CN116472280A - Vaccine against SARS-CoV-2 infection - Google Patents

Abstract

Novel vaccines for prophylactic treatment of SARS-CoV-2 infection and COVID-19 and methods of making the vaccines are provided.

Description

Vaccine against SARS-CoV-2 infection

Cross Reference to Related Applications

The present application claims from U.S. provisional application 63/069,172 filed on 8/24/2020; U.S. provisional application 63/131,278 filed on 12/28/2020; U.S. provisional application 63/184,065 filed on 5/4 of 2021; and U.S. provisional application 63/201,848 filed on day 5 and 14 of 2021. The disclosures of the above-referenced priority applications are incorporated herein by reference in their entirety.

Federally sponsored research or development

The present invention is in HHSO100201600005I awarded by the United states department of health and public service (U.S. department of Health and Human Services) and ASPR-BARDA; and other transaction agreements (Other Transaction Agreement, OTA) W15QKN-16-9-1002 issued by the united states army contractual commander (u.s. Army Contracting Command) ACC-NJ and granted as a joint task between the health and public service department and the defense department, are completed with government support. The government has certain rights in this invention.

Sequence listing

The present application contains a sequence listing that has been electronically submitted in ASCII format and is hereby incorporated by reference in its entirety. The electronic copy name of the sequence listing created at month 8 and 23 of 2021 is 025532_wo003_sl. Txt and is 59,582 bytes in size.

Background

Coronaviruses are a family of enveloped, positive-sense single-stranded RNA viruses that infect a wide variety of mammalian and avian species. The viral genome is packaged in a capsid consisting of viral nucleocapsid (N) proteins and surrounded by a lipid envelope. Embedded in the lipid envelope are membrane (M) proteins, envelope small membrane (E) proteins, hemagglutinin Esterase (HE) and spike (S) proteins. The S protein mediates viral attachment and entry into cells.

Human coronavirus (hCoV) causes respiratory diseases. The low pathogenicity hCoV infects the upper respiratory tract and causes a mild cold. Highly pathogenic hCoV primarily infects the lower airways and can cause severe (and sometimes fatal) pneumonia, such as severe acute respiratory syndrome (SARS-CoV) and middle east respiratory syndrome (MERS-CoV). Severe pneumonia caused by hCoV is often associated with rapid viral replication, massive inflammatory cell infiltration, and elevated proinflammatory cytokines and chemokines, leading to acute lung injury and acute respiratory distress syndrome (see, e.g., channelappanavir and Perlman, semin Immunopathol (2017) 39 (5): 529-39).

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (also known as 2019 novel coronavirus (2019-nCoV)) is a seventh known human-infecting coronavirus following HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKU1, MERS-CoV and original SARS-CoV (Zhu et al, N Eng Med. (2020) 382 (8): 727-33). Like the SARS-associated coronavirus strain involved in the SARS outbreak in 2003, SARS-CoV-2 is a member of the subgenera (β -CoV lineage B) of sand Bei Bingdu (Sarbecovirus). SARS-CoV-2 is the cause of persistent 2019-21 coronavirus disease (COVID-19) (Chan et al, lancet (2020) 395 (10223): 514-23; xu et al, lancet Respir Med. (2020) doi:10.1016/S2213-2600 (20) 30076-X; genBank: MN908947.3; gorbalenya et al, bioRxiv (2020) doi: 10.1101/2020.02.07.937862). Human-to-human transmission occurs primarily via respiratory droplets and aerosols.

The clinical characteristics of covd-19 vary. In most cases, the infected individual may be asymptomatic or have mild symptoms. Among those symptomatic, typical manifestations include fever, coughing, shortness of breath, loss of sense of smell, and fatigue. More severe manifestations include acute respiratory distress syndrome, stroke, and cytokine release syndrome, leading to death in some cases. Serious diseases may occur in healthy individuals of any age, but mainly in elderly or medically co-morbid adults. Elderly people are most often affected and have a high mortality rate. Co-diseases and other conditions associated with severe disease and mortality include chronic kidney disease, chronic Obstructive Pulmonary Disease (COPD), immune-compromised status, obesity, severe heart conditions (e.g., heart failure, coronary artery disease, or cardiomyopathy), sickle cell disease, diabetes, hypertension, liver disease, and pulmonary fibrosis. The risk from the covd-19 varies throughout the world also from country to country and from regions within the country (see, e.g., de Souza, nat Hum behav. (2020) 4:856-865;Chen,Cell Death Dis. (2020) 11:438).

SARS-CoV-2 infects cells by binding to the Cell surface protein angiotensin converting enzyme 2 (ACE 2) (Hoffmann et al, cell (2020) 181 (2): 271-80; walls et al, cell (2020) 181 (2): 281-92). The virus gains access to the host cell via the S protein. The S protein is a class I fusion protein and is thickly coated with a polysaccharide, helping the virus to evade immune surveillance. The protein is produced by processing of a precursor S polypeptide. The precursor polypeptide undergoes glycosylation, removes the signal peptide, and is cleaved between residues 685 and 686 by the proprotein convertase furin to produce the two subunits S1 and S2. S1 and S2 remain associated as protomers. The S protein is a trimer of protomers, present in a metastable pre-fusion conformation. After binding of the S1 subunit to the host cell receptor, the S1 subunit is released from the protein. The remaining S2 subunit is converted to a highly stable post-fusion conformation and facilitates membrane fusion between the virus and the host cell, thus facilitating entry of the virus into the cell (see, e.g., wrapp et al, science (2020) 10.1126/Science. Abb2507; shang et al, PNAS (2020) 117 (21): 11727-34).

The S protein is a key target for vaccine development. Proteins in the pre-fusion conformation are expected to exhibit the most neutralizing epitopes (see, e.g., wrapp, supra). Successful immunization strategies require a stable antigen, and attempts to stabilize the SARS-CoV-2S protein in a pre-fusion conformation have been described (see, e.g., xiong et al, nat Struct Mol biol (2020) doi.org/10.1038/s 41594-020-0478-5).

Public health crisis caused by covd-19 continues to remain unabated, especially in developing countries. Variants of SARS-CoV-2 are constantly occurring. There remains an urgent need to develop effective vaccines that can help combat the persistent threat of covd-19.

Disclosure of Invention

The present disclosure provides an isolated polypeptide comprising from N-terminus to C-terminus (i) a sequence that is at least 94%, such as at least 95% (e.g., at least 96%, 97%, 98%, or 99%) identical to residues 19-1243 of SEQ ID No. 10, wherein residue GSAS (SEQ ID No. 6) at positions 687-690 of SEQ ID No. 10 and residue PP at positions 991 and 992 of SEQ ID No. 10 are maintained in said sequence; and (ii) a trimerization domain, wherein said trimerization domain may comprise SEQ ID NO. 7. In some embodiments, the polypeptide further comprises at its N-terminus a signal peptide derived from an insect or baculovirus protein (e.g., chitinase); in a further embodiment, the signal peptide comprises SEQ ID NO. 3. In certain embodiments, the polypeptide comprises or has the same sequence as (i) residues 19-1243 of SEQ ID NO:10 or (ii) residues 19-1240 of SEQ ID NO: 14.

In one aspect, the present disclosure provides a recombinant SARS-CoV-2S protein, wherein the protein is a trimer of the recombinant polypeptides herein. In some embodiments, the protein is a trimer of polypeptides having the same sequence as (i) residues 19-1243 of SEQ ID NO:10 or (ii) residues 19-1240 of SEQ ID NO: 14.

The present disclosure also provides a nucleic acid molecule encoding a recombinant polypeptide herein, optionally wherein the nucleic acid molecule comprises SEQ ID No. 9.

The present disclosure also provides a baculovirus vector for expressing the polypeptides herein. In some embodiments, expression of the polypeptide is under the control of a polyhedrin promoter in the baculovirus expression vector. The present disclosure further provides a method of producing a recombinant SARS-CoV-2S protein, the method comprising introducing the baculovirus vector into an insect cell, culturing the insect cell under conditions allowing expression and trimerization of the polypeptide, and isolating the recombinant SARS-CoV-2S protein from the culture, wherein the recombinant SARS-CoV-2S protein is a trimer of the polypeptide that does not contain a signal sequence. Also provided is a recombinant SARS-CoV-2S protein produced by the method.

The present disclosure further provides an immunogenic composition comprising one, two, three or more recombinant SARS-CoV-2S proteins described herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is phosphate buffered saline (e.g., comprising 7.5mM phosphate and 150mM NaCl,pH 7.2) and optionally a surfactant (e.g., polysorbate 20 at a concentration of, for example, 0.005% to 1% (such as 0.2%). In some embodiments, the composition comprises from about 2 μg to about 50 μg, such as from about 2 μg to about 45 μg, or from about 5 μg to about 50 μg (e.g., 2.5, 5, 10, 15, or 45 μg) of the or each of the recombinant S proteins (if more than one is included) (or along with "each of the one or more recombinant SARS-CoV-2S proteins" as used herein when referring to both monovalent and multivalent cases). Alternatively, the amount of protein described above is the total amount of protein in the composition. When a composition is said to have two or more proteins, it is intended that these proteins differ from each other.

In some embodiments, the immunogenic composition further comprises an adjuvant, wherein the adjuvant is an oil-in-water emulsion, and for each dose (at, for example, about 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, or 0.7 mL) of the immunogenic composition comprises or is prepared by mixing: (i) About 2 μg to about 50 μg, e.g., about 2 μg to about 45 μg or about 5 μg to about 50 μg (e.g., 2.5, 5, 10, 15 or 45 μg) of each of the one or more recombinant SARS-CoV-2S proteins; and (ii) one dose of adjuvant, wherein the volume of the adjuvant per dose is 0.25mL and comprises or is prepared by mixing: 12.5mg squalene, 1.85mg sorbitan oleate (monooleate), 2.38mg polyoxyethylene cetostearyl ether and 2.31mg mannitol in phosphate buffered saline (such as phosphate buffered saline containing 7.5mM phosphate and 150mM NaCl, pH 7.2). Alternatively, the amount of protein described above is the total amount of protein in the composition. In some embodiments, the composition comprises one (monovalent) or more (multivalent) different recombinant SARS-CoV-2S proteins. For example, the composition comprises two (bivalent), three (trivalent), or four (tetravalent) different recombinant SARS-CoV-2S proteins.

In some embodiments, an immunogenic composition herein comprises one, two, three or more recombinant SARS-CoV-2S proteins, and for each dose (at, for example, 0.2mL, 0.25mL, 0.3mL, 0.4mL, 0.5mL or 0.6 mL) of the composition comprises or is prepared by mixing: 2 μg to 50 μg, e.g., about 2 μg to about 45 μg or about 5 μg to about 50 μg (e.g., 2.5, 5, 10, 15 or 45 μg) of each of the one or more recombinant SARS-CoV-2S proteins, 0.097mg sodium phosphate monobasic, 0.65mg disodium phosphate dodecahydrate (or 0.26mg anhydrous disodium phosphate), 2.2mg sodium chloride, 50-600 (e.g., 55 or 550) μg polysorbate (e.g., polysorbate 20), and about 0.25mL water (sufficient added (qs. Ad) 0.25mL water). Alternatively, the amount of protein described above is the total amount of protein in the composition.

In some embodiments, the composition comprises 2.5 μg of each of the one or more recombinant SARS-CoV-2S proteins for every 0.25 or 0.5mL of the immunogenic composition, optionally wherein the composition comprises two different recombinant SARS-CoV-2S proteins. Alternatively, the amount of protein described above is the total amount of protein in the composition.

In some embodiments, the composition comprises 5 μg of each of the one or more recombinant SARS-CoV-2S proteins for every 0.25 or 0.5mL of the immunogenic composition, optionally wherein the composition comprises two different recombinant SARS-CoV-2S proteins. Alternatively, the amount of protein described above is the total amount of protein in the composition.

In some embodiments, the composition comprises 10 μg of each of the one or more recombinant SARS-CoV-2S proteins for every 0.25 or 0.5mL of the immunogenic composition, optionally wherein the composition comprises an equal amount of two different recombinant SARS-CoV-2S proteins. Alternatively, the amount of protein described above is the total amount of protein in the composition.

In some embodiments, the volume of the immunogenic composition per dose is 0.25mL in the absence of adjuvant or 0.5mL in the presence of adjuvant.

In some embodiments, the immunogenic composition comprises a recombinant SARS-CoV-2S protein comprising residues 19-1243 of SEQ ID NO. 10 and/or a recombinant SARS-CoV-2S protein comprising residues 19-1240 of SEQ ID NO. 14.

The present disclosure also provides an article of manufacture, such as a container, comprising the immunogenic composition herein. In some embodiments, the container contains a single dose of the immunogenic composition, e.g., contains 0.25mL or 0.5mL of the immunogenic composition. In some embodiments, the container is a pre-filled disposable syringe. In other embodiments, the container contains multiple doses of the immunogenic composition.

The present disclosure also provides a kit for intramuscular vaccination, wherein the kit comprises two containers, wherein the first container contains a pharmaceutical composition comprising the recombinant SARS-CoV-2S protein and the second container contains an adjuvant. The second container does not contain both tocopherol and squalene or the adjuvant AS03. In some embodiments, the first container comprises one or more doses of the one or more recombinant SARS-CoV-2S proteins, wherein each dose of the one or more proteins is about 2 to 50, 2 to 45, or 5 to 50 (e.g., 2.5, 5, 10, 15, 20, 30, 40, or 45) μg (total or alone) provided in 0.25mL of phosphate buffered saline, optionally comprising (i) 7.5mM phosphate and 150mM NaCl,pH 7.2, optionally the PBS comprises 0.005% -1% (e.g., 0.2%) polysorbate 20; or (ii) 0.0975mg of sodium dihydrogen phosphate, 0.26mg of anhydrous disodium hydrogen phosphate, 2.2mg of sodium chloride, 50-600 (e.g., 55 or 550) μg of polysorbate (e.g., polysorbate 20), and about 0.25mL of water (0.25 mL of water added in sufficient quantity). In some embodiments, each antigen dose comprises 2.5, 5, 10, 15, 20, 30, 40, or 45 μg of one or more recombinant SARS-CoV-2S proteins (if more than one protein, collectively or individually), optionally wherein the antigen dose comprises (i) a recombinant SARS-CoV-2S protein comprising residues 19-1243 of SEQ ID NO:10, (ii) a recombinant SARS-CoV-2S protein comprising residues 19-1240 of SEQ ID NO:14, or (iii) both (i) and (ii).

In some embodiments, the second container comprises one or more doses of the adjuvant, wherein the volume of the adjuvant per dose is 0.25mL and comprises 12.5mg squalene, 1.85mg sorbitan monooleate, 2.38mg polyoxyethylene cetostearyl ether, and 2.31mg mannitol in phosphate buffered saline, e.g., comprising 7.5mM phosphate, 150mM NaCl,pH 7.2, and optionally polysorbate (e.g., polysorbate 20). The present disclosure further provides a method of making a vaccine kit comprising providing the antigenic component and/or the adjuvant component of the immunogenic compositions herein and packaging them into a sterile container. In some embodiments, the method comprises providing a recombinant S protein and an adjuvant of the immunogenic composition and packaging the protein and the adjuvant into separate sterile containers.

The disclosure further provides a method of preventing or ameliorating covd-19 in a subject (e.g., a human subject) in need thereof, the method comprising administering to the subject a prophylactically effective amount of the immunogenic composition. In some embodiments, the prophylactically effective amount may be administered in a single dose or in two or more doses. In some embodiments, the prophylactically effective amount is about 2 to 50 μg per dose, optionally 5, 10, 15, or 45 μg per dose of the one or more recombinant SARS-CoV-2S proteins (if more than one protein, collectively or individually), administered intramuscularly in a single dose or in two or more doses. In some embodiments, the method comprises administering to the subject two doses of the immunogenic composition at intervals of about two weeks to about three months, wherein each dose of the immunogenic composition comprises a total of 5 μg or 10 μg of the one or more recombinant SARS-CoV-2S proteins. The interval may be, for example, about three weeks or about 21 days, or about four weeks or about 28 days, or about one month.

In some embodiments, prior to the administering step, the subject may have been infected with SARS-CoV-2 (e.g., progressive COVID-19) or has been vaccinated with the first COVID-19 vaccine. In some embodiments, the subject may have been vaccinated with a genetic or subunit vaccine, or an inactivated vaccine, prior to the administering step. In some embodiments, prior to the administering step, the subject has been vaccinated with a genetic vaccine comprising mRNA encoding the recombinant SARS-CoV-2S antigen. In some embodiments, the administering step may be performed after infection (e.g., after recovery) or 4 weeks, one month, three months, six months, or one year after the subject is vaccinated with the first covd-19 vaccine.

In some embodiments, in the methods herein, the immunogenic composition can comprise 2.5 or 5 μg of each of the one or more recombinant SARS-CoV-2S proteins with or without an adjuvant.

In some embodiments, the immunogenic compositions of the invention are used as booster vaccines for subjects previously infected with SARS-CoV-2 or subjects who have been vaccinated against the same or a different strain of virus first COVID-19 vaccine. The first vaccine may be an inactivated vaccine, a subunit vaccine, or a genetic vaccine (e.g., an mRNA vaccine or a viral vector vaccine). In further embodiments, the genetic vaccine comprises mRNA encoding a recombinant SARS-CoV-2S antigen, optionally wherein the recombinant SARS-CoV-2S antigen comprises SEQ ID NO. 1, 4, 10, 13 or 14 or an antigenic fragment thereof. In certain embodiments, the subject is administered an immunogenic composition of the invention about 4 weeks, about one month, about two months, about three months, about four months, about five months, about six months, about seven months, about eight months, about nine months, about ten months, about eleven months, about one year or more after infection or after the subject is vaccinated with the first covd-19 vaccine. In some embodiments, the time to boost is about four to about ten months (e.g., about eight months) after infection (e.g., after recovery from covd-19) or after the initial vaccination.

Also provided herein is the use of the recombinant protein or the immunogenic composition for the manufacture of a medicament for prophylactic treatment of covd-19, optionally for use in a method as disclosed herein, and the recombinant protein or the immunogenic composition for use in prophylactic treatment of covd-19, optionally for use in a method as disclosed herein.

Other features, objects, and advantages of the invention will be apparent from the detailed description that follows. However, it should be understood that the detailed description, while indicating embodiments and aspects of the invention, is given by way of illustration only and not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description.

Drawings

FIG. 1 is a diagram showing the design of construct 1 containing a baculovirus expression cassette for recombinant SARS-CoV-2S protein. The expression cassette includes a polyhedrin promoter and a coding sequence for a polypeptide containing a chitinase signal sequence ("ss") and a mutation at a putative furin cleavage site at the S1/S2 junction and a biproline substituted SARS-CoV-2S protein ectodomain in the S2 subunit. FIG. 1 discloses SEQ ID NOs 5 and 6, respectively, in the order of appearance.

FIG. 2A is a schematic diagram depicting the assembly of the SapI digested pPSC12DB-LIC transfer plasmid with synthetic gBlock fragments. The SapI linearized transfer plasmid is shown in gray, the polyhedrin promoter is shown in green arrow, the gBlock fragment is colored yellow, blue and orange, and the respective overlapping sequences are depicted in the same color (upper panel). The final transfer plasmid containing the preS dTM gene is shown in the following figure.

FIG. 2B shows the 5 'and 3' terminal sequences of the gBlock fragments (SEQ ID NOS: 15-24, respectively, in order of appearance).

FIG. 3 is a schematic diagram showing a method for producing a baculovirus construct expressing the recombinant SARS-CoV-2S protein. MV: and (3) a main virus.

FIG. 4 is a graph showing serum S-specific IgG levels for D21 and D36 in D0/D21-injected presdTM and S dTM without adjuvant mice. Titer was expressed as the reciprocal of the dilution with od=0.2. EU: ELISA units. preS dTM: a recombinant stable prefusion SARS-CoV-2S protein (SEQ ID NO: 10) lacking a transmembrane domain and a cytoplasmic domain. S dTM: a recombinant non-stable SARS-CoV-2S protein lacking a transmembrane domain and a cytoplasmic domain.

Fig. 5 is a graph showing the effect of adjuvant AF03 on S-specific IgG levels in injected mice on days 21 and 36. Titer was expressed as the reciprocal of the dilution with od=0.2. Light colored shape: day 21. Dark colored shape: day 36.

FIG. 6A is a graph showing the neutralization titer of SARS-CoV-2 infection in D36 in Swiss Webster mice in the absence or presence of AF03 elicited by the preS dTM vaccine. Neutralization to reduce neutralization titers of 50% at D36 of serum antibodies obtained from immunized mice (PRNT ₅₀ ) And (3) representing. The lower horizontal dashed line indicates the lower limit of quantitation (LLOQ), i.e. 1/2 of the initial dilution. The upper horizontal dashed line indicates the upper limit of quantitation (ULOQ), i.e. the highest dilution tested. The Y-axis shows the endpoint dilution of the 50% decrease in the number of viral plaques counted on the cell monolayer.

FIG. 6B is a graph showing the individual S-specific IgG elicited by preS dTM vaccine in D36 in Swiss Webster mice in the absence or presence of AF03 ₁ And IgG _2a Titer (Log) ₁₀ EU). Bar = average. Horizontal dash-dot line = LLOQ.

FIG. 6C is a graph showing the individual S-specific IgG elicited by preS dTM vaccine in the presence of AF03 in D36 in Swiss Webster mice _2a /IgG ₁ Plot of ratio (x 100).

FIG. 6D is a graph showing the S1 specificity elicited by presdTM vaccine in the presence of AF03 in D36 in BALB/c miceSex CD4 ⁺ Graph of T cell response. Strip: average%.

FIG. 7 is a graph showing serum IgG levels against SARS-CoV-2 pre-fusion S protein in rhesus monkeys immunized with target doses of 5 or 15 μg of preS dTM with or without AF03 adjuvant. IgG levels were measured at D0, D21 and D28. The "-" on the X-axis indicates vehicle control. The vehicle was PBS (phosphate buffered saline). The Y-axis represents log scale of EU.

FIG. 8 is a graph showing the neutralization titers of SARS-CoV-2 infection in rhesus monkeys by the preS dTM vaccine in the absence or presence of AF03 at D21 and D28. 50% Inhibitory Concentration (IC) of neutralizing antibody ₅₀ ) Titers were measured against Integral Molecular SARS-CoV-2S pseudoviruses exhibiting SARS-CoV-2S protein from the same study as FIG. 7. The Y-axis represents IC ₅₀ Log of titer ₁₀ Values. "Conv": human SARS-CoV-2 convalescence serum (high titer).

FIG. 9 is an analysis of MIMIMIIC CD4 in vitro ⁺ S-specific CD4 elicited by presdTM vaccine in human PBMC from 50 human donors as measured in lymphoid tissue equivalent (lymphoid tissue equivalent, LTE) assay ⁺ A set of graphs of Th1 profiles. Secretion of TNF-alpha, IFN-gamma and IL-2 was analyzed. The figure shows that CD4 secretes three cytokines relative to the epidemic-free condition ⁺ CD154 ⁺ Percentage of cells.

FIG. 10 is an analysis of MIMIMIIC CD4 in vitro ⁺ S-specific CD4 elicited by presdTM vaccine in human PBMC from 50 human donors measured in LTE assay ⁺ A set of graphs of Th2 profiles. Secretion of IL-4, IL-5 and IL-17 was analyzed. The figure shows that CD4 secretes three cytokines relative to the epidemic-free condition ⁺ CD154 ⁺ Percentage of cells.

FIG. 11 is a pair of graphs showing the decrease in neutralization titer of D90 in NHP after vaccination with mRNA-VAC2, an mRNA COVID-19 vaccine with lipid nanoparticle formulation. At D0 and D21, each group of cynomolgus monkeys (n=4) was vaccinated with 15, 45 or 135 μg of mRNA-VAC2 per dose, and serum samples collected at indicated time points were assayed for neutralization in pseudovirus (PsV) (panel a) and for minimal neutralization (M)N) the test was performed in the assay (panel b). Each symbol represents an individual sample and the line represents the geometric mean of the group. Neutralization titer of the sample (shown as ID ₅₀ ) Defined as the reciprocal of the highest test serum dilution at which viral infectivity was reduced by 50% when compared to the assay challenge virus dose. PsV and MN titers of 93 human Conv sera were shown on the same Y-axis scale as the other samples, respectively.

FIG. 12 is a graph showing the robust neutralization of D3, 14, 28, 42 after boosting with AF 03-adjuvanted presdTM (rAG/AF 03) D123. Each group of cynomolgus monkeys (n=4) was previously vaccinated with 15, 45 or 135 μg of mRNA-VAC2 per dose at D0 and D21. At D123, six NHPs from all priming dose groups were randomized and boosted with 3 μg of rAg/AF03 (n=6). Three control untreated NHPs were immunized with 3. Mu.g of rAG/AF 03. Serum samples collected 3 days prior to immunization (D-3), 14, 28 and 42 days after immunization were tested in the MN assay. Each symbol represents an individual sample and the line represents the geometric mean of the group. Neutralization titer of the sample (shown as ID ₅₀ ) As defined in fig. 11.

FIG. 13 is a graph showing robust binding antibody response after boosting with rAG/AF 03D 123. Each group of cynomolgus monkeys (n=4) was vaccinated with 15, 45 or 135 μg of mRNA-VAC2 per dose at D0 and D21. At D123, 12 NHPs from all dose groups were randomly grouped and boosted with 3 μg of rAg/AF03 (n=6). Three control untreated NHPs were immunized with 3. Mu.g of rAG/AF 03. Serum samples collected 3 days prior to immunization (D-3), 14, 28 and 42 days after immunization were tested in the MN assay. Each symbol represents an individual sample and the line represents the geometric mean of the group. Neutralization titer of the sample (shown as ID ₅₀ ) As defined in fig. 11.

FIG. 14 is a set of graphs showing the profile of T cell cytokines obtained from PBMC from mRNA-VAC 1-vaccinated NHPs. PBMCs collected at D42 (21 days after the second mRNA-VAC1 injection) were incubated overnight with the SARS-CoV-2S protein peptide pool representing the entire S open reading frame. The frequency of PBMC secreting IFN-gamma (left panel) or IL-13 (right panel) was calculated as Spot Forming Cells (SFC) per million PBMC. Each symbol represents an individual sample and the bars represent the geometric mean of the group. The dash-dot line indicates the lower limit of quantification.

FIG. 15 is a set of graphs showing the T cell cytokine profile obtained with D171 PBMC from NHP vaccinated with mRNA-VAC1 (at D0 and D21) and boosted with rAG/AF03 at D129. PBMCs collected at D42 after booster vaccination were incubated with two peptide pools representing the entire S open reading frame. The response of IFN-gamma (upper panel) or IL-13 (lower panel) secreting PBMC was calculated as SFC per million PBMC. Each symbol represents an individual sample and the bars represent the geometric mean of the group. The dash-dot line indicates the lower limit of quantification.

Detailed Description

The present disclosure provides immunogenic compositions having protective effects against covd-19. The composition comprises a recombinant protein derived from SARS-CoV-2S protein and expressed in a baculovirus/insect cell expression system. The recombinant protein may comprise an extracellular portion of an S protein (e.g., all or part of an S protein extracellular domain) while lacking all or part of the transmembrane and cytoplasmic domains of the S protein. The recombinant protein comprises three identical subunit polypeptides (i.e., homotrimers), each subunit polypeptide containing a trimerization motif optimized for expression in a baculovirus/insect cell system that facilitates trimerizing the three subunit polypeptides in a stable native pre-fusion trimeric configuration. The immunogenic composition may comprise squalene-based AF03 adjuvant (hereinafter referred to as "AF 03").

The immunogenic compositions herein can be used to prevent symptomatic covd-19 in a human subject not infected with SARS-CoV-2, to prevent moderate to severe covd-19 (e.g., to prevent hospitalization or death), to prevent asymptomatic infection, to elicit immunogenicity against homologously matched strains, to reduce viral load, and/or to protect against circulating variant strains. Unless otherwise indicated, a SARS-CoV-2 "variant" refers to a SARS-CoV-2 strain that has an amino acid difference in the S protein relative to the original Whan strain (or "D614 strain"; SEQ ID NO: 1).

As used herein, the terms "immunogenic composition," "vaccine" and "vaccine composition" are interchangeable and refer to compositions that contain components that can elicit prophylactic protection against SARS-CoV-2 infection, including alleviation of the symptoms of covd-19 and improvement of recovery and survival from disease.

As used herein, the percent identity between two amino acid sequences refers to the percentage of amino acid residues in a query sequence that are identical to residues in a reference sequence when the query sequence and the reference sequence are aligned for maximum identity. The homologous sequence can have the same or a shorter length than the reference sequence (e.g., have at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of the length of the reference sequence).

I.Antigenic component of immunogenic compositions

The immunogenic compositions of the present disclosure comprise recombinant SARS-CoV-2S protein. The recombinant proteins are stabilized to maintain a native pre-fusion trimeric conformation on the viral envelope.

The SARS-CoV-2S protein has 1273 amino acid residues. The amino acid sequence of the S protein is available under NCBI accession number YP_ 009724390. The sequence is shown below. The signal sequence is boxed (MFVFLVLLPLVSS (SEQ ID NO: 2)), and the transmembrane domain and intracellular domain are underlined. S1 and S2 are linked between residues 685 and 686, which are shown in bold and underlined.

The recombinant S proteins herein consist of three identical polypeptides (herein "recombinant S polypeptides"). Prior to maturation, each recombinant S polypeptide may comprise a signal sequence suitable for expressing the protein in an insect cell. For example, the signal sequence is derived from an insect or baculovirus protein. The signal sequence may also be an artificial signal sequence. In some embodiments, the signal sequence is derived from an insect or baculovirus protein, such as chitinase and GP64. Exemplary chitinase signal sequences are wild-type chitinase signal sequences

MLYKLLNVLW LVAVSNA(SEQ ID NO:11)

Or mutant chitinase signal sequences

MPLYKLLNVL WLVAVSNA(SEQ ID NO:3)。

Sequences homologous (e.g., at least 95%, 96%, 97%, 98%, or 99% identical) to the chitinase signal sequence may also be used, so long as the signal peptide function is retained. See also U.S. patent 8,541,003.

The recombinant S proteins herein comprise the SARS-CoV-2S protein ectodomain sequence, e.g., a sequence corresponding to residues 14 through 1,211 of SEQ ID NO. 1. Exemplary SARS-CoV-2S protein ectodomain sequences are shown below:

in some embodiments, the recombinant S protein may comprise the sequence of SEQ ID NO. 4, if there are NO certain amino acid substitutions as further described herein, and is at least 99% (e.g., at least 99.5%, 99.6%, 99.7%, 99.8%, 99.9%) identical to SEQ ID NO. 4. In further embodiments, residues 669-672 of SEQ ID NO. 4 (bold) are changed to residue GSAS (SEQ ID NO. 6) and/or residues 973 and 74 of SEQ ID NO. 4 (underlined) are changed to residue PP.

In some embodiments, the recombinant S protein comprises one or more common mutations found in variants circulating in the COVID-19 pandemic. One such mutation is the D614G mutation (numbered according to SEQ ID NO: 1) which is associated with most of the current COVID-19 incidences worldwide. Other mutations that may be included in the recombinant S protein may be one or more of the following: W152C, K417T/N, N440K, V445I, G446A/S, L452R, Y453F, L455 456L, A475V, G476S, T I/K/A, V483A/F/I, E484Q/K/D/A, F490S/L, Q493L/R, S494P/L, Y495N, G496L, P499H, N501Y, V503F/I, Y505W/H, Q506H/K and P681H mutations (numbering according to SEQ ID NO: 1). In some embodiments, the recombinant S protein may include one or more of mutations N440K, T479I/K/a and D614G.

In some embodiments, the recombinant S protein comprises one or more mutations found in SARS-C oV-2 variants such as: b.1.1.7 (British or alpha variants; e.g., N501Y/P681H/H69/V70 deleted), B.1.351 (south Africa or beta variants; e.g., K417N/E484K/N501Y), B.1.617 (India or delta variants; e.g., L452R/E484Q mutation), P.1 (Brazil or gamma variants; e.g., K417T/E484K/N501Y) and CAL.20C strains (also known as B.1.429; california or epsilon variants; e.g., W152C/L452R).

The ectodomain sequence in the recombinant S protein may be modified to improve expression of the protein in a host cell (e.g., an insect cell) and stability of the produced protein. In some embodiments, the S ectodomain sequence contains a mutation at the junction of the S1 subunit and the S2 subunit that removes a proprotein convertase (PPC) motif (furin cleavage site). For example, the sequence RRAR (SEQ ID NO:5; residues 682-685 corresponding to SEQ ID NO: 1) at the furin cleavage site was changed to GSAS (SEQ ID NO: 6). Such mutations help preserve the pre-fusion conformation of the native S protein.

In some embodiments, the ectodomain sequence contains additional mutations that help maintain the recombinant S protein in a more stable conformation to facilitate antigen presentation of the pre-fusion epitope that is more likely to lead to neutralization. For example, amino acids (KV) corresponding to residues 986 and 987 of SEQ ID NO. 1 are mutated to PP (see, e.g., wrapp, supra; kirchdoerfer et al, sci Rep. (2018) 8:15701; xiong, supra).

The recombinant S proteins herein comprise a trimerization domain in the C-terminal region that is optimized for expression in baculovirus/insect cell expression systems, such that the S proteins can adopt a stable pre-fusion conformation of the native S protein. A folding subdomain coding sequence can be inserted between the last codon and the stop codon of the S ectodomain coding sequence. In some embodiments, the trimerization domain is derived from a folding subdomain of T4 bacteriophage secondary fibrin (fibritin) (see, e.g., meier et al, J Mol biol. (2004) 344 (4): 1051-69; WO 2018/081318). An exemplary folding subsequence is shown below:

GYIPEAPRDG QAYVRKDGEW VFLSTFL(SEQ ID NO:7)。

in some embodiments, the folding subsequence may be optimized to enhance expression of the recombinant protein in a host cell. For example, to enhance expression of the recombinant protein in insect cells (e.g., spodoptera (Spodoptera) cells), the sequence encoding the folded subsequence may be codon optimized. The natural coding sequence (upper) and codon optimized version (lower) of the folded subdomain are shown below (nucleotide point mutations marked with asterisks):

the recombinant S protein may comprise a tag (e.g., his tag, FLAG tag, HA tag, myc tag, or V5 tag) to facilitate purification.

In some embodiments, the recombinant S protein may be a trimer of polypeptides having the following sequences, but does not contain a signal sequence once processed and assembled. In the sequences below, the signal sequences (residues 1-18) are underlined, the folding subsequences (residues 1217-1243) are double-underlined, and mutations (artificially introduced) relative to the wild-type sequence are shown in bold and underlined (residues 687-690 and 991-992). This protein is also referred to herein as "preS dTM" or "D614 preS dTM".

Sequences homologous to SEQ ID NO. 10 may also be used. For example, sequences thereof can be used with SEQ ID10 at least 95% (e.g., at least 96%, 97%, 98%, or 99%) of the same recombinant S polypeptide. The homologous sequence may have the same length as SEQ ID NO. 10 or be NO more than 10% (e.g., NO more than 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1%) shorter or longer than SEQ ID NO. 10. In a further embodiment, residues GSAS (SEQ ID NO: 6) at positions 687-690 of SEQ ID NO:10 and/or residues PP at positions 991 and 992 of SEQ ID NO:10 are maintained in such homologous sequences. The percentage identity of two amino acid sequences can be determined, for example, by Obtained using default parameters available on the national center for biotechnology information (U.S. national Library of Medicine's National Center for Biotechnology Information) website of the national medical library.

In some embodiments, variants of preS dTM (also referred to herein as "preS dTM variants") are used, i.e., recombinant S proteins that contain one or more amino acid differences relative to SEQ ID No. 10 (e.g., outside the signal sequence region). In a further embodiment, the recombinant S protein is derived from south africa or beta variant b.1.351. This variant contains the following mutations (relative to the martial strain or SEQ ID NO: 1): (i) in the NTD domain: L18F, D80A, D G, L242del, a243del and L244del; (ii) in the RBD domain: K417N, E484K, N501Y; (iii) in the S1 domain: D614G; and (iv) a701V. The S protein may comprise the following sequence (SEQ ID NO: 14), which is free of signal sequences (underlined; residues 1-18) once processed and secreted from the producer cell. The T4 folding subsequence (residues 1214-1240) is double underlined; the variation relative to SEQ ID NO 10 is framed and bolded; and the artificially introduced mutations (residues 684-687 and residues 988-989) are underlined and bolded. In contrast to the S protein derived from the Wuhan strain, this protein has a three residue "LAL" deletion immediately following the "FQTL" at positions 243-246 below.

In some embodiments, the immunogenic compositions of the invention are multivalent (e.g., bivalent, trivalent, or tetravalent). That is, the composition comprises a plurality (e.g., two, three, or four) different recombinant S proteins. The recombinant S proteins in one or more of the multivalent compositions can comprise one or more mutations found in SARS-CoV-2 variants, such as D614G and mutations found in the newly emerged variant strains (e.g., b.1.1.7, b.1.351, b.1.617, p.1, and cal.20 c).

In some embodiments, the immunogenic compositions of the invention are bivalent. In a further embodiment, the bivalent composition comprises a first recombinant S protein derived from a strain of wuhan and a second recombinant S protein derived from a strain of south africa. In certain embodiments, the bivalent composition comprises a recombinant S protein comprising SEQ ID NO. 10 that does not contain a signal sequence and a recombinant S protein comprising SEQ ID NO. 14 that does not contain a signal sequence.

II.Adjuvant component of immunogenic compositions

The immunogenic compositions of the invention may comprise adjuvants having pharmaceutically acceptable ingredients. The immunogenic compositions of the invention do not comprise both tocopherol and squalene. The immunogenic composition of the invention also does not comprise the adjuvant AS03 (an oil-in-water emulsion comprising tocopherol and squalene; see, for example, WO2006/100109; Et al, expert Rev Vaccines (2012) 11:349-66; cohet et al, vaccine (2019) 37 (23): 3006-21). The adjuvant enhances the magnitude and quality of the immune response to the recombinant S protein. In some embodiments, the immunogenic compositions of the invention may employ an oil-in-water (O/W) emulsion adjuvant that contains squalene but no tocopherol. The adjuvant may promote balanced Th1/Th 2T helper responses. See, for example, U.S. patent nos. 8,703,095, 9,327,021 and 9,504,659.

Squalene is a compound of empirical formula C having six double bonds ₃₀ H ₅₀ Is an oil of (a). Such a kind ofThe oil is metabolizable and of a quality required for injectable pharmaceutical products. It is derived from shark liver (animal origin), but may also be extracted from olive oil (plant origin). The amount of squalene used to prepare the concentrated emulsion may be between 0.5% and 5% (e.g., 2.5%).

The O/W squalene based adjuvant comprises a nonionic hydrophilic surfactant, wherein the hydrophilic-lipophilic balance (HLB) value is not less than 10. Examples of such surfactants are polyoxyethylene alkyl ethers (PAE or POE), also known as polyoxyethylated fatty alcohol ethers, or n-alcohol polyethylene glycol (polyoxyethylene glycol) ethers, or polyethylene glycol (macrogol) ethers. These nonionic surfactants are obtained by chemical condensation of fatty alcohols and ethylene oxide. They have the general chemical formula CH ₃ (CH ₂ ) _x -(O-CH ₂ -CH ₂ ) _n -OH, wherein "n" represents the number of ethylene oxide units (typically 10-60), and (x+1) is the number of carbon atoms in the alkyl chain, typically 12 (lauryl (dodecyl)), 14 (myristyl (tetradecyl)), 16 (cetyl (hexadecyl)) or 18 (stearyl (octadecyl)), so "x" ranges from 11 to 17. POE tend to be a mixture of polymers with slightly different molecular weights. Thus, the emulsion may comprise a mixture of POE, thus, herein references are made to suitable POE for use in the emulsion, the ether being the main but not necessarily the only POE present in the emulsion. POE suitable for use may be in liquid form or in solid form at ambient temperature. Suitable solid compounds are those which dissolve directly in the aqueous phase or do not require continuous heating. Lauryl, myristyl, cetyl, oleyl and/or stearyl alcohols may be used herein provided that the number of ethylene oxide units is sufficient. Examples of POE are cetostearyl alcohol polyether-12 (e.g.,b1) Cetostearyl alcohol polyether-20 (e.g.)>B2) Stearyl alcohol polyether-21 (e.g.)>S21), cetyl polyether-20 (e.g., simulsol ^TM 58 or->58 Cetyl polyether-10 (e.g., +) >56 Stearyl alcohol polyether-10 (e.g.)>76 Stearyl alcohol polyether-20 (e.g., +)>78 Oleyl polyether-10 (e.g.)>96 or 97) and oleyl polyether-20 (-/-)>98 or 99), wherein each chemical name has a number corresponding to the number of ethylene oxide units in the formula.

The O/W squalene based emulsion adjuvant further comprises a nonionic hydrophobic surfactant. Suitable surfactants in this regard include, for example, sorbitan esters or sorbitan esters. They are hydrophobic surfactants having a total HLB of less than 9 (e.g., less than 6). Examples are SPAN (ICI Americas Inc; e.g. SPAN 80 or sorbitan monooleate), dehypul ^TM (Cognis; for example,SMO (sorbitan oleate)), arlacel ^TM (ICI Americas Inc) and Montane ^TM (Seppic; e.g. MONTANE) ^TM 80). Useful anhydromannitol esters include, for example, anhydromannitol monooleate (e.g., sigma; or Seppic MONTANIDE) ^TM 80)。

The O/W (e.g., squalene) emulsion adjuvant has an aqueous phase comprising water and, in some embodiments, a salt. The aqueous phase may for example be a buffer solution containing phosphate, acetate, citrate, succinate or histidine. The buffer solution may have a pH between about 6.4 and about 9 (e.g., a pH of about 6.8 to about 7.5, such as 7.0, 7.2, or 7.4).

In some embodiments, the O/W (e.g., squalene) emulsion adjuvant may comprise a toll-like receptor (TLR) agonist (e.g., TLR4 agonist ER804057 or E6020), a polyol (e.g., sorbitol, mannitol, glycerol, xylitol, or erythritol), and/or a mineral salt (e.g., an aluminum salt such as aluminum hydroxide, aluminum potassium sulfate, and aluminum phosphate; a calcium salt; or an iron salt).

The O/W (e.g., squalene) emulsion adjuvants may be prepared by a phase transition temperature (PIT) method that produces a monodisperse emulsion with small (e.g., submicron) droplet sizes, making the emulsion highly stable and easily filterable by means of a sterile filter. The method includes a step of obtaining a W/O inverse emulsion by increasing the temperature and a step of converting the W/O inverse emulsion into an O/W emulsion by decreasing the temperature. This transformation occurs when the resulting W/O emulsion is cooled to a temperature below the phase transition temperature of the emulsion. The O/W emulsion produced by this method is considered "thermoreversible".

Generally, the thermoreversible emulsions used herein are homogeneous. The term "homogeneous emulsion" refers to an emulsion in which the graphical representation of the size distribution of oil droplets ("particle map") is unimodal. Typically, this graphical representation is of the "Gaussian" type. In some embodiments, at least 90% of the population has a size of no greater than 200nM (e.g., 50-200nM, 75-175nM, 75-150nM, 75-125nM, 75-100nM, 80-120nM, or 90-110 nM) by volume of the oil droplets of the emulsion. Typically, at least 50% (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) of the population has a size no greater than 110nm by volume of the oil droplets of these emulsions. According to a particular feature, at least 90% of the population by volume of the oil droplets has a size of no more than 180nm, and at least 50% (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%) of the population by volume of the oil droplets has a size of no more than 110 nm. The size of the droplets may be measured by various means, such as a laser diffraction particle size analyzer, such as a Beckman Coulter device of the LS series (e.g., LS 230) or a Malvern device of the Mastersizer series (e.g., mastersizer 2000).

In certain embodiments, the adjuvant is an AF03 adjuvant. AF03 is a squalene based O/W emulsion (Klucker et al, J Pharm Sci. (2012) 101 (12): 4490-500; rudic ell et al, vaccine (2019) 37 (42): 6208-20; ruat et al, J Virol. (2008) 82 (5): 2565-9). For every 0.25mL of AF03, the adjuvant contains 12.5mg squalene, 1.85mg sorbitan monooleate (e.g., dehypuls SMO) ^TM ) 2.38mg of POE (12) cetostearyl ether (e.g., kolliphor CS 12) ^TM ) 2.31mg mannitol in Phosphate Buffered Saline (PBS) (7.5 mM phosphate, 150mM NaCl; pH 7.2) to a volume of 0.5 mL. See also U.S. patent 8,703,095 and WO2007/006939.AF03 can be obtained by the PIT method and has an average droplet size of about 100nM, or more than 60% (e.g., about 85%) of its droplets are no greater than 100nM. In some embodiments, a single dose of AF03 for intramuscular injection (e.g., for an adult) is 0.25mL. See also table 9 below. A single dose of AF03 may be mixed with a single dose of antigen component provided in the same liquid volume to reach a final volume of 0.5mL for e.g. intramuscular injection.

One potential safety issue with coronavirus vaccines is the ability to enhance vaccine immunopathology after exposure to wild-type virus (Smatti et al, front microbiol. (2018) 9:2991). The molecular mechanism of this phenomenon (known as antibody-dependent enhancement or immunopotentiation of viral infection) is not yet fully understood. In the context of coronavirus infection, a number of factors are thought to lead to this phenomenon. These factors include the epitope targeted, the method of antigen delivery, the magnitude of the immune response, the balance between binding and functional antibodies, the eliciting of antibodies with functional characteristics such as binding to specific Fc receptors, and the nature of T helper cell responses (Tseng et al, PLoS One (2012) 7 (4); yasui et al, J immunol (2008) 181 (9): 6337-48; czub et al, vaccine (2005) 23 (17-18): 2273-9). It is expected that formulations comprising adjuvanted agents comprising adjuvants such as AF03 will further enhance the magnitude of the neutralising antibody response and thus alleviate the antibody dependence enhancement of viral infections, which is believed to be mediated primarily by non-neutralising antibodies.

III.Production of recombinant S proteins

The viral antigen component of the immunogenic compositions of the invention may be produced by recombinant techniques in insect cells (e.g., drosophila (Drosophila) S2 cells, spodoptera frugiperda (Spodoptera frugiperda) cells, sf9 cells, sf21, high Five cells, or expansSF+ cells) that have been transduced with a baculovirus expression vector, such as an expression vector derived from Spodoptera frugiperda nuclear polyhedrosis virus (Autographa californica multiple nucleopolyhedrovirus, acMNPV). Baculoviruses (such as AcMNPV) form large protein crystal inclusions within the nucleus of infected cells, with a single polypeptide called polyhedrin accounting for about 95% of the protein mass. The polyhedrin gene is present in a single copy in the baculovirus genome and can be easily replaced by exogenous genes, as it is not necessary for viral replication in cultured cells. Recombinant baculoviruses expressing a foreign gene (such as the recombinant S polypeptide) are constructed by homologous recombination between the baculovirus genomic DNA and a transfer plasmid containing the foreign gene.

In certain embodiments, the transfer plasmid contains an expression cassette for the recombinant S polypeptide, wherein the expression cassette is flanked by sequences that naturally flank the polyhedrin locus in AcMNPV (fig. 1). Co-transfecting the transfer plasmid with baculovirus genomic DNA into a host cell, the genomic DNA having been linearized with an enzyme (e.g., bsu 36I) such that the polyhedrin gene and a portion of the essential genes downstream of the polyhedrin locus are removed such that the parental viral DNA molecule cannot replicate, thereby rendering the genomic DNA non-infectious; however, this part of the essential gene is present on the transfer plasmid. After co-transfection, homologous recombination between the transfer plasmid and the linearized genomic DNA re-circularizes the genomic viral DNA, thereby restoring its replication capacity. Since the original baculovirus genomic DNA before linearization contains the polyhedrin gene, plaques formed by non-recombinant viruses are turbid (due to crystalline inclusion bodies in infected cells), whereas plaques formed by recombinant viruses are clear.

The baculovirus expression vector may be engineered to increase the yield of the recombinant protein. In some embodiments, the baculovirus vector knocks out one or more genes. Baculovirus genomes contain genes that are not essential for viral replication and expression of recombinant proteins in cell culture. Such gene deletions may eliminate unnecessary gene burden, help create a more stable baculovirus expression vector, reduce the time required for established insect cell infection, and result in more efficient expression of recombinant proteins. In some embodiments, the polyhedrin promoter is modified by including more than one copy of a burst (burst) sequence therein; for example, the promoter may be engineered to include two burst sequences to produce a "double burst" (DB) promoter containing two repeats of nucleotide sequence CTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATA (SEQ ID NO: 12). See, e.g., manohar et al, biotechnol Bioeng. (2010) 107:909-16. For integration of the viral antigen coding sequence into the baculovirus expression vector, a transfer plasmid carrying said coding sequence may be integrated into the DNA encoding the baculovirus genome by homologous recombination. The identity of the virus can be confirmed by, for example, southern blot or Sanger sequencing analysis of the S protein coding sequence insert from purified baculovirus DNA and immunoblot analysis of recombinant proteins produced in infected insect cells. See, for example, U.S. patent nos. 6,245,532 and 8,541,003.

Host cells containing the viral antigen expression construct are cultured in a bioreactor (e.g., 45L, 60L, 459L, 2000L, or 20,000L) in, for example, a batch process or a fed-batch process. The produced S protein may be isolated from the cell culture by, for example, flow-through mode or column chromatography in combination with elution mode. Examples are ion exchange resins and affinity resins such as lentil lectin agarose gel; and a mixed mode cation exchange-hydrophobic interaction column (CEX-HIC). The protein may be concentrated, the buffer exchanged by ultrafiltration, and the retentate from the ultrafiltration may be filtered through a 0.22 μm filter. See, e.g., mcPherson et al, "Development of a SARS Coronavirus Vaccine from Recombinant Spike Protein Plus Delta Inulin Adjuvant," chapter 4, sunil Thomas (eds.), vaccine Design: methods and Protocols: vol.1: vaccines for Human Diseases, methods in Molecular Biology, springer, new York,2016. See also U.S. patent 5,762,939.

Baculovirus Expression Vector Systems (BEVS) provide an excellent approach to the development of ideal subunit vaccines. Recombinant proteins can be produced by such systems in about eight weeks. Rapid production is particularly important when there is a pandemic threat. In addition, baculoviruses are safe because of their narrow host range, limited to some taxonomically related insect species, and replication in mammalian cells has not been observed. Furthermore, few microorganisms are known to be capable of replication in both insect cells and mammalian cells; thus, the potential for contamination by foreign factors in clinical products made from insect cells is very low. Furthermore, humans are generally not pre-existing immunized against proteins from insects that are natural hosts to baculoviruses, as these insects do not bite into humans; thus, allergic reactions to clinical products manufactured in BEV systems are less likely to occur. Furthermore, although the carbohydrate moieties added to the proteins of insect cells appear to be less complex than the carbohydrate moieties on their mammalian cell-expressed counterparts, the immunogenicity of the glycoproteins expressed by insect cells and those expressed by mammalian cells appear to be comparable. Full-length proteins expressed in baculovirus systems typically self-assemble into higher structures commonly employed for natural proteins by modulating surfactant concentration. Finally, due to the extremely high activity of the polyhedrin promoter, the BEVS system is very efficient, which allows high level production of recombinant proteins at significantly reduced costs.

IV.Preparation of vaccineAnd packaging

The one or more recombinant S proteins (e.g., preS dTM) can be formulated and packaged alone or in combination with an adjuvant in an amount effective to enhance an immunogenic response against the recombinant S proteins. As noted above, the immunogenic composition may be monovalent or multivalent. The immunogenic composition may be formulated for parenteral (e.g., intramuscular, intradermal, or subcutaneous) administration or nasopharyngeal (e.g., intranasal) administration. The composition may or may not contain a pharmaceutically acceptable preservative. Such preservatives include, but are not limited to, parabens, thimerosal (thimerosal), thiomersal (thiomersal), chlorobutanol, benzalkonium chloride, and chelating agents (e.g., EDTA).

The immunogenic composition may be provided in the form of a mixture of the antigen and an adjuvant, provided that the adjuvant does not comprise both tocopherol and squalene or an AS03 adjuvant.

The immunogenic composition may also be in the form of a temporary formulation in which the antigen and the adjuvant are contacted just prior to or at the time of use. For example, the antigen (liquid) may be mixed volumetrically with the adjuvant (emulsion) prior to injection. In some embodiments, the antigen formulation is an aqueous buffer solution prior to mixing with the adjuvant. The buffer may be phosphate buffered saline optionally prepared with sodium dihydrogen phosphate, disodium hydrogen phosphate, and sodium polysorbate. The buffer may also contain a surfactant (e.g., 0.01% -1%).

In some embodiments, the surfactant is hydrophilic and/or nonionic. The surfactant may be selected from: ethoxylated polysorbates, e.g. under the trade names respectively20、/>40、/>60 and->80 polysorbate 20, polysorbate 40, polysorbate 60 and polysorbate 80; ethylene oxide/propylene oxide copolymers, hereinafter referred to as poloxamers, such as poloxamer 124 sold under the trade name SynperisticTM PE/L44, and ∈>Poloxamer 188 sold by F68 or SynperisticTM PE/F68 under the trade namePoloxamer 237 sold under the trade name SynperisticTM PE/F87, poloxamer 338 sold under the trade name SynperisticTM PE/F108, or poloxamer 237 sold under the trade name +.>F127, synperisticTM PE/F127 or +.>Poloxamer 407 sold by F127; and polyethylene hydroxystearates, such as under the trade name +.>Polyethylene hydroxystearate 660 sold by HS 15.

In some embodiments, the aqueous buffer formulation containing the antigen may comprise 0.01% -0.5% polysorbate 20. In some embodiments, the formulation contains about 0.02% to 0.2% polysorbate 20. In certain embodiments, the formulation contains 50-600 (e.g., 55 or 550) μg polysorbate 20 per 0.25mL of aqueous antigen formulation (without adjuvant).

In some embodiments, the antigen may be lyophilized and absorbed with the adjuvant (emulsion) just prior to use, or conversely, the adjuvant may be in lyophilized form and absorbed with a solution of the antigen (e.g., an aqueous buffer solution).

Thus, the present disclosure provides an article of manufacture (such as a kit) that provides the antigen and adjuvant components of the immunogenic composition of the invention in separate containers (e.g., pretreated glass vials or ampoules) and mixes the two components prior to injection. If a solution is required to re-suspend the lyophilized components, the solution may also be provided in the article of manufacture (such as a kit). Alternatively, the antigen component and the adjuvant are mixed and provided in the same container, and the composition may be administered directly to a subject in need of vaccination. The article of manufacture may also include instructions for use. The article of manufacture (e.g., the kit) may also include instructions for use.

The immunogenic composition may be provided in unit dosage form (single dose) or in multi-dose form. In some embodiments, the antigen component is provided in a multi-dose form in one container, while the adjuvant component is provided in a single dose or in multiple dose forms in a separate container; prior to use, a single dose of the antigen component is removed from its container and mixed with a single dose of the adjuvant.

In some embodiments, the immunogenic composition is provided for use in Intramuscular (IM) or subcutaneous injection. The immunogenic composition, once prepared at the bedside by mixing the antigen component and the adjuvant component, can be injected into a subject, for example, at the deltoid muscle of his/her upper arm. In some embodiments, the antigen and/or adjuvant components of the immunogenic composition are provided in a pre-filled syringe or cartridge (e.g., single-chamber or multi-chamber). In some embodiments, the immunogenic composition is provided for use in inhalation and provided in a prefilled pump, nebulizer or inhaler.

In some embodiments, the unit dose for intramuscular injection is 1-50 or 5-50 (e.g., 2.5, 5, 10, 15, 30, or 45) μg of recombinant S protein (e.g., one or more (such as two) recombinant S proteins selected from preS dTM and variants thereof) per dose in an injection volume of, for example, about 0.2 to 0.6mL (e.g., 0.25mL or 0.5 mL). In some embodiments, the unit dose is a total of 2.5 μg of recombinant S protein in an injection volume of 0.25 or 0.5 mL. In other embodiments, the unit dose is a total of 5 μg of recombinant S protein in an injection volume of 0.25 or 0.5 mL. In some other embodiments, the unit dose is a total of 10 μg of recombinant S protein in an injection volume of 0.25 or 0.5 mL. In some other embodiments, the unit dose is 15 μg of recombinant S protein total in an injection volume of 0.25 or 0.5 mL. In some embodiments, the unit dose is 45 μg total recombinant S protein in an injection volume of 0.25mL or 0.5 mL. In these embodiments, an injection volume of 0.25mL or 0.5mL may include an adjuvant.

In some embodiments, the recombinant S protein is provided in a single dose or multiple doses in a container. Each dose may be in a volume of, for example, 0.25 mL. The S protein may be formulated in phosphate buffered saline (sufficient 0.25 mL) containing Tween at a concentration of 0.2%Without preservatives or antibiotics. The protein solution may be mixed with an adjuvant (e.g., AF03 adjuvant; not AS03 adjuvant) prior to use. In some embodiments, the protein solution is mixed with an equal volume of adjuvant prior to use.

In some embodiments, a unit dose of the antigen composition for intramuscular injection contains the ingredients shown in table a below.

Table A CoV2 preS dTM formulation (unadjuvanted)

/>

In some embodiments, the unit dose comprises 2.5, 5 or 10 μg of D614 preS dTM (SEQ ID NO:10, without signal sequence). In some embodiments, the unit dose comprises 2.5, 5 or 10 μg of B.1.351 presdTM (SEQ ID NO:14, without signal sequence). In some embodiments, this unit dose is bivalent and comprises a total of 2.5, 5, or 10 μg of D614 preS dTM and b.1.351preS dTM, wherein the two proteins are present in equal amounts. The unit dose of the antigen composition may be used alone for vaccination or mixed with an adjuvant prior to vaccination.

In some embodiments, the unit dose is a total of 2.5, 5, 10, 15, or 45 μg of recombinant S protein in 0.25mL or 0.5mL (excluding adjuvant). The dose may be administered, for example, as a booster dose with or without an adjuvant, as further explained below.

In some embodiments, for each human vaccination by intramuscular injection, 2.5 μg of preS dTM (SEQ ID NO:10, NO signal sequence) or variant (e.g., SEQ ID NO:14, NO signal sequence) (see e.g., table a, table 8 or table 8A below) in 0.25mL of sterile, clear and colorless PBS solution is mixed in volume with 0.25mL of AF03 adjuvant in volume ratio prior to injection to achieve a final injection volume of 0.5 mL. In other embodiments, this antigen solution is administered AS a booster without an adjuvant or with another adjuvant (provided that the adjuvant does not comprise both tocopherol and squalene or AS 03).

In some embodiments, for each human vaccination by intramuscular injection, 5 μg of preS dTM (SEQ ID NO:10, NO signal sequence) or variant (e.g., SEQ ID NO:14, NO signal sequence) (see, e.g., table a, table 8 or table 8A below) in 0.25mL of sterile, clear and colorless PBS solution is mixed in volume with 0.25mL of AF03 prior to injection to achieve a final injection volume of 0.5 mL. In other embodiments, this antigen solution is administered AS a booster without an adjuvant or with another adjuvant (provided that the adjuvant does not comprise both tocopherol and squalene or AS 03).

In some embodiments, for each human vaccination by intramuscular injection, 10 μg of preS dTM (SEQ ID NO:10, NO signal sequence) or variant (e.g., SEQ ID NO:14, NO signal sequence) (see, e.g., table a, table 8 or table 8A below) in 0.25mL of sterile, clear and colorless PBS solution is mixed in volume with 0.25mL of AF03 prior to injection to achieve a final injection volume of 0.5 mL. In other embodiments, this antigen solution is administered AS a booster without an adjuvant or with another adjuvant (provided that the adjuvant does not comprise both tocopherol and squalene or AS 03).

In some embodiments, for each human vaccination by intramuscular injection, 15 μg of preS dTM (SEQ ID NO:10, NO signal sequence) or variant (e.g., SEQ ID NO:14, NO signal sequence) (see, e.g., table a, table 8 or table 8A below) in 0.25mL of sterile, clear and colorless PBS solution is mixed in volume with 0.25mL of AF03 prior to injection to achieve a final injection volume of 0.5 mL. In other embodiments, this antigen solution is administered without an adjuvant or with another adjuvant (provided that the adjuvant does not comprise both tocopherol and squalene or AS 03).

In some embodiments, for each human vaccination by intramuscular injection, 45 μg of preS dTM (SEQ ID NO:10, NO signal sequence) or variant (e.g., SEQ ID NO:14, NO signal sequence) (see, e.g., table a, table 8 or table 8A below) in 0.25mL of sterile, clear and colorless PBS solution is mixed in volume with 0.25mL of AF03 prior to injection to achieve a final injection volume of 0.5 mL. In other embodiments, this antigen solution is administered without an adjuvant or with another adjuvant (provided that the adjuvant does not comprise both tocopherol and squalene or AS 03).

In some embodiments, for each human vaccination by intramuscular injection, a total of 10 μg of two different recombinant S proteins (e.g., preS dTM or variants such as variants derived from b.1.351 (SEQ ID NO:14, NO signal sequence), each 5 μg) (see, e.g., table a, table 8 below, or table 8A) in 0.25mL of sterile, clear and colorless PBS solution are mixed in volume ratio with 0.25mL of AF03 adjuvant prior to injection to achieve a final injection volume of 0.5 mL.

In some embodiments, the immunogenic composition is monovalent and contains 10 μg of a single recombinant S protein per dose (e.g., preS dTM or preS dTM variant, such as b.1.351preS dTM).

In some embodiments, the immunogenic composition is bivalent and contains two different recombinant S proteins (e.g., preS dTM and preS dTM variants, such as b.1.351preS dTM) at 5 μg each dose.

In some embodiments, the immunogenic composition is trivalent and contains three different recombinant S proteins (e.g., preS dTM and two different preS dTM variants) at 3.3 μg each dose.

In some embodiments, the immunogenic composition is monovalent and contains a single recombinant S protein (e.g., preS dTM or preS dTM variant, such as b.1.351preS dTM) at 2.5 μg per dose.

In some embodiments, the vaccine products of the present disclosure may be stored at 2 ℃ -8 ℃.

V.Use of vaccines

Subjects suitable for vaccination with the vaccine compositions of the present disclosure include humans susceptible to SARS-CoV-2 infection, such as adults 18-49 years old, adults 18-59 years old, adults 50 years old or older, adults 60 years old or older, adults 65 years old or older, children 2-18 years old, children under 12 years old or children under 2 years old. The amount of vaccine to be administered to a subject can be determined according to standard techniques well known to those of ordinary skill in the art, including the type of adjuvant used, the route of administration, and the age and weight of the subject. In some embodiments, a dose of 2.5 μg of antigen with or without adjuvant will be administered. In some embodiments, a 5 μg dose of antigen with or without adjuvant will be administered. In some embodiments, a 10 μg dose of antigen with or without adjuvant will be administered. In some embodiments, a 15 μg dose of antigen with or without adjuvant will be administered. In some embodiments, a 45 μg dose of antigen with or without adjuvant will be administered. The composition may be administered in a single dose or in a series of doses (e.g., one to three initial doses and one or more subsequent "booster" doses). In some embodiments, the first dose and the second dose will be administered about 14 days (or about 2 weeks) to about six months apart. For example, the intervals between doses may be 14-35 days apart (e.g., about 21 or 28 days) or about 2-5 weeks apart (e.g., about 3 or 4 weeks).

In some embodiments, the single dose is about 0.25mL of a mixture of an antigen composition (containing 5 or 10 μg of recombinant S protein) and an adjuvant (e.g., AF 03) as shown in table a, table 8, or table 8A. In further embodiments, two such doses are administered to the subject, each dose being separated by 21 days or 3 weeks. In other further embodiments, two such doses are administered to the subject, each dose being separated by 28 days or 4 weeks.

The vaccine composition is provided to the subject in a prophylactically effective amount, which may be administered in a single dose or in a series of doses. By "prophylactically effective amount" is meant an amount necessary to induce an immune response sufficient to prevent or delay the onset and/or reduce the frequency and/or severity of one or more symptoms of covd-19. In some embodiments, the amount elicits an immune response that partially or completely reduces the severity of one or more symptoms and/or the time a subject experiences one or more symptoms, reduces the likelihood of developing an established infection following challenge, slows progression of the disease, optionally increases survival, and/or produces neutralizing antibodies to SARS-CoV-2 and SARS-CoV-2S protein-specific T cell responses.

In some embodiments, the vaccination methods provided herein prevent or ameliorate covd-19, such as one or more symptoms thereof; or to prevent or reduce the risk of hospitalization or death associated with covd-19. In one method, an immunogenic composition prepared by mixing 0.25mL of an aqueous antigen component and an adjuvant is administered intramuscularly to a subject not suffering from covd-19 or vaccinated. 0.25mL of the aqueous antigen component may be Monovalent (MV) and contain 5 or 10 μg of D614 preS dTM or B.1.351 (. Beta.) preS dTM, optionally formulated in PBS, as shown in Table A. Alternatively, the aqueous antigen component is Bivalent (BV) and comprises 5 μg of D614 preS dTM and 5 μg of β preS dTM, optionally formulated in PBS, as shown in table a; or 2.5 μg of D614 preS dTM and 2.5 μg of beta preS dTM, optionally formulated in PBS, as shown in Table A. The immunogenic composition may be administered to the subject twice a week or four weeks apart or one month apart.

VI.Use of vaccine as a booster

The vaccine compositions of the present invention may be used as general purpose boosters. The vaccine compositions of the invention may be used as boosters to previously administered covd-19 vaccines as part of a prime-boost vaccination regimen (e.g., as a heterologous or homologous prime-boost vaccination regimen). The priming dose (i.e., the primary vaccine) in the regimen may be a vaccine based on: mRNA, DNA, viral vectors (e.g., adenovirus vectors, adeno-associated virus vectors, lentiviral vectors, vesicular stomatitis virus vectors, vaccinia virus vectors, or measles virus vectors), peptides or proteins, virus-like particles (VLPs), capsid-like particles (CLPs), attenuated live viruses, inactivated viruses (inactivated vaccines), and the like. In some embodiments, the primary vaccine contains the same antigen as the booster vaccine (i.e., a homologous prime-boost vaccination regimen). The prime-boost regimen may be advantageous in part due to reuse (especially for viral vector priming) and due to the qualitative and quantitative different immune characteristics provided by boosting. Such a regimen would be expected to produce an enhanced outcome in terms of breadth, efficacy and persistence of antiviral immunity in vaccinated subjects.

Vaccines comprising genetic material (e.g., mRNA, DNA, or viral vectors) for expressing SARS-CoV-2 antigen (e.g., S protein antigen) in vivo are collectively referred to as "genetic vaccines. For example, genetic vaccines include those containing mRNA, with or without chemical modifications or nucleotide analogs. The mRNA may be encapsulated (e.g., in Lipid Nanoparticles (LNP)) or complexed with a carrier or adjuvant (e.g., protamine or saponin). mRNA may be self-replicating or non-self-replicating. The vaccine compositions of the invention are useful as boosters of genetic vaccines, as genetic vaccines may elicit an anti-drug immune response in vaccinated subjects that destroys and thus reduces the efficacy of subsequent doses of the same vaccine. In such cases, the genetic vaccine cannot be repeatedly (e.g., seasonally) administered to the same subject.

In some embodiments of the prime-boost regimen of the invention, the priming dose may be a genetic vaccine encoding a recombinant S protein, which may include the extracellular domain of SARS-CoV-2S protein. In some embodiments, the recombinant S protein may comprise the amino acid sequence of SEQ ID NO. 1, 4, 10, 13 or 14, or an antigenic fragment thereof. In some embodiments, the recombinant S protein is a trimer of polypeptides comprising sequences from the SARV-CoV-2 ectodomain or Receptor Binding Domain (RBD) and trimerization sequences (e.g., the natural SARS-CoV-2S trimerization domain). In some embodiments, the encoded recombinant S protein may comprise a signal peptide sequence (e.g., a signal peptide from SARS-CoV-2, such as S protein) that facilitates secretion of the recombinant S protein from producer cells of an vaccinated subject.

In some embodiments, the genetic vaccine encodes an S protein or antigenic portion thereof that has one or more mutations compared to a reference (e.g., naturally occurring) S protein for a particular design purpose. For example, the encoded S protein may contain (i) a mutation at the furin cleavage site to prevent furin cleavage (e.g., a "GSAS" (SEQ ID NO: 6) mutation); (ii) a mutation that alters Endoplasmic Reticulum (ER) retention; (iii) eliminating putative glycosylated mutations; (iv) introducing a mutation that replaces the signal peptide; and/or (v) a mutation that stabilizes the pre-fusion conformation of the S polypeptide (e.g., a "PP" mutation).

In some embodiments, the S protein encoded by the genetic vaccine may include naturally occurring mutations, such as the D614G mutation and other mutations described herein. In certain embodiments, the genetic vaccine can encode a recombinant S protein derived from a SARS-CoV-2 variant (such as the variants described above).

In certain embodiments, the genetic vaccine (such as an mRNA vaccine) may encode the following recombinant S polypeptides:

in the above sequences, the boxed sequence (GSAS; SEQ ID NO: 6) was changed from the wild-type RRAR (SEQ ID NO: 5). Underlined residues (PP) are altered from wild-type KV. These changes can help maintain the trimeric S protein in a stable pre-fusion conformation.

In some embodiments, the genetic vaccine is a Moderna COVID-19 vaccine, a Pfizer-BioNTech COVID-19 vaccine, a Janssen COVID-19 vaccine, or a Vaxzevria (formerly COVID-19 vaccine, astraZeneca).

In some embodiments of the prime-boost regimen of the invention, the priming dose is an inactivated vaccine, such as a Sinovac-CoronaVac and Sinopharm BIBP vaccine.

The prime-boost regimen involves vaccination with a primary vaccine (e.g., a genetic vaccine or subunit vaccine) followed by one or more booster doses with a protein vaccine of the invention. In some embodiments, the primary vaccine requires one administration (e.g., intramuscular, subcutaneous, intradermal, or intranasal administration) of the vaccine; or two administrations of vaccine separated by a period of time (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks or more).

In some embodiments, a booster dose of a recombinant protein of the invention may be administered at least two weeks (e.g., four weeks, one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, one year, one and a half years, two years, three years, four years, five years, or more) after the initial vaccination. For example, once a genetic vaccine (e.g., an mRNA or adenovirus-based vaccine) or subunit vaccine is administered, a booster dose of the protein vaccine of the invention may be administered to a subject annually or every half year. For convenience, the booster vaccine may be co-administered annually with the influenza vaccine (e.g., as a separate formulation or co-formulation).

In some embodiments, the enhancer is a monovalent or multivalent immunogenic composition as described herein, with or without an adjuvant. In some embodiments, the enhancer is a monovalent immunogenic composition (e.g., a composition containing recombinant S protein derived from a strain of wuhan or a variant of south africa). In other embodiments, the enhancer is a bivalent immunogenic composition (e.g., a composition comprising recombinant S protein derived from a wuhan strain and recombinant S protein derived from a south africa variant).

In certain embodiments, the booster dose may be 0.25 or 0.5mL of the immunogenic composition comprising 2.5 or 5 μg of preS dTM or one or more variants thereof. In some embodiments, the booster injection does not include an adjuvant. In some embodiments, the booster dose contains an adjuvant (e.g., an AF03 adjuvant; not an AS03 adjuvant), and may be prepared, for example, by volumetric mixing of a solution comprising the antigen with the adjuvant in a volumetric ratio prior to injection. In some embodiments, the booster injection is prepared by volumetric mixing of 2.5 or 5 μg of preS dTM or variant (see, e.g., table a, table 8 or table 8A below) with 0.25mL of AF03 adjuvant in a sterile, clear and colorless PBS solution prior to injection. In a further embodiment, the variant is a beta variant (e.g., SEQ ID NO:14 containing a signal sequence).

In certain embodiments, the primary vaccination is with a subunit vaccine comprising recombinant S protein, and the booster vaccine contains a smaller amount of recombinant S protein than the vaccine used for the primary (non-booster) vaccination. For example, the primary vaccination requires two injections, 10 μg of recombinant S protein each at intervals (e.g., 3, 4, 5, 6, 7, 8 or more weeks intervals), respectively, while the booster injections may contain only 2.5 or 5 μg of recombinant S protein.

In some embodiments, the primary vaccination requires two injections of 0.5mL of an immunogenic composition prepared by volumetric mixing 10 μg of preS dTM or variant (or 5 μg preS dTM plus 5 μg variant for bivalent vaccine) in 0.25mL of sterile, clear and colorless PBS solution prior to injection at a certain interval (e.g., 3, 4, 5, 6, 7, 8 or more weeks interval) (see e.g., table a, table 8 or 8A below) with 0.25mL of AF03 adjuvant. A booster vaccine is then administered to the subject at a later time (e.g., at least 3, 6, 8, 9, or 12 months after the second injection of the primary vaccination), wherein the booster vaccine may be 2.5 or 5 μg preS dTM or variant in 0.25 or 0.5mL of sterile, clear and colorless PBS solution (see e.g., table a, table 8 or 8A below), or the booster vaccine may be prepared by volumetric mixing 2.5 or 5 μg preS dTM or variant in 0.25mL of PBS solution with 0.25mL of AF03 adjuvant.

In some embodiments, the booster vaccine does not require an adjuvant. The recombinant S protein may be provided in an aqueous liquid solution for intramuscular injection (e.g., PBS, such as the PBS shown in table a, table 8, or table 8A).

Unless defined otherwise herein, scientific and technical terms used in connection with the present invention shall have the meanings commonly understood by one of ordinary skill in the art. Exemplary methods and materials are described below, but methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. In case of conflict, the present specification, including definitions, will control. Generally, the nomenclature used in connection with cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medical and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein, and the techniques thereof, are those well known and commonly used in the art. The enzymatic reactions and purification techniques are performed as generally accomplished in the art or as described herein according to the manufacturer's instructions. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. Throughout this specification and the embodiments, the words "have" and "comprise" or variations such as "has", "having", "comprises" or "comprising" are to be understood as implying that the stated integer or group of integers is included but not excluding any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are referred to herein, this reference does not constitute an admission that any of these documents form part of the common general knowledge in the art.

As used herein, the term "about" or "approximately" as applied to one or more target values refers to values similar to the stated reference values. In certain embodiments, unless otherwise indicated or otherwise apparent from the context, the terms refer to ranges of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of either direction (greater or less) of the stated reference value.

In order that the invention may be better understood, the following examples are set forth. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention in any way.

Examples

Example 1: cloning of SARS-CoV-2S coding sequence into baculovirus transfer plasmid

Gibson Assembly (GA) was used to generate a transfer plasmid containing the indicated SARS-CoV-2 spike glycoprotein modified by SARS-CoV-2 spike glycoprotein (YP_ 009724390.1 from genomic isolate Wuhan-Hu-1 GenBank NC045512). For each construct, three gene fragments (gBlock) were designed for cloning into the linearized SapI pPSC12 DB transfer vector. The gBlock gene fragment has an overlapping sequence of 40bp at its ligation site, and overlaps with pPSC12 at 5 'and 3' for gBlock fragments 1 and 3, respectively. gBlock was synthesized from Integrated DNA Technologies (IDT). A depiction of the Gibson assembly reaction is shown (fig. 2A and 2B). The final transfer plasmid was confirmed by Eurofins Genomics via Sanger sequencing. Site-directed mutagenesis may also be used to produce variant proteins.

Example 2: production and purification of recombinant S proteins

Recombinant baculoviruses containing sequences encoding preS dTM under the control of the polyhedrin promoter were used to infect spodoptera frugiperda (s.frugiperda) cells. Cells were grown to 2.5x10 in PSFM medium (SAFC) at 27 ℃ ⁶ Density of individual cells/mL, andand infected with 2% (v/v) recombinant baculovirus. Cells were harvested 72 hours post infection by centrifugation at 3,400x g for 15 minutes. The supernatant was used for purification of recombinant S protein.

In one purification method, the supernatant containing secreted recombinant SARS-CoV-2 spike protein was depth filtered using SUPRACAP 100 double layer K250P/KS50P 5' filter (Pall, # NP5LPDG 41). Using 100kDa Sartocon Slice Cassette (0.1 m) ² ) The depth filtrate was concentrated 10x at 15psi at a flow rate of 200mL/min, then with 20mM Tris;5 Xdiafiltration was performed against 50mM NaCl (pH 7.4). Passing the percolate containing SARS-CoV-2 spike protein through Capto ^TM The purification was performed by column chromatography (purification as a capturing step) of lentil lectin (cytova). Capto is Capto ^TM The lentil lectin column was run with 20mM Tris;50mM NaCl;10mM methyl-alpha-D-mannopyranoside (pH 7.4). Under these conditions, SARS-CoV-2 spike protein is reacted with Capto ^TM The lentil lectin resin bound and flowed contaminants through the column. The column was run with 20mM Tris;50mM NaCl;10mM methyl-alpha-D-mannopyranoside (pH 7.4) was washed to remove unbound protein. SARS-CoV-2 spike protein is used with a solution containing 20mM Tris;500mM elution buffer of methyl-alpha-D-mannopyranoside (pH 7.4) from Capto ^TM Eluting on the column of lentil lectin.

Capto is Capto ^TM Passing the lentil lectin eluate through phenyl Sepharose ^TM The HP hydrophobic interaction chromatography resin (Cytiva) (as a fine purification step) was further purified. Capto is Capto ^TM The lentil lectin eluate was adjusted to a concentration of 750mM ammonium sulphate, 0.01% triton X-100 and loaded with a solution containing 50mM sodium phosphate; 750mM ammonium sulfate; 0.01% v/v Triton X-100 buffer (pH 7.0) on phenyl sepharose HP column. After loading, phenyl sepharose HP column was run with 50mM sodium phosphate; 750mM ammonium sulfate; a0.01% v/v Triton X-100 (pH 7.0) wash was performed to remove unbound contaminants. SARS-CoV2 spike protein is treated with a solution containing 50mM sodium phosphate; 300mM ammonium sulfate; elution buffer (pH 7.0) of 0.01% v/v Triton X-100 was eluted from the phenyl sepharose HP column.

Phenyl sepharose HP eluate was diluted 3.25× with distilled water and Q-membrane filtered using a single Mustang Q XT Acrodisc filter (Pall, #mstgx25q16). After Q membrane filtration, TFF was performed using Sartocon Slice 50 (Sartorius Stedim, #3D91465050 ELLPU). The Q filtrate was concentrated to 0.25mg/mL and then diafiltered 10 Xwith 10mM sodium phosphate buffer (pH 6.8-7.2). TFF retentate containing SARS-CoV-2 spike protein was formulated with 0.005% tween 20 and sterile filtered using a 0.2 μm filter and stored at 4 ℃ until use.

An alternative purification method uses CEX-HIC. Harvesting may be accomplished by depth filtration (with or without an initial centrifugation step). The captured recombinant protein may then be further purified by ultrafiltration/diafiltration steps.

Example 3: key mouse study

This example describes a study of SARS-CoV-2 recombinant protein vaccine formulation in mice. Vaccine formulations contain the SARS-CoV-2 pre-fusion stable S protein (CoV-2 preS dTM) lacking a transmembrane and cytoplasmic region. The vaccine contains an AF03 adjuvant. This vaccine study investigated dose response and adjuvant effects on humoral and cell-mediated immunity. The study also compares the effect between the unstable S ectodomain (deletion of transmembrane and cytoplasmic regions; "S dTM") and presdTM. S dTM contains the His-tagged SARS-CoV-2 spike protein ECD S1 and S2 regions (Sino Biological).

The mice used herein are 6-8 week old, inbred female Swiss Webster mice. They were given 50 μl (25 μl antigen solution plus 25 μl adjuvant) of vaccine formulation for intramuscular injection on day 0 and day 21.

The following data reflects the target antigen dose and the actual antigen dose. After experimental runs, a key polyclonal antibody reagent for detecting SARS-CoV-2preS protein was found to also recognize glycosylated Host Cell Protein (HCP). Thus, the target purity and HCP levels are inaccurate and the concentration of SARS-CoV-2preS protein in the formulated vaccine product is significantly lower than planned. Table 1 shows the dosing regimen and table 2 reflects the actual doses recalculated as follows.

Table 1 dosing regimen for mice studies

TABLE 2 target and actual doses of CoV2-02_Ms for CoV2 presdTM antigen

Date of injection	Target dose (μg)	CoV 2preS dTM content%	Actual dose (μg)
				D0	0.167/0.5/1.5/4.5	41	0.07/0.2/0.6/1.8
D21	0.167/0.5/1.5/4.5	26	0.04/0.13/0.4/1.17

* The actual dose was recalculated based on a new assay that distinguished structurally correct CoV 2preS dTM trimers from HCP impurities. The assay is based on ACE2 binding and/or HPSEC.

The actual doses injected for D0 and D21 are different due to dosing adjustments based on the new dosing. For consistency, only the target dose is indicated in the text and figures.

Blood was drawn from animals on day-4, day 21 and day 36. S-specific IgG, igG1 and IgG2a levels were measured by ELISA, in which plates were coated with spike ECD (S dTM; sino Biological) containing S1 and S2 regions. Titers were reported as the reciprocal of the last dilution that caused an OD value greater than 0.2. The od=0.2 value represents at least twice the background of the assay. The ability of serum antibodies to neutralize live virus WAs first evaluated in a plaque reduction neutralization assay (PRNT) under BSL 3 using the SARS-CoV-2USA/WA1/2020 strain. A second neutralization assay was performed in parallel on 293-hsACE2 clone cells using the Integral Molecular SARS-CoV-2GFP pseudovirus assay under BSL 2.

The data indicate that preS dTM and S dTM are not immunogenic without adjuvant, as demonstrated by very low or absence of IgG and neutralizing antibody responses after 1 or 2 doses. Serum S-specific IgG levels between the two antigens were similar and there was no statistically significant titer change from day 21 to day 36 (fig. 4). In contrast, the preS dTM vaccine with AF03 adjuvant elicited high IgG responses after 1 dose (D21) at all doses tested (the mean value of the different vaccine dose groups ranged from 3.4 to 4.1Log ₁₀ ELISA Units (EU)). The second injection (D36) further increased the response and the average IgG titer reached 4.4 to 4.9Log ₁₀ EU, depending on vaccine dose. Both adjuvant effects (fold increase and P-value) and booster effects were demonstrated. On both day 21 and day 36, adjuvant AF03 significantly increased the S-specific IgG titers induced by immunization with preS dTM in animals, and titers were observed to be higher on day 36 than on day 21 (fig. 5). In summary, the dose-response effect of AF 03-containing vaccine formulations was statistically significant, with p<0.001. However, the dose-response effect of the unadjuvanted formulation was not statistically significant (p= 0.7866). In short, no matter what dose is used, a significant AF03 adjuvant effect is shown, with all dosesp values are all<0.001。

Consistent with IgG responses, the AF03 adjuvanted vaccine elicited a robust neutralizing antibody response after 2 doses, as assessed in the PRNT assay. To perform this assay, serum samples were heat inactivated at 56 ℃ for 30 minutes and diluted in diluent (DMEM/2% fbs). SARS-CoV-2 virus is prepared and kept on ice until use. The diluted serum samples were mixed with an equal volume of dilution to contain 30 PFU/well of SARS-CoV-2 and incubated for 1 hour at 37 ℃. Plates of confluent Vero E6 cells were inoculated in duplicate with 250 μl of serum+virus mixture and incubated for 1 hour at 37 ℃. After incubation, the plates were covered with 1mL of 0.5% methylcellulose medium and the plates were incubated at 37 ℃/5% co ₂ Incubate for 3 days. The methylcellulose medium was then removed and the wells were washed once with 1mL PBS. After washing, each well of the plate was fixed with ice-cold methanol at-20 ℃ for 30 minutes. After fixing, the methanol was discarded and the monolayer was stained with 0.2% crystal violet for 30 minutes at room temperature and then with PBS or dH ₂ And (3) washing. The plates were air dried and the neutralizing antibody titer was determined as the highest serum dilution that reduced the number of viral plaques in the test by 50% or more.

PRNT was detected in all mice (except one in the 0.5 μg group) ₅₀ Titer. The mean value of neutralization was in the range of 2.0Log from the lowest vaccine dose group (0.167. Mu.g) ₁₀ 2.9Log to the highest vaccine dose group (4.5. Mu.g) ₁₀ . Thus, animals immunized with the adjuvanted formulation produced significantly higher amounts of SARS-CoV-2 neutralizing antibodies in a dose-dependent manner by day 36 compared to the unadjuvanted group (fig. 6A).

IgG was measured at D36 ₁ (Th 2 related) and IgG _2a (Th 1 dependent) titres to record Th1/Th2 polarization distribution responses. Although unadjuvanted preS dTM vaccines did not elicit or elicit very low IgG ₁ And IgG _2a The preS dTM vaccine with AF03 adjuvant elicited robust IgG at all vaccine doses in response ₁ Reaction (IgG) ₁ Average titer from 4.6 to 4.9Log ₁₀ EU)。IgG _2a At a lower levelHorizontal priming and increasing titres with vaccine dose (average titre from 2.5 to 3.9Log ₁₀ EU) (fig. 6B). IgG is processed by _2a /IgG ₁ The ratio was calculated as an indication of Th1/Th2 distribution and showed significantly higher ratios (p<0.05 (fig. 6C).

Example 4: assisted mouse study

This example describes a second mouse study of SARS-CoV-2 recombinant protein vaccine formulation in mice. This study focused on evaluating cell-mediated immunity (CMI) in immunized mice. The mice used herein are female inbred BALB/c mice of 6-8 weeks of age. They were injected intramuscularly with 50 μl of vaccine formulation on day 0 and day 14. The dosing regimen is shown below, with five mice per group. The preS dTM target injected was 4.5 μg with or without adjuvant (AF 03). For consistency, only the target dose is indicated in the text and figures.

Table 3CoV2 presdTM antigen CoV2-03_Ms target and actual doses

* The actual dose was recalculated based on a new assay that distinguished structurally correct CoV2 preS dTM trimers from HCP impurities. The assay is based on ACE2 binding and/or HPSEC.

Blood was drawn from animals on day 0, day 14 and day 24. Spleens were harvested for CMI analysis on day 24 and splenocytes were stimulated with s1+s2 15 mer peptide pool (JPT) with 11 amino acid overlap. Cells were phenotyped by flow cytometry methods and cytokine production was assessed by Intracellular Cytokine Staining (ICS). The biomarker panel evaluated is shown below.

Table 4CMI biomarker panel

For intracellular staining (ICS), spleen was homogenized, erythrocytes were lysed, and cells were incubated at 37℃and 5% CO ₂ The mixture was left to stand for 1 hour. Spleen cells were then counted and 2x10 ⁶ Individual cells were incubated at 37℃with 5% CO ₂ The following were incubated with Golgi Plug (BD Biosciences) for 6 hours under the following four conditions: no peptide stimulation (medium only control), positive control stimulation and stimulation with two separate spike peptide libraries (JPT product PM-WCPV-S-1). Cells from each individual animal were stimulated with a cell activation mixture (Cell Activation Cocktail) with briaferin a (Biolegend) as a positive control. After stimulation, cells were washed and resuspended in Mouse BD Fc Block at 4 ℃ ^TM (clone 2.4G2) for 10 minutes. The cells were then centrifuged, fc blocks removed, and the cells were surface stained and live/dead stained with an antibody mixture containing the following at 4 ℃ for 30 minutes: CD4 (RM 4-5) PerCP-Cy5.5 (Biolegend), CD8 (53-6.7) AF700 (BD Biosciences), CD45R/B220 (RA 3-6B 2) PE/Cy7 (BD Biosciences), CD14 (Sa 14-2) PE/Cy7 (Biolegend) and LIVE/DEAD in staining buffer (FBS) (BD Biosciences) near-infrared DEAD cell staining kit (Invitrogen) can be immobilized. After surface staining, cells were washed, fixed and permeabilized with a Cytofix/Cytoperm solution (BD Biosciences) for 30 min at 4 ℃. The cells were then washed with 1x Perm/Wash solution (BD Biosciences) and then stained in the dark at 4 ℃ for 30 minutes with a mixture containing: CD3e (17A 2) BUV395 (BD Biosciences), IFN-. Gamma. FITC (BD Biosciences) (XMG 1.2), TNF-. Alpha. (MP 6-XT 22) Pacific Blue (bioleged), IL-2 (JES 6-5H 4) BV605 (BD Biosciences), IL-4 (11B 11) APC (Biolegend) and IL-5 (TRFK 5) PE (bioleged) in 1 XPerm/Wash buffer. The cells were then washed and resuspended in FACS buffer. Samples were run on LSR Fortessa flow cytometer (BD Biosciences) and analyzed on FlowJo software (version 10.6.1).

ICS analysis showed none or none of the mice immunized with the AF 03-adjuvanted vaccineS-specific CD4 expressing IFN-gamma, TNF-alpha, IL-2, IL-4 and IL-5 in response to stimulation of spleen cells with both S1 and S2 peptide libraries with low frequency ⁺ T cells (below 0.5% in the range of nonspecific signals detected in mice immunized with adjuvant alone) (fig. 6D). The reactions to the S1 and S2 peptide libraries were similar. Only the reaction to S1 peptide is shown. No S-specific CD8 was detected ⁺ T cell response (data not shown).

Example 5: non-human primate study

This example describes a study to evaluate humoral immunity in non-human primate (NHP). The animal used herein is a rhesus monkey aged 4-12 years. On days 0 and 21, target doses of 5 or 15 μg of AF03 mixed preS dTM were injected intramuscularly for NHP in a volume of 0.5mL. Serum was collected at D4, D21, D28 and D35. On day 56, 10 was used by intranasal (total 1 mL) and intratracheal (total 1 mL) routes ⁶ The SAR2-CoV-2USA/WA1/2020 strain of PFU challenged immunized animals. For consistency, only the target dose is indicated in the text and figures.

Table 5 dosing regimen for NHP study

TABLE 6 target and actual doses of CoV2-02_NHP for CoV2 presdTM antigen

* The actual dose was recalculated based on ACE2 binding quantification.

Consistent with the antibody response observed in mice with preS dTM, no or very low response was detected in the absence of adjuvant. However, when formulated in AF03 adjuvant, the vaccine elicited high levels of pre-fusion S-bound IgG in all immunized monkeys as early as 2 weeks after dose 1 (average titers at 5 and 15 μg doses of 3.6 and 3.9Log, respectively ₁₀ EU). Second immunization effectively increased at D28IgG titres (average titres at 5 and 15. Mu.g doses were 4.7 and 4.9Log, respectively ₁₀ EU). Importantly, there was no difference in titer between the two antigen dose groups (5 and 15 μg) (fig. 7). Functional antibody responses elicited by preS dTM vaccines were assessed using GFP pseudovirus (Integral Molecular) neutralization assays. Three weeks after dose 1, no pseudovirus neutralization titers were detected. However, one week after the second injection (D28), pseudovirus neutralization titers were measured in all preS dTM immunized rhesus monkeys with AF03 adjuvant (average titers in the 5 and 15 μg groups were 2.1 and 2.5Log, respectively ₁₀ IC ₅₀ ). No statistically significant differences were confirmed between the two doses (5 and 15 μg). The functional antibody response of immunized rhesus monkeys was compared to titers obtained from a panel of human conv sera, and showed similar titers in the vaccine group with AF03 adjuvant (fig. 8).

Example 6: in vitro studies in primary human cells

This example describes a study investigating the Th profile induced by preS dTM with or without AF03 adjuvant. In this study pooled PBMCs from 50 human donors were primed with a target 2.5 or 5 μg dose of preS dTM with or without AF03 or another adjuvant. The adjuvant was provided at 250. Mu.g/mL. The cells were then fixed and permeabilized and stained with antibodies to cell surface markers and to cytokines characteristic of either Th1 (IFN- γ, TNF- α and IL-2) or Th2 (IL-4, IL-5 and IL-17) responses.

TABLE 7 in vitro MIMIMIIC study design

Group (n=50)	Target antigen dose (μg)	Actual antigen dose (μg)	Adjuvant
				1	0	0	/
2	2.5	1	/
				3	5	2	/
4	2.5	1	AF03
				5	5	2	AF03

The data indicate that preS dTM induced predominantly Th1 responses in LTE and no adjuvant effect was observed (fig. 9 and 10).

Example 7: clinical study

This example describes a phase I/II clinical protocol for evaluating the safety and efficacy of vaccine compositions of the present disclosure. Participants, outcome assessors, researchers, laboratory personnel and most sponsor researchers (except those participating in ESDR and those who are only directed to the relevant participants) will be blinded to the vaccine group allocation group (formulation and adjuvant; injection schedule will not be blinded). Those preparing/administering study interventions will be informed of vaccine component assignment. Participants were randomly grouped and layered by age.

The composition comprises preS dTM (a trimer of the polypeptide of SEQ ID NO:10, without signal peptide) with or without an adjuvant. Vaccine compositions are provided at two dose strengths: formulations 1 and 2 contained 5 μg (low dose) and 15 μg (high dose) of CoV2 preS dTM antigen, respectively. The antigen compositions are shown below:

table 8 antigen compositions for clinical studies

For subsequent studies, the antigen may be provided in aqueous liquid solution prior to mixing with any adjuvants, as shown in table 8A below.

Table 8A antigen formulations

* This corresponds to 0.26mg of anhydrous disodium hydrogen phosphate, which can also be used to prepare the formulation.

To evaluate the effect of the adjuvant, AF03 was used. The unit dose intensities for the adjuvant study group were 5 μg and 15 μg preS dTM. Each single dose vial of squalene AF03 contains the ingredients shown below.

Table 9 adjuvant compositions for clinical studies

The antigen composition and the adjuvant composition were mixed prior to use, wherein the total volume was 0.5mL. Placebo is 0.5mL of 0.9% physiological saline per dose.

The route of administration is intramuscular injection, at the deltoid muscle of the upper arm.

Each study intervention will be provided in a separate box (antigen and adjuvant or antigen and diluent (PBS) will be put together in a 2 vial box).

Participants were healthy individuals 18 years and older, and were randomly grouped within age groups. A small cohort consisting of participants 18-49 years old (cohort 1) will receive a single dose. If it is deemed acceptable to review the security data and laboratory metrics to D09 in group 1 based on blinded data, the remaining participants in group 1 and all participants in group 2 will be recruited. All participants will receive one injection of either the study vaccine formulation or placebo control at D01 (vaccination [ VAC ] 1). Participants in group 2 will receive a second injection of study vaccine formulation or placebo (VAC 2) at D22. The duration of participation in the study by each participant will be approximately 365 days after the last injection.

Covd-19 like disease will be part of the efficacy target for active and passive monitoring. It is expected that the design of candidate SARS-CoV-2 antigens selected for this study will promote the production of neutralizing antibodies that are more robust than the binding antibodies. It is expected that formulations including adjuvanted will further enhance the magnitude of the neutralizing antibody response and induce a balanced Th1/Th 2T helper cell response. In summary, these strategies are designed to mitigate the theoretical risk of immune enhancement of viral infection. Individuals with chronic co-morbid conditions believed to be associated with increased risk of severe covd-19 will be excluded.

The main objective of the study was to evaluate the immunogenicity of the vaccine composition by describing the level and profile of neutralizing antibodies at D01, D22 and D36. Neutralizing antibody titers will be measured using a neutralization assay. It is expected that the neutralizing titre of serum antibodies in D22 and D36 will increase about 2 to 4 fold relative to D01 after vaccination. The occurrence of neutralizing antibody seroconversion is defined as a value below the lower limit of quantification (LLOQ) at baseline and a detectable neutralizing titer higher than the assay LLOQ at D22 and D36.

The secondary objective of the study was to evaluate the immunogenicity of the vaccine composition by describing the binding antibody profile of each study intervention group at D01, D22, D36, D181 (group 1) or D202 (group 2) and D366 (group 1) or D387 (group 2), and by describing the neutralizing antibody profile of each study intervention group at D181 (group 1) or D202 (group 2) and D366 (group 1) or D387 (group 2). The binding antibody titers of full-length SARS-CoV-2 spike protein will be measured by the enzyme-linked immunosorbent assay (ELISA) method for each study intervention group. It is expected that the fold increase in anti-S antibody concentration [ post/pre ] will be 2 or more, or 4 or more at D22, D36, D181 (group 1) or D202 (group 2) and D366 (group 1) or D387 (group 2). Neutralizing antibody titers will be measured using a neutralization assay. It is expected that the fold increase in serum neutralization titers after vaccination at D181 (group 1) or D202 (group 2) and D366 (group 1) or D387 (group 2) relative to D01 will be 2 or more or 4 or more. The occurrence of neutralizing antibody seroconversion is defined as a value below LLOQ at baseline and a detectable neutralizing titer above the assay lower limit at D181 (group 1) or D202 (group 2) and D366 (group 1) or D387 (group 2).

Another secondary objective of the study was to evaluate efficacy by describing the occurrence of virologically-confirmed covd-19 like disease and serologically-confirmed SARS-CoV-2 infection and evaluating the correlation/association between the antibody response to the recombinant SARS-CoV-2 protein and the risk of covd-19 like disease and/or serologically-confirmed SARS-CoV-2 infection. Virologically validated covd-19 like disease is defined by prescribed clinical symptoms and signs, and validated by nucleic acid assay virus detection assays. Serologically confirmed SARS-CoV-2 infection is defined by detection of SARS-CoV-2 specific antibodies in a non-S ELISA. The risk/protection correlation is based on antibody responses to SARS-CoV-2 (as assessed using virus neutralization or ELISA) considering virologically confirmed COVID-19 like disease and/or serologically confirmed SARS-CoV-2 infection as defined above.

The exploratory goal of the study was to evaluate immunogenicity by profiling the cellular immune response of each study intervention group in group 2 at D22 and D36 and describing the ratio between neutralizing antibodies and binding antibodies. Th1 and Th2 cytokines will be measured in whole blood and/or cryopreserved PBMC following stimulation with full-length S protein and/or S antigen peptide libraries. The ratio between the bound antibody (ELISA) concentration and the neutralizing antibody titer will be calculated.

SARS-CoV-2 neutralizing antibody assessment

The SARS-CoV-2 neutralizing antibody will be measured using a neutralization assay. In this assay, a serum sample is mixed with a constant concentration of SARS-CoV-2 virus. The reduction in viral infectivity (viral antigen production) due to neutralization of antibodies present in the serum sample can be detected by ELISA. After washing and immobilization, SARS-CoV-2 antigen production in the cells can be detected by continuous incubation with anti-SARS-CoV-2 specific antibody, HRP IgG conjugate, and chromogenic substrate. The resulting optical density was measured using an enzyme-labeled instrument. The reduction in infectivity of SARS-CoV-2 (as compared to that in the virus control wells) constitutes a positive neutralization reaction, which indicates the presence of neutralizing antibodies in the serum sample.

Serum IgG ELISA of SARS-CoV-2 spike protein antibody

ELISA will be used to measure SARS-CoV-2 anti-S protein IgG antibodies. The microtiter plates were coated with SARS-CoV-2 spike protein antigen diluted to the optimal concentration in coating buffer. Plates can be blocked by adding a blocking buffer to all wells and incubating for a defined period of time. After incubation, the plates will be washed. All controls, references and samples were pre-diluted with dilution buffer. The pre-diluted control, reference and samples were then further serially diluted in wells of the coated test plate. Plates were incubated for a defined period of time. After incubation, the plates were washed, optimized dilutions of goat anti-human IgG enzyme conjugate were added to all wells, and the plates were further incubated. After this incubation, the plates were washed and enzyme substrate solution was added to all wells. The plates were incubated for a defined period of time to allow the substrate to develop. Substrate development will be stopped by adding a stop solution to each well. An ELISA microtiter plate reader will be used to read test plates using assay specific SoftMax Pro templates. The average OD value of the plate blank will be subtracted from all Optical Densities (OD) within each plate. Sample titers will be derived using the measurements of the blank, control and reference standard curves, which will be included on each assay plate within the run.

Cell-mediated immunity (using whole blood and/or PBMC)

Cytokines will be measured in whole blood and/or cryopreserved PBMCs after stimulation with full-length S protein and/or S antigen peptide libraries.

Covd-19 like disease

Covd-19 like disease is defined as having any one of (i) the following conditions (occurring again for a period of at least 12 hours or within a period of 12 hours): cough (dry cough or expectoration); absence of smell; loss of taste sensation; chilblain (covd toe); dyspnea or shortness of breath; clinical or imaging evidence of pneumonia; and any hospitalization for clinical diagnosis of stroke, myocarditis, myocardial infarction, thromboembolic events (e.g., pulmonary embolism, deep vein thrombosis, and stroke), and/or idiopathic purpura; or (ii) either (for a period of at least 12 hours or again within a period of 12 hours): pharyngitis; shivering; myodynia; headache; a rhinorrhea; abdominal pain; and at least one of nausea, diarrhea, and vomiting.

Virologically confirmed covd-19 disease

Virologically confirmed covd-19 disease is defined as a positive result of SARS-CoV-2 by performing a Nucleic Acid Amplification Test (NAAT) on respiratory samples associated with covd-19 like disease.

Serologically confirmed SARS-CoV-2 infection

Serologically confirmed SARS-CoV-2 infection is defined as a positive result of the presence in serum of antibodies specific for the non-spike protein of SARS-CoV-2 detected by ELISA.

Serum IgG ELISA of SARS-CoV-2 nucleoprotein antibody

An ELISA will be used to measure SARS-CoV-2 antinuclear protein antibodies. The microtiter plates were coated with SARS-CoV-2 nucleoprotein antigen diluted to optimal concentration in coating buffer. Plates can be blocked by adding a blocking buffer to all wells and incubating for a defined period of time. After incubation, the plates will be washed. All controls, references and samples were pre-diluted with dilution buffer. The pre-diluted control, reference and samples were then further serially diluted in wells of the coated test plate. Plates were incubated for a defined period of time. After incubation, the plates were washed, optimized dilutions of goat anti-human IgG enzyme conjugate were added to all wells, and the plates were further incubated. After this incubation, the plates were washed and enzyme substrate solution was added to all wells. The plates were incubated for a defined period of time to allow the substrate to develop. Substrate development will be stopped by adding a stop solution to each well. An ELISA microtiter plate reader will be used to read test plates using assay specific SoftMax Pro templates. The average OD value of the plate blank will be subtracted from all OD in each plate. Sample titers will be derived using the measurements of the blank, control and reference standard curves, which will be included on each assay plate within the run.

Nucleic acid amplification assay (NAAT) for detection of COVID-19 cases

In the assay, respiratory tract samples will be collected and RNA extracted. The purified template was then evaluated by NAAT using SARS-CoV-2 specific primers that specifically amplify the SARS-CoV-2 target.

Example 8: use of recombinant S vaccine as part of prime-boost regimen

Recent studies have shown that humoral responses against SARS-CoV-2 build rapidly, peaking about 2 or 3 weeks after onset of symptoms, but steadily decreasing over the next three months (see, e.g., beaudoun-Bussieres et al, mBio (2020) 11 (5): e02590-20; altmann and Boyton, sci immunol. (2020) 5 (49): eabd6160; hellerstein, vaccine X (2020) 6:100076j; seow et al, nat Microbiol. (2020) 5:1598-1607; tan et al, front Med. (2020) 5:1-6). These findings indicate that the early kinetics of the humoral response to SARS-CoV-2 is similar to those of other acute viral infections. This pattern was also reported to be followed by the concentration of bound antibody and SARS-CoV-2 neutralization titer elicited by the two doses of mRNA vaccine, showing a decrease within five weeks after the second dose (Sahin et al, nature (2020) 586:594-9; mulligan et al, nature (2020) 586:589-593).

This example describes a study in which the protein vaccine of the present disclosure was used as a booster for the mRNA vaccine mRNA-VAC1 or mRNA-VAC2 in the NHP model. mRNA-VAC1 and mRNA-VAC2 are mRNA vaccine. They all encode recombinant S proteins whose polypeptide sequence is SEQ ID NO. 13, but contain different lipid nanoparticle formulations. mRNA-VAC1 has been shown to induce binding and neutralizing antibodies and Th 1-biased T cell responses in mice and NHPs (bioxiv.org/content/10.1101/2020.10.14.337535 v 1).

Materials and methods

ELISA (ELISA)

Nunc MaxiSorb plates were coated overnight at 4℃with 0.5. Mu.g/mL SARS-CoV S-GCN4 protein (customized at GeneArt) protein in PBS. Plates were washed 3 times with PBS-Tween 0.1% and then blocked with 1% BSA in PBS-Tween 0.1% for 1 hour at ambient temperature. Samples were plated at an initial dilution of 1:450, followed by 3-fold 7-point serial dilutions in blocking buffer. Plates were incubated for 1h at room temperature and then washed 3 times before 50 μl of 1:5000 rabbit anti-human IgG (Jackson Immuno Research) was added to each well. Plates were incubated for 1 hour at room temperature and washed 3 times. Using Pierce 1-Step ^TM The plates were developed for 0.1 hour with Ultra TMB-ELISA substrate solution and stopped with TMB stop solution. At the position ofThe plate was read at 450nm in a plate reader. Antibody titer was reported as the highest dilution of the Optical Density (OD) cutoff of ≡0.2.

Pseudovirus neutralization assay

Serum samples were incubated in medium (FluoBrite ^TM Phenol red-free dmem+10%FBS+10mM HEPES+1%PS+1%GlutaMAX ^TM ) Is diluted 1:4 and heat inactivated at 56℃for 0.5 hours. A further 2-fold serial dilution of heat-inactivated serum was prepared and mixed with Reporter Virus Particles (RVP) -GFP (Integral Molecular) (diluted to 300 infectious particles per well) and incubated for 1 hour at 37 ℃. mu.L of a 96-well plate of 50% confluent 293T-hsACE2 clone cells was inoculated with 50. Mu.L of a serum/virus mixture and incubated at 37℃for 72 hours. At the end of incubation, plates were scanned on a high content imager and individual GFP expressing cells were counted. Will inhibit dilution titre (ID ₅₀ ) Reported as the reciprocal of the dilution that reduced the number of viral plaques under test by 50%. The ID50 of each test sample was obtained by using the last dilution of the plaque number below 50% neutralization and the plaques above 50% neutralization The slope and intercept were calculated for the first dilution of the number of plaques to interpolate. ID50 titer= (50% neutralization point-intercept)/slope).

Micro neutralization assay

Serial two-fold dilutions of heat-inactivated serum samples were incubated with 5% CO at 37℃ ₂ Lower and target 50% tissue culture infection dose (TCID ₅₀ ) SARS-CoV-2 (strain USA-WA1/2020[BEI Resources; catalog number NR-52281]) Incubate for 1 hour. Inoculating the serum-virus mixture into Vero E6 with prefabricationCRL-1586 TM) cell monolayer in wells of 96-well microplates and at 37℃with 5% CO ₂ The lower adsorption was carried out for 0.5 hours. Additional assay medium was added to all wells without removal of the inoculum present and was incubated at 37℃with 5% CO ₂ Incubate for 2 days. After washing and fixing Vero E6 cell monolayers, SARS-CoV-2 antigen production in cells was detected by continuous incubation with anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological, cat# 40143-MM 05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories, cat# 115-035-062) and chromogenic substrate. The resulting Optical Density (OD) was measured using an enzyme-labeled instrument. The reduction in infectivity of SARS-CoV-2 (as compared to that in the virus control wells) constitutes a positive neutralization reaction, which indicates the presence of neutralizing antibodies in the serum sample. 50% neutralization titer (MN ID ₅₀ ) Is defined as the reciprocal of the serum dilution that reduced viral infectivity by 50% relative to the viral control on each plate. MN ID for each sample ₅₀ Is interpolated by calculating the slope and intercept using the last dilution with OD below 50% neutralization point and the first dilution with OD above 50% neutralization point; MN ID ₅₀ Titer= (OD-intercept of 50% neutralization point)/slope.

Memory B cell analysis

For testing the B cell memory response in NHPs, the monkey IgG/IgA FluoSpot kit (kit; MABTECH, catalog number FS-05R 24G-10) was used. Frozen PBMC were incubated in medium (RPMI 16 containing L-glutamine, 10% FCS and 1% penicillin-streptomycin)40 In culture dishes, resuspended in the same medium supplemented with R848 and recombinant human IL-2 (rhIL-2) at final concentrations of 1. Mu.g/mL and 10ng/mL, respectively, and incubated with 5% CO at 37 ℃C ₂ Incubate for 3 days. FluoSpot plates were coated overnight with 4. Mu.g/mL of SARS-CoV 2S-GCN 4 protein (GeneArt) or 15. Mu.g/mL of anti-IgG and IgA mAbs provided in the kit. Plates were then blocked with complete medium for 1 hour. Pre-stimulated PBMC washes were counted to determine the number of living cells and at 5x10 ⁵ Individual cells/well (for wells coated with SARS-CoV 2S-GCN 4 protein) and 1X10 ⁵ Individual cells/wells (for wells coated with anti-IgG and IgA mabs) were added to the plates. The plates were incubated at 37℃with 5% CO ₂ Incubate for 16-24 hours. After washing, the fluorescently labeled anti-IgG and IgA detection antibodies were added for 2 hours, followed by the fluorescence enhancer. After the plates were air dried for 24 hours, fluorescent spots were counted with a FluoroSpot analyzer. Data are reported as the number of Antibody Secreting Cells (ASCs) per million PBMCs.

Cytokine ELISPOT analysis

For testing cytokine responses in NHPs, the monkey IFN-. Gamma.ELISPOT kit (CTL, catalog No. 3421M-4 APW) and the IL-13ELISPOT kit (CTL, catalog No. 3470M-4 APW) were used. Previously frozen PBMCs were washed, resuspended in media provided by the kit and enumerated. PepMix is used ^TM SARS-CoV-2 peptide library and CovA are used for stimulation. PBMCs were plated at 300,000 cells/well and stimulated overnight. After overnight incubation, the plates were washed and developed according to the manufacturer's instructions. Plates were dried overnight, scanned, and analyzed using a CTL analyzer (immunolS6 general analyzer, CTL) counts the spots. Data are reported as Spot Forming Cells (SFC) per million PBMCs.

Results

In the study of the present invention, mRNA-VAC2 (15. Mu.g, 45. Mu.g or 135. Mu.g) was injected intramuscularly into the deltoid muscle of the right forelimb of a cynomolgus monkey of Marissin origin, aged 2-6 years and weighing in the range of 2-6kg, on day 0 (D0), and then the same amount of mRNA-VAC2 was injected intramuscularly into the other forelimb on day 21 (D21). NHP serum samples were collected at D4, 14, 21, 28, 35, 42, and Peripheral Blood Mononuclear Cells (PBMCs) were isolated at D42. The data reveals a dramatic decrease in neutralization activity in the serum samples of D90 (fig. 11). Convalescent human serum obtained from commercial suppliers (Sanguine Biobank, iSpecmen and PPD) was included in all the immune response assessments assayed. Antibody titers decreased to levels corresponding to single dose immunization.

Six mRNA-VAC2 immunized animals were boosted with preS dTM (3 μg) with AF03 adjuvant at D129. After strengthening D14 (D143), enhancer-induced micro-neutralization (MN) ₅₀ ) The titers (fig. 12) and bound antibody titers (fig. 13) increased robustly 10 to 15 fold. No significant drop in MN and binding titers was observed between 2 and 6 weeks after boosting.

We also explored whether the primary response provided a B cell memory component. We performed ELISPOT analysis on NHP PBMC samples collected prior to boost administration (D90). After immunization of D0 with mRNA-VAC1, the spike-specific memory B cells in PBMC from NHP alone were enumerated at D90 (Table 10). As described above, the total and SARS-CoV-2S specific IgG ASC was enumerated by ELISPOT. The IgG specific activity was calculated as (S-specific IgG ASC/total IgG memory ASC) x100%.

TABLE 10 spike-specific memory B cells in PBMC from NHP alone at D90

NHP ID	mRNA-VAC1 priming dose (. Mu.g)	S-specific IgG ASC%
			1	15	1.5
2	15	0.6
			3	15	0.8
4	15	0.8
			5	45	2.3
6	45	1.9
			7	45	1.1
8	45	0.7
			9	135	0.8
10	135	2.7
			11	135	0.8
12	135	1.1

The data in Table 10 reveals that circulating memory B cells levels in D90 mRNA-VAC1 immunized animals are from 0.6% to 4% regardless of the priming dose used. This level is 5-10 times that reported for other vaccines (Scherer et al, PLoS Pathog. (2014) 10 (12): e1004461; weinberg et al, hum vaccine immunother. (2019) 15:2466-74). This memory B cell level was also consistent with recent reports of six month post-infection immune memory assessment for covd-19 patients.

Table 11 shows the levels of spike-specific memory B cells in PBMC from NHP alone before and after boosting with 3. Mu.g of AF 03-adjuvanted presdTM. Prior to D129 boost, these NHPs were injected with mRNA-VAC2 at the doses indicated in the tables at D0 and D21. As described above, the total and SARS-CoV-2S specific IgG ASC was enumerated by ELISPOT. The IgG specific activity was calculated as (S-specific IgG ASC/total IgG memory ASC) x100%.

TABLE 11 spike-specific memory B cells in NHP PBMC before and after preS dTM boosting

* Numbers in brackets: data from repeated experiments.

The data in table 11 show that memory B cell levels induced by mRNA vaccination are not affected by priming doses in a dose-dependent manner, despite a significant increase in neutralizing and binding antibody titers. The results in table 11 show that the level of memory B cells elicited by mRNA vaccination is very high and may not be effectively significantly enhanced by subunit vaccination. This finding may also be due to the short observation period of the experiment (less than 6 months after vaccination).

Next, we investigated T cell response profiles in seeded NHPs. Vaccine-related enhanced respiratory disease (VAERD) has been a safety issue for the developing COVID-19 vaccine, although the current problem is only a theoretical one (see, e.g., graham et al, science (2020) 368:945-6). Vaced (Graham, supra) has been reported for whole inactivated viral vaccines against measles and Respiratory Syncytial Virus (RSV). One explanation for vard involves antigen-specific CD4 ⁺ T cells are biased to produce Th2 cytokines (e.g., IL-4, IL-5, and IL-13). A similar correlation was reported between Th2 profile and disease enhancement for inactivated SARS-CoV-1 vaccine in mice (Bolles et al, J Virol. (2011) 85:12201-5; teng et al, PLoS One (2012) 7:e35421). Less severe cases of SARS are associated with accelerated induction of Th1 cellular responses (Oh et al, emerg Microbes select (2012) 1:1-6). Similar phenomena have been observed in humans. For example, SARS-CoV-2 specific cellular responses are associated with the severity of the disease: PBMC from rehabilitation patients with mild C OVID-19 symptoms showed high level induction of IFN-gamma by SARS-CoV-2 antigen, while PBMC from patients with severe pneumonia showed significantly reduced levels of this cytokine (Kroemer et al, J effect (2020) 4816, doi:10.1016/j.jin f.2020.08.036). Thus, it is important to understand the T cell profile induced by the vaccination regimen of the invention.

T cell cytokine responses were tested in NHP three weeks after the second mRNA-VAC1 vaccination of D21. Cytokines induced by the combined SARS-CoV-2S protein peptide re-stimulation were evaluated in PBMC by IFN-gamma (Th 1 cytokine) and IL-13 (Th 2 cytokine) ELISPOT assays in D42. Most animals in the three dose level groups tested (10 out of 12) demonstrated the presence of IFN- γ secreting cells, ranging from two to over 100 spot forming cells per million PBMCs. Dose-dependent responses were not observed, as animals in the lower dose level group and the higher dose level group showed a comparable frequency of IFN- γ secreting cells. In contrast, no IL-13 cytokine secreting cells were detected in any of the test groups and at any of the dose levels, indicating that a Th1 biased cellular response was induced (FIG. 14). These data provide clear evidence for the lack of Th2 response to S antigen in NHP following mRNA-VAC1 vaccination. We then examined the cytokine secretion profile from PBMCs of animals boosted with preS dTM at D129. At D171 (post-boost D42), PMBC from the boost animals maintained a Th1/Th2 ratio similar to the pre-boost ratio (fig. 15).

These results demonstrate that primary humoral memory responses induced by two intramuscular mRNA-VAC1 or similar mRNA formulations (e.g., mRNA-VAC 2) immunizations administered 3 weeks apart are effectively enhanced by a single dose of adjuvanted protein vaccine formulation administered at D129. In summary, the prime-boost regimen described herein allows for rapid reappearance of antibodies in the blood after initial introduction of S immunogen delivered via a genetic vaccine. These results indicate that the protein vaccine of the present invention can be introduced as a booster into the covd-19 vaccine routine to provide durable and efficient protection within pre-immune populations.

Sequence listing

SEQ ID NO	Description of the invention
		1	SARS-CoV-2S protein amino acid sequence (Wuhan)
2	SARS-CoV-2S protein signal peptide amino acid sequence
		3	Mutant chitinase signal peptide amino acid sequence
4	SARS-CoV-2 S protein ectodomain amino acid sequence
		5	RRAR
6	GSAS
		7	Folded subunit amino acid sequence
8	Wild type folding subunit coding sequence
		9	Codon optimized folded son coding sequence
10	preS dTM amino acid sequence
		11	Wild type chitinase signal peptide amino acid sequence
12	Polyhedrin promoter burst sequence
		13	Exemplary recombinant SARS-CoV-2S protein
14	Recombinant S protein amino acid sequence derived from B.1.351
		15	gBlock pPSC12-DB 3' fragment sequence
16	F1-gBlock-5' fragment sequence
		17	F1-gBlock-3' fragment sequence
18	F2-gBlock-5' fragment sequence
		19	F2-gBlock-3' fragment sequence
20	F3-gBlock-5' fragment sequence
		21	F3-gBlock-3' fragment sequence
22	gBlock pPSC12-DB 5' fragment 1 sequence
		23	F3b-gBlock-3' fragment sequence
24	gBlock pPSC12-DB 5' fragment 2 sequence

Sequence listing

<110> Sanofife Pasteur Corp

<120> vaccine against SARS-CoV-2 infection

<130> 025532.WO003

<140>

<141>

<150> 63/201,848

<151> 2021-05-14

<150> 63/184,065

<151> 2021-05-04

<150> 63/131,278

<151> 2020-12-28

<150> 63/069,172

<151> 2020-08-24

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 1273

<212> PRT

<213> Severe acute respiratory syndrome coronavirus 2

<400> 1

Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val

1 5 10 15

Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe

20 25 30

Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu

35 40 45

His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp

50 55 60

Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp

65 70 75 80

Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu

85 90 95

Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser

100 105 110

Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile

115 120 125

Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr

130 135 140

Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr

145 150 155 160

Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu

165 170 175

Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe

180 185 190

Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr

195 200 205

Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu

210 215 220

Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr

225 230 235 240

Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser

245 250 255

Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro

260 265 270

Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala

275 280 285

Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys

290 295 300

Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val

305 310 315 320

Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys

325 330 335

Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala

340 345 350

Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu

355 360 365

Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro

370 375 380

Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe

385 390 395 400

Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly

405 410 415

Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys

420 425 430

Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn

435 440 445

Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe

450 455 460

Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys

465 470 475 480

Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly

485 490 495

Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val

500 505 510

Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys

515 520 525

Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn

530 535 540

Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu

545 550 555 560

Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val

565 570 575

Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe

580 585 590

Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val

595 600 605

Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile

610 615 620

His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser

625 630 635 640

Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val

645 650 655

Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala

660 665 670

Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala

675 680 685

Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser

690 695 700

Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile

705 710 715 720

Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val

725 730 735

Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu

740 745 750

Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr

755 760 765

Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln

770 775 780

Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe

785 790 795 800

Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser

805 810 815

Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly

820 825 830

Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp

835 840 845

Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu

850 855 860

Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly

865 870 875 880

Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile

885 890 895

Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr

900 905 910

Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn

915 920 925

Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala

930 935 940

Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn

945 950 955 960

Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val

965 970 975

Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln

980 985 990

Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val

995 1000 1005

Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn

1010 1015 1020

Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys

1025 1030 1035

Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro

1040 1045 1050

Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val

1055 1060 1065

Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His

1070 1075 1080

Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn

1085 1090 1095

Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln

1100 1105 1110

Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val

1115 1120 1125

Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro

1130 1135 1140

Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn

1145 1150 1155

His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn

1160 1165 1170

Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu

1175 1180 1185

Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu

1190 1195 1200

Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Ile Trp Leu

1205 1210 1215

Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile Met

1220 1225 1230

Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys Cys

1235 1240 1245

Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro

1250 1255 1260

Val Leu Lys Gly Val Lys Leu His Tyr Thr

1265 1270

<210> 2

<211> 13

<212> PRT

<213> Severe acute respiratory syndrome coronavirus 2

<400> 2

Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser

1 5 10

<210> 3

<211> 18

<212> PRT

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic peptides'

<400> 3

Met Pro Leu Tyr Lys Leu Leu Asn Val Leu Trp Leu Val Ala Val Ser

1 5 10 15

Asn Ala

<210> 4

<211> 1198

<212> PRT

<213> Severe acute respiratory syndrome coronavirus 2

<400> 4

Gln Cys Val Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr

1 5 10 15

Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser

20 25 30

Ser Val Leu His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn

35 40 45

Val Thr Trp Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys

50 55 60

Arg Phe Asp Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala

65 70 75 80

Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr

85 90 95

Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn

100 105 110

Val Val Ile Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu

115 120 125

Gly Val Tyr Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe

130 135 140

Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln

145 150 155 160

Pro Phe Leu Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu

165 170 175

Arg Glu Phe Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser

180 185 190

Lys His Thr Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser

195 200 205

Ala Leu Glu Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg

210 215 220

Phe Gln Thr Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp

225 230 235 240

Ser Ser Ser Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr

245 250 255

Leu Gln Pro Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile

260 265 270

Thr Asp Ala Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys

275 280 285

Thr Leu Lys Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn

290 295 300

Phe Arg Val Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr

305 310 315 320

Asn Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser

325 330 335

Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr

340 345 350

Ser Val Leu Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly

355 360 365

Val Ser Pro Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala

370 375 380

Asp Ser Phe Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly

385 390 395 400

Gln Thr Gly Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe

405 410 415

Thr Gly Cys Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val

420 425 430

Gly Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu

435 440 445

Lys Pro Phe Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser

450 455 460

Thr Pro Cys Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln

465 470 475 480

Ser Tyr Gly Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg

485 490 495

Val Val Val Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys

500 505 510

Gly Pro Lys Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe

515 520 525

Asn Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys

530 535 540

Lys Phe Leu Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr

545 550 555 560

Asp Ala Val Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro

565 570 575

Cys Ser Phe Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser

580 585 590

Asn Gln Val Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro

595 600 605

Val Ala Ile His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser

610 615 620

Thr Gly Ser Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala

625 630 635 640

Glu His Val Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly

645 650 655

Ile Cys Ala Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg

660 665 670

Ser Val Ala Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala

675 680 685

Glu Asn Ser Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn

690 695 700

Phe Thr Ile Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys

705 710 715 720

Thr Ser Val Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys

725 730 735

Ser Asn Leu Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg

740 745 750

Ala Leu Thr Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val

755 760 765

Phe Ala Gln Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe

770 775 780

Gly Gly Phe Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser

785 790 795 800

Lys Arg Ser Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala

805 810 815

Asp Ala Gly Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala

820 825 830

Ala Arg Asp Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu

835 840 845

Pro Pro Leu Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu

850 855 860

Leu Ala Gly Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala

865 870 875 880

Leu Gln Ile Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile

885 890 895

Gly Val Thr Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn

900 905 910

Gln Phe Asn Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr

915 920 925

Ala Ser Ala Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln

930 935 940

Ala Leu Asn Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile

945 950 955 960

Ser Ser Val Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala

965 970 975

Glu Val Gln Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln

980 985 990

Thr Tyr Val Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser

995 1000 1005

Ala Asn Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln

1010 1015 1020

Ser Lys Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser

1025 1030 1035

Phe Pro Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr

1040 1045 1050

Tyr Val Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile

1055 1060 1065

Cys His Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val

1070 1075 1080

Ser Asn Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu

1085 1090 1095

Pro Gln Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys

1100 1105 1110

Asp Val Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu

1115 1120 1125

Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe

1130 1135 1140

Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly

1145 1150 1155

Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu

1160 1165 1170

Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln

1175 1180 1185

Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys

1190 1195

<210> 5

<211> 4

<212> PRT

<213> Severe acute respiratory syndrome coronavirus 2

<400> 5

Arg Arg Ala Arg

1

<210> 6

<211> 4

<212> PRT

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic peptides'

<400> 6

Gly Ser Ala Ser

1

<210> 7

<211> 27

<212> PRT

<213> unknown

<220>

<221> Source

<223 >/note= "unknown description: foldon sequence'

<400> 7

Gly Tyr Ile Pro Glu Ala Pro Arg Asp Gly Gln Ala Tyr Val Arg Lys

1 5 10 15

Asp Gly Glu Trp Val Phe Leu Ser Thr Phe Leu

20 25

<210> 8

<211> 81

<212> DNA

<213> unknown

<220>

<221> Source

<223 >/note= "unknown description: foldon sequence'

<400> 8

ggttatattc ctgaagctcc aagagatggg caagcttacg ttcgtaaaga tggcgaatgg 60

gtattccttt ctaccttttt a 81

<210> 9

<211> 81

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 9

ggttatatac cagaggctcc tagagatggc caagcatacg tgcgcaaaga tggtgaatgg 60

gtctttctca gcacattctt a 81

<210> 10

<211> 1243

<212> PRT

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic polypeptide'

<400> 10

Met Pro Leu Tyr Lys Leu Leu Asn Val Leu Trp Leu Val Ala Val Ser

1 5 10 15

Asn Ala Gln Cys Val Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala

20 25 30

Tyr Thr Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe

35 40 45

Arg Ser Ser Val Leu His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe

50 55 60

Ser Asn Val Thr Trp Phe His Ala Ile His Val Ser Gly Thr Asn Gly

65 70 75 80

Thr Lys Arg Phe Asp Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr

85 90 95

Phe Ala Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly

100 105 110

Thr Thr Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala

115 120 125

Thr Asn Val Val Ile Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro

130 135 140

Phe Leu Gly Val Tyr Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser

145 150 155 160

Glu Phe Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val

165 170 175

Ser Gln Pro Phe Leu Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys

180 185 190

Asn Leu Arg Glu Phe Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile

195 200 205

Tyr Ser Lys His Thr Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly

210 215 220

Phe Ser Ala Leu Glu Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile

225 230 235 240

Thr Arg Phe Gln Thr Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro

245 250 255

Gly Asp Ser Ser Ser Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val

260 265 270

Gly Tyr Leu Gln Pro Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly

275 280 285

Thr Ile Thr Asp Ala Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr

290 295 300

Lys Cys Thr Leu Lys Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr

305 310 315 320

Ser Asn Phe Arg Val Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn

325 330 335

Ile Thr Asn Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe

340 345 350

Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala

355 360 365

Asp Tyr Ser Val Leu Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys

370 375 380

Tyr Gly Val Ser Pro Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val

385 390 395 400

Tyr Ala Asp Ser Phe Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala

405 410 415

Pro Gly Gln Thr Gly Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp

420 425 430

Asp Phe Thr Gly Cys Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser

435 440 445

Lys Val Gly Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser

450 455 460

Asn Leu Lys Pro Phe Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala

465 470 475 480

Gly Ser Thr Pro Cys Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro

485 490 495

Leu Gln Ser Tyr Gly Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro

500 505 510

Tyr Arg Val Val Val Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr

515 520 525

Val Cys Gly Pro Lys Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val

530 535 540

Asn Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser

545 550 555 560

Asn Lys Lys Phe Leu Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp

565 570 575

Thr Thr Asp Ala Val Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile

580 585 590

Thr Pro Cys Ser Phe Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn

595 600 605

Thr Ser Asn Gln Val Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu

610 615 620

Val Pro Val Ala Ile His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val

625 630 635 640

Tyr Ser Thr Gly Ser Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile

645 650 655

Gly Ala Glu His Val Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly

660 665 670

Ala Gly Ile Cys Ala Ser Tyr Gln Thr Gln Thr Asn Ser Pro Gly Ser

675 680 685

Ala Ser Ser Val Ala Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu

690 695 700

Gly Ala Glu Asn Ser Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro

705 710 715 720

Thr Asn Phe Thr Ile Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met

725 730 735

Thr Lys Thr Ser Val Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr

740 745 750

Glu Cys Ser Asn Leu Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu

755 760 765

Asn Arg Ala Leu Thr Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln

770 775 780

Glu Val Phe Ala Gln Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys

785 790 795 800

Asp Phe Gly Gly Phe Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys

805 810 815

Pro Ser Lys Arg Ser Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr

820 825 830

Leu Ala Asp Ala Gly Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp

835 840 845

Ile Ala Ala Arg Asp Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr

850 855 860

Val Leu Pro Pro Leu Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser

865 870 875 880

Ala Leu Leu Ala Gly Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly

885 890 895

Ala Ala Leu Gln Ile Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn

900 905 910

Gly Ile Gly Val Thr Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile

915 920 925

Ala Asn Gln Phe Asn Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser

930 935 940

Ser Thr Ala Ser Ala Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn

945 950 955 960

Ala Gln Ala Leu Asn Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly

965 970 975

Ala Ile Ser Ser Val Leu Asn Asp Ile Leu Ser Arg Leu Asp Pro Pro

980 985 990

Glu Ala Glu Val Gln Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser

995 1000 1005

Leu Gln Thr Tyr Val Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile

1010 1015 1020

Arg Ala Ser Ala Asn Leu Ala Ala Thr Lys Met Ser Glu Cys Val

1025 1030 1035

Leu Gly Gln Ser Lys Arg Val Asp Phe Cys Gly Lys Gly Tyr His

1040 1045 1050

Leu Met Ser Phe Pro Gln Ser Ala Pro His Gly Val Val Phe Leu

1055 1060 1065

His Val Thr Tyr Val Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala

1070 1075 1080

Pro Ala Ile Cys His Asp Gly Lys Ala His Phe Pro Arg Glu Gly

1085 1090 1095

Val Phe Val Ser Asn Gly Thr His Trp Phe Val Thr Gln Arg Asn

1100 1105 1110

Phe Tyr Glu Pro Gln Ile Ile Thr Thr Asp Asn Thr Phe Val Ser

1115 1120 1125

Gly Asn Cys Asp Val Val Ile Gly Ile Val Asn Asn Thr Val Tyr

1130 1135 1140

Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp

1145 1150 1155

Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp

1160 1165 1170

Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile

1175 1180 1185

Asp Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile

1190 1195 1200

Asp Leu Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Gly Tyr

1205 1210 1215

Ile Pro Glu Ala Pro Arg Asp Gly Gln Ala Tyr Val Arg Lys Asp

1220 1225 1230

Gly Glu Trp Val Phe Leu Ser Thr Phe Leu

1235 1240

<210> 11

<211> 17

<212> PRT

<213> unknown

<220>

<221> Source

<223 >/note= "unknown description: chitinase signal sequence'

<400> 11

Met Leu Tyr Lys Leu Leu Asn Val Leu Trp Leu Val Ala Val Ser Asn

1 5 10 15

Ala

<210> 12

<211> 41

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 12

ctgttttcgt aacagttttg taataaaaaa acctataaat a 41

<210> 13

<211> 1273

<212> PRT

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic polypeptide'

<400> 13

Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val

1 5 10 15

Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe

20 25 30

Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu

35 40 45

His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp

50 55 60

Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp

65 70 75 80

Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu

85 90 95

Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser

100 105 110

Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile

115 120 125

Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr

130 135 140

Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr

145 150 155 160

Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu

165 170 175

Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe

180 185 190

Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr

195 200 205

Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu

210 215 220

Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr

225 230 235 240

Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser

245 250 255

Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro

260 265 270

Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala

275 280 285

Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys

290 295 300

Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val

305 310 315 320

Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys

325 330 335

Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala

340 345 350

Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu

355 360 365

Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro

370 375 380

Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe

385 390 395 400

Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly

405 410 415

Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys

420 425 430

Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn

435 440 445

Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe

450 455 460

Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys

465 470 475 480

Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly

485 490 495

Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val

500 505 510

Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys

515 520 525

Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn

530 535 540

Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu

545 550 555 560

Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val

565 570 575

Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe

580 585 590

Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val

595 600 605

Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile

610 615 620

His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser

625 630 635 640

Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val

645 650 655

Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala

660 665 670

Ser Tyr Gln Thr Gln Thr Asn Ser Pro Gly Ser Ala Ser Ser Val Ala

675 680 685

Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser

690 695 700

Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile

705 710 715 720

Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val

725 730 735

Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu

740 745 750

Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr

755 760 765

Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln

770 775 780

Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe

785 790 795 800

Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser

805 810 815

Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly

820 825 830

Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp

835 840 845

Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu

850 855 860

Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly

865 870 875 880

Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile

885 890 895

Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr

900 905 910

Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn

915 920 925

Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala

930 935 940

Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn

945 950 955 960

Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val

965 970 975

Leu Asn Asp Ile Leu Ser Arg Leu Asp Pro Pro Glu Ala Glu Val Gln

980 985 990

Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val

995 1000 1005

Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn

1010 1015 1020

Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys

1025 1030 1035

Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro

1040 1045 1050

Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val

1055 1060 1065

Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His

1070 1075 1080

Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val Ser Asn

1085 1090 1095

Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln

1100 1105 1110

Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys Asp Val

1115 1120 1125

Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu Gln Pro

1130 1135 1140

Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe Lys Asn

1145 1150 1155

His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly Ile Asn

1160 1165 1170

Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu Asn Glu

1175 1180 1185

Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln Glu Leu

1190 1195 1200

Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Ile Trp Leu

1205 1210 1215

Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile Met

1220 1225 1230

Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys Cys

1235 1240 1245

Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro

1250 1255 1260

Val Leu Lys Gly Val Lys Leu His Tyr Thr

1265 1270

<210> 14

<211> 1240

<212> PRT

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic polypeptide'

<400> 14

Met Pro Leu Tyr Lys Leu Leu Asn Val Leu Trp Leu Val Ala Val Ser

1 5 10 15

Asn Ala Gln Cys Val Asn Phe Thr Thr Arg Thr Gln Leu Pro Pro Ala

20 25 30

Tyr Thr Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe

35 40 45

Arg Ser Ser Val Leu His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe

50 55 60

Ser Asn Val Thr Trp Phe His Ala Ile His Val Ser Gly Thr Asn Gly

65 70 75 80

Thr Lys Arg Phe Ala Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr

85 90 95

Phe Ala Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly

100 105 110

Thr Thr Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala

115 120 125

Thr Asn Val Val Ile Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro

130 135 140

Phe Leu Gly Val Tyr Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser

145 150 155 160

Glu Phe Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val

165 170 175

Ser Gln Pro Phe Leu Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys

180 185 190

Asn Leu Arg Glu Phe Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile

195 200 205

Tyr Ser Lys His Thr Pro Ile Asn Leu Val Arg Gly Leu Pro Gln Gly

210 215 220

Phe Ser Ala Leu Glu Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile

225 230 235 240

Thr Arg Phe Gln Thr Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser

245 250 255

Ser Ser Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu

260 265 270

Gln Pro Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr

275 280 285

Asp Ala Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr

290 295 300

Leu Lys Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe

305 310 315 320

Arg Val Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn

325 330 335

Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val

340 345 350

Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser

355 360 365

Val Leu Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val

370 375 380

Ser Pro Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp

385 390 395 400

Ser Phe Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln

405 410 415

Thr Gly Asn Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr

420 425 430

Gly Cys Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly

435 440 445

Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys

450 455 460

Pro Phe Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr

465 470 475 480

Pro Cys Asn Gly Val Lys Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser

485 490 495

Tyr Gly Phe Gln Pro Thr Tyr Gly Val Gly Tyr Gln Pro Tyr Arg Val

500 505 510

Val Val Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly

515 520 525

Pro Lys Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn

530 535 540

Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys

545 550 555 560

Phe Leu Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp

565 570 575

Ala Val Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys

580 585 590

Ser Phe Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn

595 600 605

Gln Val Ala Val Leu Tyr Gln Gly Val Asn Cys Thr Glu Val Pro Val

610 615 620

Ala Ile His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr

625 630 635 640

Gly Ser Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu

645 650 655

His Val Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile

660 665 670

Cys Ala Ser Tyr Gln Thr Gln Thr Asn Ser Pro Gly Ser Ala Ser Ser

675 680 685

Val Ala Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Val Glu

690 695 700

Asn Ser Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe

705 710 715 720

Thr Ile Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr

725 730 735

Ser Val Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser

740 745 750

Asn Leu Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala

755 760 765

Leu Thr Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe

770 775 780

Ala Gln Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly

785 790 795 800

Gly Phe Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys

805 810 815

Arg Ser Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp

820 825 830

Ala Gly Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala

835 840 845

Arg Asp Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro

850 855 860

Pro Leu Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu

865 870 875 880

Ala Gly Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu

885 890 895

Gln Ile Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly

900 905 910

Val Thr Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln

915 920 925

Phe Asn Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala

930 935 940

Ser Ala Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala

945 950 955 960

Leu Asn Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser

965 970 975

Ser Val Leu Asn Asp Ile Leu Ser Arg Leu Asp Pro Pro Glu Ala Glu

980 985 990

Val Gln Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr

995 1000 1005

Tyr Val Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser

1010 1015 1020

Ala Asn Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln

1025 1030 1035

Ser Lys Arg Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser

1040 1045 1050

Phe Pro Gln Ser Ala Pro His Gly Val Val Phe Leu His Val Thr

1055 1060 1065

Tyr Val Pro Ala Gln Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile

1070 1075 1080

Cys His Asp Gly Lys Ala His Phe Pro Arg Glu Gly Val Phe Val

1085 1090 1095

Ser Asn Gly Thr His Trp Phe Val Thr Gln Arg Asn Phe Tyr Glu

1100 1105 1110

Pro Gln Ile Ile Thr Thr Asp Asn Thr Phe Val Ser Gly Asn Cys

1115 1120 1125

Asp Val Val Ile Gly Ile Val Asn Asn Thr Val Tyr Asp Pro Leu

1130 1135 1140

Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu Asp Lys Tyr Phe

1145 1150 1155

Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp Ile Ser Gly

1160 1165 1170

Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp Arg Leu

1175 1180 1185

Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu Gln

1190 1195 1200

Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Gly Tyr Ile Pro Glu

1205 1210 1215

Ala Pro Arg Asp Gly Gln Ala Tyr Val Arg Lys Asp Gly Glu Trp

1220 1225 1230

Val Phe Leu Ser Thr Phe Leu

1235 1240

<210> 15

<211> 60

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 15

taaataatgc ccttgtacaa attgttaaac gttttgtggt tggtcgccgt tagtaacgcg 60

<210> 16

<211> 60

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 16

attgttaaac gttttgtggt tggtcgccgt tagtaacgcg cagtgtgtta atcttacaac 60

<210> 17

<211> 60

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 17

ctcctactaa attaaatgat ctctgcttta ctaatgtcta tgcagattca tttgtaatta 60

<210> 18

<211> 60

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 18

ctctgcttta ctaatgtcta tgcagattca tttgtaatta gaggtgatga agtcagacaa 60

<210> 19

<211> 60

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 19

ttcacaaata ttaccagatc catcaaaacc aagcaagagg tcatttattg aagatctact 60

<210> 20

<211> 60

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 20

catcaaaacc aagcaagagg tcatttattg aagatctact tttcaacaaa gtgacacttg 60

<210> 21

<211> 57

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 21

atgagcaggt atataaatga gtaattaatt aagtaccgac tctgctgaag aggagga 57

<210> 22

<211> 57

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 22

gtaattaatt aagtaccgac tctgctgaag aggaggaaat tctccttgaa gtttccc 57

<210> 23

<211> 56

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 23

tattcctttc taccttttta taattaatta agtaccgact ctgctgaaga ggagga 56

<210> 24

<211> 56

<212> DNA

<213> artificial sequence

<220>

<221> Source

<223 >/annotation = "description of artificial sequence: synthetic oligonucleotides "

<400> 24

taattaatta agtaccgact ctgctgaaga ggaggaaatt ctccttgaag tttccc 56

Claims (38)

1. An isolated polypeptide comprising, from N-terminus to C-terminus,

(i) A sequence at least 95% identical to residues 19-1243 of SEQ ID NO. 10, wherein residues GSAS (SEQ ID NO. 6) at positions 687-690 of SEQ ID NO. 10 and residues PP at positions 991 and 992 of SEQ ID NO. 10 are maintained in said sequence; and

(ii) A trimerization domain, wherein said trimerization domain comprises SEQ ID No. 7.

2. The isolated polypeptide of claim 1, further comprising (iii) a signal peptide derived from an insect or baculovirus protein, optionally wherein the insect or baculovirus protein is chitinase.

3. The isolated polypeptide of claim 2, wherein the signal peptide comprises SEQ ID No. 3.

4. The isolated polypeptide of claim 1, wherein the polypeptide comprises or has the same sequence as (i) residues 19-1243 of SEQ ID No. 10 or (ii) residues 19-1240 of SEQ ID No. 14.

5. A recombinant SARS-CoV-2S protein, wherein the protein is a trimer of the polypeptide of any one of claims 1-4.

6. The recombinant protein according to claim 5, wherein said protein is a trimer of a polypeptide having the same sequence as (i) residues 19-1243 of SEQ ID No. 10 or (ii) residues 19-1240 of SEQ ID No. 14.

7. A nucleic acid molecule encoding the polypeptide according to any one of claims 1-4, optionally wherein the nucleic acid molecule comprises SEQ ID No. 9.

8. A baculovirus vector for expressing a polypeptide comprising the nucleic acid molecule of claim 7.

9. The baculovirus vector of claim 8 wherein expression of the polypeptide is under the control of a polyhedrin promoter.

10. A method of producing a recombinant SARS-CoV-2S protein, the method comprising

Introducing a baculovirus vector as defined in claim 8 or 9 into an insect cell,

culturing the insect cell under conditions that allow expression and trimerization of the polypeptide, and isolating the recombinant SARS-CoV-2S protein from the culture, wherein the recombinant SARS-CoV-2S protein is a trimer of the polypeptide that does not comprise a signal sequence.

11. A recombinant SARS-CoV-2S protein produced by the method of claim 10.

12. An immunogenic composition comprising one, two, three or more recombinant SARS-CoV-2S proteins according to claim 5, 6 or 11 and a pharmaceutically acceptable carrier, optionally wherein said pharmaceutically acceptable carrier comprises a polypeptide comprising 7.5mM phosphate and 150mM naci and optionally 0.2% polysorbateIs a phosphate buffered saline, pH7.2.

13. An immunogenic composition comprising one, two, three or more recombinant SARS-CoV-2S proteins according to claim 5, 6 or 11, and for each 0.25mL or each dose of said composition comprising or prepared by mixing:

together from 2 μg to 50 μg of the one or more recombinant SARS-CoV-2S proteins,

0.097mg sodium dihydrogen phosphate monohydrate,

0.26mg of anhydrous disodium hydrogen phosphate,

2.2mg of sodium chloride, and,

550 μg polysorbate 20, and

about 0.25mL of water.

14. The immunogenic composition of claim 12 or 13, wherein each dose of the composition comprises or is prepared by mixing:

(i) An antigenic component comprising a total of about 2 to about 45 μg of said one or more recombinant SARS-CoV-2S proteins; and

(ii) A dose of adjuvant, wherein the volume of the adjuvant per dose is 0.25mL and comprises or is prepared by mixing:

12.5mg of squalene, based on total weight of the composition,

1.85mg of sorbitan monooleate,

2.38mg of polyoxyethylene cetostearyl ether,

2.31mg mannitol, and

phosphate buffered saline.

15. The immunogenic composition of any one of claims 12-14, comprising a total of 2.5, 5, 10, 15, or 45 μg of the one or more recombinant SARS-CoV-2S proteins per dose, optionally the volume of the immunogenic composition per dose is 0.25mL without adjuvant or 0.5mL with adjuvant.

16. The immunogenic composition of claim 15, wherein each dose of the composition comprises a total of 5 μg of the one or more recombinant SARS-CoV-2S proteins, optionally wherein the composition comprises equal amounts of two different recombinant SARS-CoV-2S proteins, optionally the volume of the immunogenic composition per dose is 0.25mL without adjuvant or 0.5mL with adjuvant.

17. The immunogenic composition of claim 15, wherein each dose of the composition comprises a total of 10 μg of the one or more recombinant SARS-CoV-2S proteins, optionally wherein the composition comprises equal amounts of two different recombinant SARS-CoV-2S proteins, optionally the volume of the immunogenic composition per dose is 0.25mL without adjuvant or 0.5mL with adjuvant.

18. The immunogenic composition of any one of claims 12-17, comprising recombinant SARS-CoV-2S protein comprising residues 19-1243 of SEQ ID No. 10 and/or recombinant SARS-CoV-2S protein comprising residues 19-1240 of SEQ ID No. 14.

19. A container containing the immunogenic composition of any one of claims 12-18.

20. The container of claim 19, wherein the container is a vial or a syringe.

21. The container of claim 19 or 20, wherein the container contains a single dose or multiple doses of the immunogenic composition.

22. A kit for intramuscular vaccination, wherein the kit comprises two containers, wherein a first container contains a pharmaceutical composition comprising one, two, three or more recombinant SARS-CoV-2S proteins according to claim 5, 6 or 11, and a second container contains an adjuvant.

23. The kit of claim 22, wherein the first container comprises one or more antigen doses, wherein each antigen dose comprises a total of about 2 to 45 μg of the one or more recombinant SARS-CoV-2S proteins provided in 0.25mL of Phosphate Buffered Saline (PBS), optionally wherein the PBS comprises

(i) 7.5mM phosphate and 150mM NaCl,pH 7.2, and optionally 0.2% polysorbate 20; or (b)

(ii) 0.097mg sodium dihydrogen phosphate monohydrate, 0.26mg anhydrous disodium hydrogen phosphate, 2.2mg sodium chloride, 550 μg polysorbate 20, and a sufficient amount of 0.25mL water added.

24. The kit of claim 23, wherein each antigen dose comprises a total of 2.5, 5, 10, 15, or 45 μg of one or more recombinant SARS-CoV-2S proteins, optionally wherein the antigen dose comprises

(i) Recombinant SARS-CoV-2S protein containing residues 19-1243 of SEQ ID NO. 10,

(ii) Recombinant SARS-CoV-2S protein containing residues 19-1240 of SEQ ID NO. 14, or

(iii) Both (i) and (ii).

25. The kit of any one of claims 22-24, wherein the second container comprises one or more doses of the adjuvant, wherein the volume of each dose of the adjuvant is 0.25mL and comprises: in PBS

12.5mg of squalene, based on total weight of the composition,

1.85mg of sorbitan monooleate,

2.38mg of polyoxyethylene cetostearyl ether, and

2.31mg of mannitol, based on the total weight of the tablet,

optionally wherein the PBS comprises or is prepared by mixing:

(i) 7.5mM phosphate and 150mM NaCl,pH 7.2, and optionally polysorbate, optionally polysorbate 20; or (b)

(ii) 0.097mg of sodium dihydrogen phosphate monohydrate, 0.26mg of anhydrous disodium hydrogen phosphate, 2.2mg of sodium chloride, 50-600, optionally 55 or 550 μg of polysorbate, optionally polysorbate 20, and a sufficient amount of 0.25mL of water added.

26. A method of making a vaccine kit, the method comprising:

providing an immunogenic composition according to any one of claims 12-18, and

packaging the composition into a sterile container.

27. A method of preventing or ameliorating covd-19 in a subject in need thereof, the method comprising administering to the subject a prophylactically effective amount of the immunogenic composition of any one of claims 12-18.

28. A method of preventing or ameliorating covd-19 in a subject in need thereof, the method comprising administering to the subject a prophylactically effective amount of the immunogenic composition of any one of claims 12-18, wherein prior to the administering step, the subject has been infected with SARS-CoV-2 or has been vaccinated with a first covd-19 vaccine.

29. The method of claim 28, wherein prior to the administering step, the subject has been vaccinated with a genetic vaccine, a subunit vaccine, or an inactivated vaccine.

30. The method of claim 29, wherein prior to the administering step, the subject has been vaccinated with a genetic vaccine comprising mRNA encoding a recombinant SARS-CoV-2S antigen.

31. The method of any one of claims 28-30, wherein the administering step is performed 4 weeks, one month, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, or one year, optionally four to ten months, further optionally eight months, after infection or after the subject is vaccinated with the first covd-19 vaccine, optionally wherein the immunogenic composition comprises 2.5 or 5 μg of each of the one or more recombinant SARS-CoV-2S proteins, and further optionally wherein the immunogenic composition is monovalent or multivalent.

32. The method of any one of claims 27-31, wherein the prophylactically effective amount is about 2 to 50 μg per dose, optionally 2.5, 5, 10, 15 or 45 μg per dose.

33. The method of any one of claims 27-32, wherein the prophylactically effective amount is optionally administered intramuscularly in a single dose or in two or more doses.

34. The method of claim 33, comprising administering to the subject two doses of the immunogenic composition at intervals of about two weeks to about three months, wherein each dose of the immunogenic composition comprises a total of 2.5, 5, or 10 μg of the one or more recombinant SARS-CoV-2S proteins.

35. The method of claim 34, wherein the interval is about three weeks or about 21 days, or about four weeks or about 28 days, or about one month.

36. The method of any one of claims 27-35, wherein the subject is a human subject, optionally wherein the human subject is a child, an adult, or an elderly adult.

37. Use of the recombinant protein according to claim 5, 6 or 11 or the immunogenic composition according to any one of claims 12-18 for the manufacture of a medicament for prophylactic treatment of covd-19, optionally for use in a method according to any one of claims 27-36.

38. The recombinant protein according to claim 5, 6 or 11 or the immunogenic composition according to any one of claims 12-18 for use in the prophylactic treatment of covd-19, optionally in the method according to any one of claims 27-36.