Copy/ml) dilution 10 11 After doubling, the Ct value is still < 40, but when diluted 10 12 After doubling, no Ct value or Ct greater than 40. Therefore, the minimum detection limit of 5 viruses in the kit of the invention is 1.0 to 1.5X10 2 Copy/ml.
Example 11: precision verification of multiplex real-time fluorescent quantitative PCR for detecting 5 diarrhea viruses
The precision verification should include repeatability tests and intermediate precision tests.
1. Repeatability test
Diluting both the positive control of group A and the positive control of group B10 5 10 replicates were performed as samples to be tested, as shown in fig. 6A. The results show that: after the 3 virus nucleic acids in the A group are amplified by real-time fluorescent quantitative PCR, the variation Coefficients (CV) of Ct values are respectively as follows: group a rotavirus 0.9%, norovirus type GI 0.6%, norovirus type GII 0.6%; after the 2 virus nucleic acids in the B group are amplified by real-time fluorescent quantitative PCR, the variation Coefficients (CV) of Ct values are respectively as follows: astrovirus was 0.7% and sheaf virus was 0.7%. The results show that CV values of 5 virus nucleic acid detection repeatability tests are all smaller than 5%, and the repeatability is very good.
2. Intermediate precision
Group A positive control was taken as 10 3 Double sum 10 6 Double dilution gives two diluted concentration samples (referred to as high concentration and low concentration samples, respectively). In addition, the same dilution was made for the group B positive control. 1 assay batch was tested daily, 2 levels of samples were tested per batch, each sample was tested 5 times repeatedly, and testing was continued for 5 days, as shown in fig. 6B. The results show that: after 3 virus nucleic acids in the high-concentration sample of the group A are amplified by real-time fluorescent quantitative PCR, the variation Coefficients (CV) of Ct values are respectively as follows: group a rotavirus 2.9%, norovirus type GI 1.5%, norovirus type GII 1.7%; after 3 virus nucleic acids in the low-concentration sample of the group A are amplified by real-time fluorescent quantitative PCR, the variation Coefficients (CV) of Ct values are respectively as follows: group A rotavirus 2.7%, nuoIf the virus GI type is 0.9%, the norovirus GII type is 4.3%; after 2 virus nucleic acids in the B group high-concentration sample are amplified by real-time fluorescent quantitative PCR, the variation Coefficients (CV) of Ct values are respectively as follows: astrovirus 2.6% and sheaf virus 3.5%; after 2 virus nucleic acids in the low-concentration sample of the group B are amplified by real-time fluorescent quantitative PCR, the variation Coefficients (CV) of Ct values are respectively as follows: astrovirus was 4.1% and sheaf virus was 3.3%. The results show that CV values of intermediate compactness in detection of 5 virus nucleic acids are all smaller than 5%, and the precision is very good.
Example 12: establishment of standard curve for multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses
The positive control was diluted to different concentrations and used as a template for the PCR reaction. And drawing a standard curve by taking the logarithm of the dilution multiple as an abscissa and taking the measured CT value as an ordinate. As can be seen from FIGS. 7A to 7E, the number of templates to the virus was approximately 10 4 ～10 11 R of standard curve of each virus at copy/ml 2 The amplification method is larger than 0.99, has small error and good repeatability, the slope is-3.223 to-3.360, and is close to the theoretical slope-3.322, thus indicating high amplification efficiency.
In summary, the invention provides a nucleic acid composition, a kit and a method for using the kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses. The test of the measure of the embodiment 1 and the test of the embodiment 9 show that the method has good specificity; the high sensitivity of the method of the invention is demonstrated by the actions of examples 4 and 5 and the verification of example 10; the verification of example 11 shows that the method of the invention has good repeatability; the experiments of examples 1, 4 and 5 and the verification of example 12 show that the method of the present invention has high amplification efficiency.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
/>
/>
/>
/>
/>
/>
/>
/>
/>

Claims (12)

1. A nucleic acid composition for multiplex real-time fluorescent quantitative PCR for detecting 5 diarrhea viruses, comprising an amplification primer pair and a fluorescent probe corresponding to the amplification primer pair;
the amplification primer pair comprises: a group A rotavirus amplification primer pair with the sequences shown in SEQ ID No.1 and SEQ ID No.2, a norovirus GI type amplification primer pair with the sequences shown in SEQ ID No.3 and SEQ ID No.4, a norovirus GII type amplification primer pair with the sequences shown in SEQ ID No.5 and SEQ ID No.6, a astrovirus amplification primer pair with the sequences shown in SEQ ID No.7 and SEQ ID No.8, and a sheaf of virus amplification primer pair with the sequences shown in SEQ ID No.9 and SEQ ID No. 10;
the sequences of the fluorescent probes corresponding to the amplification primer pairs are respectively shown as SEQ ID No. 11-SEQ ID No. 15; the 5 'end of the fluorescent probe is connected with a fluorescent group, and the 3' end of the fluorescent probe is connected with a fluorescence quenching group.
2. The nucleic acid composition of claim 1, wherein the nucleic acid composition is divided into two groups A, B: the group A nucleic acid composition comprises an amplification primer pair of group A rotavirus and a corresponding fluorescent probe, an amplification primer pair of norovirus GI type and a corresponding fluorescent probe, and an amplification primer pair of norovirus GII type and a corresponding fluorescent probe; the group B nucleic acid composition comprises an amplification primer pair of astrovirus and a corresponding fluorescent probe, an amplification primer pair of zha virus and a corresponding fluorescent probe; the fluorescent groups attached to the 5' ends of different fluorescent probes within the same set are different.
3. The nucleic acid composition of claim 2, wherein the fluorescent moiety on the fluorescent probe in each set is selected from one of FAM, HEX, CY 5.
4. The nucleic acid composition of claim 3, wherein the fluorescent groups on the fluorescent probes of the group a nucleic acid composition are FAM, HEX, and CY5; the fluorescent groups on the fluorescent probes of the group B nucleic acid composition are FAM and HEX.
5. A kit for multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses, comprising the nucleic acid composition of any one of claims 1 to 4 for multiplex real-time fluorescent quantitative PCR for detecting 5 diarrheal viruses.
6. The kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses of claim 5 further comprising a one-step reverse transcription real-time fluorescent quantitative PCR reaction premix for PCR-fluorescent probe method; the PCR reaction premix is a reagent for reverse transcription and PCR amplification of viral RNA, comprising reverse transcriptase, taq DNA polymerase, nucleotide mixture, RNase inhibitor and magnesium ion.
7. The kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses according to claim 5, further comprising an internal standard control, wherein the internal standard control is an amplification primer pair and a fluorescent probe for detecting an endogenous reference gene, namely, a gene encoding human glyceraldehyde-3-phosphate dehydrogenase.
8. The kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrhea viruses according to claim 7, wherein the amplification primer pair sequences of the internal standard control are SEQ ID No.16 and SEQ ID No.17, and the fluorescent probe sequences corresponding to the amplification primer pairs are shown as SEQ ID No. 18; the fluorescent probe has a fluorescent group at the 5 'end of ROX and a quenching group at the 3' end of BHQ2.
9. The kit for detecting multiplex real-time fluorescent quantitative PCR for 5 diarrhea viruses of claim 5 further comprising a positive control, a negative control; the positive control is in vitro transcribed RNA comprising target genes and reference gene fragments of the 5 diarrhea causing viruses; the negative control was DEPC treated water.
10. The kit for detecting multiple real-time fluorescent quantitative PCR of 5 diarrheal viruses according to claim 9, wherein the positive control contains 5 diarrheal virus target genes and internal reference gene fragments with nucleotide sequences shown in SEQ ID No. 19-SEQ ID No. 24.
11. The application method of the kit for detecting the multiplex real-time fluorescent quantitative PCR of 5 diarrhea viruses is characterized by comprising the following steps:
extracting nucleic acid from a sample to be detected to obtain a nucleic acid sample of the sample to be detected;
preparing the diarrheal virus nucleic acid composition, the internal standard control and the one-step reverse transcription real-time fluorescence quantitative PCR reaction premix in the kit according to any one of claims 5 to 10 into two reaction systems, namely a tube A and a tube B; the A tube comprises a group A nucleic acid composition, an internal standard control and a one-step reverse transcription real-time fluorescence quantitative PCR reaction premix; the B tube comprises a B group nucleic acid composition, an internal standard control and a one-step reverse transcription real-time fluorescence quantitative PCR reaction premix;
respectively adding nucleic acid of a sample to be detected, positive control and negative control into the tube A and the tube B, and carrying out reverse transcription real-time fluorescence quantitative PCR reaction;
the fluorescent quantitative PCR instrument automatically draws a real-time amplification curve according to the detected fluorescent signal and calculates a sample Ct value;
and judging the validity of the experiment through the results of the internal standard control, the positive control and the negative control, and ensuring the accuracy of the results.
12. The method of claim 11, wherein the real-time fluorescent quantitative PCR amplification conditions are: the first step: reverse transcription reaction: 50 ℃ for 15min; and a second step of: pre-deformation: 95 ℃ for 2min; and a third step of: amplification: 95℃10s,58℃40s,40 cycles.
CN202211062516.XA 2022-09-01 2022-09-01 Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit Pending CN116479168A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211062516.XA CN116479168A (en) 2022-09-01 2022-09-01 Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211062516.XA CN116479168A (en) 2022-09-01 2022-09-01 Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit

Publications (1)

Publication Number Publication Date
CN116479168A true CN116479168A (en) 2023-07-25

Family

ID=87216042

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211062516.XA Pending CN116479168A (en) 2022-09-01 2022-09-01 Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit

Country Status (1)

Country Link
CN (1) CN116479168A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117487896A (en) * 2023-12-29 2024-02-02 清华大学 Antagonist, PCR premix containing same, PCR detection kit and PCR detection method

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117487896A (en) * 2023-12-29 2024-02-02 清华大学 Antagonist, PCR premix containing same, PCR detection kit and PCR detection method

Similar Documents

Publication Publication Date Title
CN110760620A (en) Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method
CN113502352B (en) EMA-ddPCR primer and probe for detecting infectious ASFV and application
CN114085903B (en) Primer pair probe combination product for detecting mitochondria 3243A &amp; gtG mutation, kit and detection method thereof
CN108866243B (en) Porcine enterocoronavirus 4-fold fluorescent quantitative PCR detection kit
CN113652505B (en) Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof
CN111349720A (en) Nucleic acid reagent, kit, system and method for detecting respiratory tract infection virus
CN111926116A (en) Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof
CN112739833A (en) Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof
US20190048393A1 (en) Method for qualitative and quantitative detection of microorganism in human body
CN113930529B (en) Nucleic acid fragment, primer probe set, kit and application thereof for detecting mycoplasma pneumoniae
CN111826464A (en) Primer probe for detecting multiple gastrointestinal viruses in one tube, screening method and kit
CN116479168A (en) Nucleic acid composition for detecting multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) of 5 diarrhea viruses, kit and use method of kit
CN112575118B (en) Method for simultaneously detecting various diarrhea viruses by using melting curve
CN109762932A (en) Identify the detection primer and probe, kit and application of HP-PRRSV and NADC30-like strain
CN114634996B (en) Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit
CN111378787A (en) Novel coronavirus detection method
CN114507752B (en) Kit for detecting Hancheng hantaan virus and detection method thereof
CN110923364B (en) Method for detecting multiple viruses in sample by utilizing multiple quantitative PCR technology
CN115323073A (en) Primer probe composition and kit for detecting human cytomegalovirus nucleic acid and use method thereof
JP6226460B2 (en) Nucleic acid quantification method, primer set used therein, DNA chip and assay kit, and method for determining resident bacteria using the same
CN113549709A (en) Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof
CN112680544B (en) RT-RPA primer, probe, kit and detection method for detecting II-type grass carp reovirus
CN114921588B (en) Targeting segment and primer set for detecting rhinovirus in sensing sample suitable for ONT sequencing platform and application thereof
CN114672593B (en) Primer group, product and application for detecting central nervous infection pathogen nucleic acid
CN114262758B (en) Kit for detecting novel coronavirus mutant strain and detection method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination