CN116426617A - A highly sensitive mutation detection system and its application based on the hairpin structure and enzyme cleavage mechanism - Google Patents

Abstract

The invention belongs to the technical field of biological medicine and gene detection, and particularly relates to a high-sensitivity mutation detection system based on a hairpin structure and an enzyme digestion mechanism and application thereof. The invention uses the mutation enrichment detection system to carry out fluorescence quantitative PCR, can realize enrichment of rare gene mutation, and realizes selective high-efficiency amplification of rare gene mutation with mutation templates accounting for one ten thousandth or more. Meanwhile, the invention does not need special reaction reagent and special modification of base, and the cost is low; no special reaction procedure is needed, and the operation is simple.

Description

A highly sensitive mutation detection system and application based on hairpin structure and enzyme cleavage mechanism

technical field

The invention belongs to the technical field of biomedicine and gene detection, and specifically relates to a high-sensitivity mutation detection system and application based on a hairpin structure and an enzyme cutting mechanism.

Background technique

Genetic variations such as DNA point mutations and SNPs (Single Nucleotide Polymorphisms) play an important role in disease development and thus serve as molecular markers for disease diagnosis. For example, BRAF V600E is the most common gene mutation in thyroid cancer, and BRAF V600E detection based on FNBAs (fine-needle aspiration biopsy specimens) is routinely used to aid in the diagnosis of thyroid cancer. Liquid biopsy is a non-invasive diagnostic technique that enables excellent profiling of tumor genomes, including detection of circulating tumor DNA (ctDNA), circulating tumor cells, or exosomes in different fluids. ctDNA liquid biopsy has several advantages, including sample availability, noninvasiveness, and lower tumor heterogeneity. Enrichment of rare mutations in ctDNA of cancer patients holds great promise in guiding therapy as well as monitoring cancer recurrence and even early-stage cancer screening. For example, to determine whether an EGFR (epidermal growth factor receptor) tyrosine kinase inhibitor is the optimal treatment option, testing for EGFR mutations is recommended for all patients with advanced NSCLC tumors.

However, rare single-nucleotide variants are difficult to detect with high sensitivity due to the existence of a large number of wild template backgrounds, which hinders the clinical and diagnostic applications of mutation detection. At present, many methods based on hybridization and PCR have been developed, such as CRISPR-Cas system, endonuclease IV-based detection, ARMS, ASB-PCR, PCR using toehold-hairpin primers, BDA technology, COLD-PCR, etc. However, most of these genotyping methods require specific modified bases, complex operations, limited sensitivity, or limited multiplex detection capabilities. Because of the advantages of technical principles, although digital PCR can detect rare mutations well, it requires special equipment, complex operations and low flexibility in multiplexing.

Contents of the invention

The purpose of the present invention is to provide a highly sensitive mutation detection system and application based on the hairpin structure and enzyme cleavage mechanism. The mutation enrichment detection system can realize the efficient enrichment of rare mutations, and can detect rare mutations of 1/10,000 or more. Singleplex or multiplex detection of mutations.

The invention provides a highly sensitive mutation enrichment detection system, including a primer set and a fluorescent quantitative PCR amplification reagent;

The primer set includes a wild-specific blocking primer and a mutation-specific primer; the wild-specific blocking primer is composed of a complementary sequence and a protruding sequence, the complementary sequence is located at the 3' end, and the 5' of the complementary sequence is end is complementary to the wild-type gene, the overhanging sequence is located at the 5' end, the 5' end of the overhanging sequence is complementary to the base of the wild-type gene, and does not pair with the mutant base of the mutant gene; the mutation-specific primer The base at the 3' end of the gene is complementary to the mutant base of the mutant gene.

Preferably, the length of the first sequence is 15-25 bases, and the length of the protruding sequence is 15-35 bases.

Preferably, the length of the mutation-specific primer is 15-25 bases; the base at the 3' end of the mutation-specific primer is complementary to the mutation base of the mutant gene.

Preferably, the primer set includes a first primer set or a second primer set, and the first primer set includes wild-type specific upstream blocking primers and mutation-specific downstream primers;

The second primer set includes mutation-specific upstream primers and wild-type specific downstream blocking primers.

Preferably, the mutation enrichment detection system further includes a universal luminescent probe.

Preferably, the nucleotide sequences of the primer set and universal probe sequence in the mutation enrichment detection system are as shown in any one or more of combination A) to combination C):

The nucleotide sequences of the wild-specific blocking primer, the mutation-specific downstream primer and the universal luminescent probe in the combination A) are respectively shown in SEQ ID NO.1 to SEQ ID NO.3;

The nucleotide sequences of the wild-specific blocking primer, the mutation-specific downstream primer and the universal luminescent probe in the combination B) are respectively shown in SEQ ID NO.4 to SEQ ID NO.6;

The nucleotide sequences of the wild-type specific blocking primer, the mutation-specific downstream primer and the universal luminescent probe in the combination C) are respectively shown in SEQ ID NO.7-SEQ ID NO.9.

Preferably, the concentrations of the wild-type specific blocking primer, the mutation-specific primer and the universal luminescent probe are independently 0.01-3 μM.

The present invention also provides the application of the mutation enrichment detection system described in the above technical solution in the preparation of gene mutation detection reagents.

Preferably, the gene mutation includes detecting one or more of T790M mutation of EGFR gene, V600E mutation of BRAF gene and L858R mutation of EGFR gene.

The present invention also provides a gene mutation enrichment detection method for non-disease diagnosis, comprising the following steps:

Perform fluorescent quantitative PCR amplification on the DNA of the sample to be tested using the mutation enrichment detection system described in the above technical scheme to obtain the amplified Ct ₁ value of the mutant gene;

Perform fluorescent quantitative PCR amplification on the reference gene with reagents for detecting the reference gene to obtain the amplification Ct ₂ value of the reference gene;

By calculating the difference ΔCt between the amplification Ct ₁ value of the mutated gene and the amplification Ct ₂ value of the reference gene, it is determined whether the test sample contains the gene mutation.

Beneficial effect:

The invention provides a highly sensitive mutation enrichment detection system, including a primer set and a fluorescent quantitative PCR amplification reagent; the primer set includes wild-type specific blocking primers and mutation-specific primers; the wild-type specific blocking primer The primer is composed of a complementary sequence and a protruding sequence, the complementary sequence is located at the 3' end, and the 5' end of the complementary sequence is complementary to the wild-type gene, the protruding sequence is located at the 5' end, and the 5' end of the protruding sequence is It is complementary to the base of the wild-type gene and does not pair with the mutant base of the mutant gene; the base at the 3' end of the mutation-specific primer is complementary to the mutant base of the mutant gene. Using the mutation enrichment detection system to perform fluorescent quantitative PCR can realize the enrichment of rare gene mutations, and realize the selective and efficient amplification of rare gene mutations whose mutation template accounts for 1/10,000 or more. At the same time, the invention does not require special reaction reagents and special modification of bases, and the cost is low; no special reaction procedures are required, and the operation is simple.

The principle of realizing the detection ( FIG. 1 ) is that the present invention uses the mutation enrichment detection method HBC-PCR (hairpin blocker cleavage PCR) in combination with wild-specific blocking primers and mutation-specific primers to detect wild-type templates, The 5'-end base of the wild-specific blocking primer is complementary to the wild-type base, further hindering the possibility of mismatching between the 3'-end base of the mutation-specific primer and the wild-type template, and achieving a greater degree of non-specific amplification inhibition . For the mutant template, the 3'-end base of the mutation-specific primer is complementary to it, thereby achieving primer extension and template amplification, while the 5'-end base of the wild-type specific blocking primer cannot pair with the mutation base at the mutation site , and is digested by the exonuclease activity of Taq enzyme in the subsequent amplification, based on this hairpin and enzyme cutting mechanism, the specific amplification of the mutant template is realized, thereby realizing the effective detection of one in ten thousand rare mutations .

Description of drawings

In order to illustrate the embodiments of the present invention or the technical solutions in the prior art more clearly, the following will briefly introduce the drawings required in the embodiments.

Fig. 1 is the detection schematic diagram of gene mutation enrichment detection method of the present invention;

Fig. 2 is the amplification curve of the EGFR T790M mutant template detected by HBC-PCR with different concentration ratios in Example 1 of the present invention;

3 is a sequencing peak diagram of BRAF V600E mutant templates detected by HBC-PCR in Example 2 of the present invention at different concentration ratios;

Fig. 4 is the Ct value of HBC-PCR multiple detection different concentration ratio mutant type template in the embodiment 3 of the present invention;

Fig. 5 is a graph showing the detection results of BRAF V600E mutation in thyroid cancer biopsy samples and EGFR L858R mutation in lung cancer plasma ctDNA samples using HBC-PCR in Example 4 of the present invention.

Detailed ways

The invention provides a highly sensitive mutation enrichment detection system, including a primer set and a fluorescent quantitative PCR amplification reagent; the primer set includes wild-type specific blocking primers (blocker primers) and mutation-specific primers; the wild-type The specific blocking primer is composed of a complementary sequence and an overhanging sequence, the complementary sequence is located at the 3' end, and the 5' end of the complementary sequence is complementary to the wild-type gene, the overhanging sequence is located at the 5' end, and the overhanging sequence The 5' end of the primer is complementary to the base of the wild-type gene, and does not pair with the mutant base of the mutant gene; the base of the 3' end of the mutation-specific primer is complementary to the mutant base of the mutant gene.

In the present invention, the primer set is preferably designed according to the wild-type template and mutant template of the gene mutation; the reference set includes wild-type specific blocking primers and mutation-specific primers. The 3' end of the wild-specific blocking primer in the present invention is the first sequence complementary to the wild-type gene template, and the 5' end is a protruding sequence complementary to the extended wild-type amplicon to form a hairpin structure. A sequence and an overhang sequence constitute the wild-type specific blocking primer. The 5' end of the protruding sequence of the present invention is complementary to the base of the wild-type gene, and does not pair with the mutant base of the mutant gene. The length of the first sequence of the present invention is preferably 15-25 bases; the length of the protruding sequence is preferably 15-35 bases.

In the present invention, the length of the mutation-specific primer is preferably 15-25 bases; the base at the 3' end of the mutation-specific primer is complementary to the mutation base of the mutant gene.

The wild-specific blocking primers and mutation-specific primers of the present invention are preferably synthetic single-stranded DNA or modified DNA that changes hybridization affinity, and more preferably include locked nucleic acid (LNA), peptide nucleic acid (PNA) or small DNA One or more of groove binders (MGB).

In the present invention, the primer set preferably has two forms of combination, that is, it preferably includes the first primer set or the second primer set, and the first primer set preferably includes wild-type specific upstream blocking primers and mutation-specific downstream primers. Primers; the second primer set includes mutation-specific upstream primers and wild-type specific downstream blocking primers. The characteristics of each component in the first primer set and the second primer set in the present invention are the same as those of the wild-specific blocking primer and mutation-specific primer in the primer set described above, and will not be repeated here. It can be flexibly designed according to the specific detected gene mutation.

In the present invention, the mutation enrichment detection system preferably further includes a universal luminescent probe. The universal luminescent probes of the present invention include but not limited to Taqman probes, molecular beacons or fluorescent dyes. The specificity of qPCR amplification can be enhanced when using universal universal probes.

The concentrations of the wild-type specific blocking primer, the mutation-specific primer and the universal luminescent probe in the present invention are preferably independently 0.01-3 μM.

In the present invention, the mutation enrichment detection system is a single detection system or a multiple detection system. When the mutation enrichment detection system includes a gene mutation, the composed mutation enrichment detection system is a single detection system; when the mutation enrichment detection system includes two or more gene mutations, the composed mutation enrichment detection system The mutation enrichment detection system is a multiple detection system.

In the present invention, the nucleotide sequences of the primer set and universal probe sequence in the mutation enrichment detection system are as shown in any one or more of combination A) to combination C):

The nucleotide sequences of the wild-specific blocking primers, mutation-specific primers and universal luminescent probes in the combination A) are respectively shown in SEQ ID NO.1 to SEQ ID NO.3; the SEQ ID NO. The nucleotide sequence shown in 1～SEQ ID NO.3 is specifically as follows from the 5' end to the 3' end: SEQ ID NO.1: CGCAGCTCATGCCCTTCGGCTGCCTCTTGAGCAGGTACTGGGAG; SEQ ID NO.2: CCGTGCAGCTCATCAT; SEQ ID NO.3: GGACTATGTCCGGGAACA CAAAGA, The 5' and 3' ends of the SEQ ID NO.3 are respectively labeled with ROX and BHQ fluorescent markers, namely ROX-GGACTATGTCCGGGAACACAAAGA-BHQ.

The nucleotide sequences of wild-type specific blocking primers, mutation-specific primers and universal luminescent probes in the combination B) are respectively shown in SEQ ID NO.4 to SEQ ID NO.6; the SEQ ID NO. The nucleotide sequence shown in 4 to SEQ ID NO.6 is as follows from the 5' end to the 3' end: SEQ ID NO.4: ACT GTAGCTAGACCAAAATCACCTATTTAATGAGATCTACTGTTTTTCCT; SEQ ID NO.5: CCACTCCATCGAGATTTCT; SEQ ID NO.6: ACTACACCTCAGATATTTTCTTCATGA, The 5' and 3' ends of the SEQ ID NO. 6 are marked with FAM and BH Q fluorescent markers, namely FAM-ACTACACCTCAGATATATTTCTTCATGA-BHQ.

The nucleotide sequences of the wild-specific blocking primers, mutation-specific primers and universal luminescent probes in the combination C) are respectively shown in SEQ ID NO.7 to SEQ ID NO.9; the SEQ ID NO. The nucleotide sequence shown in 7 to SEQ ID NO.9 is as follows from the 5' end to the 3' end: SEQ ID NO.7: AG CCCAAAATCTGTGATCTTGAATGAACTACTTGGAGGACCG; SEQ ID NO.8: CCAGCAGTTTGGCCC; SEQ ID NO.9: CTGGCAGCCAGGAACGTACTGGT, The 5' and 3' ends of the SEQ ID NO.9 are respectively labeled with ROX and BHQ fluorescent markers, namely ROX-CTGGCAGCCAGGAACGTACTGGT-BHQ.

In the present invention, the fluorescent quantitative PCR amplification reagent preferably includes hot start polymerase, polymerase buffer, dNTPs and MgCl ₂ . In the present invention, there is no special limitation on the source of each component of the fluorescent quantitative PCR amplification reagent, and conventional commercially available products can be used.

The wild-specific blocking primers and mutation-specific primers of the present invention can specifically amplify mutant templates, inhibit or reduce the amplification of wild-type templates, thereby realizing the enrichment of mutant templates and the detection of rare gene mutations.

Based on the above advantages, the present invention also provides the application of the mutation enrichment detection system described in the above technical solution in the preparation of gene mutation detection reagents. The mutation detection in the present invention preferably includes one or more of liquid biopsy, non-invasive prenatal screening, nucleic acid amplification, tumor in vitro diagnosis and genotyping.

In the present invention, the gene mutation preferably includes, but is not limited to, that the mutation detection reagent includes detecting one or more of the T790M mutation of the EGFR gene, the V600E mutation of the BRAF gene, and the L858R mutation of the EGFR gene. The present invention is used to detect the T790M mutation of the EGFR gene, the V600E mutation of the BRAF gene and the L858R mutation of the EGFR gene. The nucleotide sequences of the primer set and the universal probe are sequentially as in the combination A) to combination C in the above technical scheme ), that is, the primer set and universal probe sequence of the T790M mutation of the EGFR gene are shown in combination A), and the primer set and universal probe sequence of the V600E mutation of the BRAF gene are shown in combination B), with And so on, no more details.

The present invention also provides a gene mutation enrichment detection method for non-disease diagnosis, comprising the following steps:

Perform fluorescent quantitative PCR amplification on the DNA of the sample to be tested using the mutation enrichment detection system described in the above technical scheme to obtain the amplified Ct ₁ value of the mutant gene;

Perform fluorescent quantitative PCR amplification on the reference gene with reagents for detecting the reference gene to obtain the amplification Ct ₂ value of the reference gene;

By calculating the difference between the amplification Ct ₁ value of the mutated gene and the amplification Ct ₂ value of the reference gene, it is determined whether the test sample contains the gene mutation.

The present invention uses the mutation enrichment system described in the above technical solution to perform fluorescence quantitative PCR amplification on the DNA of the sample to be tested to obtain the amplification Ct ₁ value of the mutant gene. The sample to be tested in the present invention is preferably a sample containing the gene mutation and/or wild-type gene. The DNA of the present invention preferably includes cDNA obtained by reverse transcription, synthetic plasmid DNA or single-stranded DNA. The present invention has no special limitation on the DNA extraction method of the sample to be tested, and conventional preparation methods in the art can be used. In the present invention, there is no special limitation on the procedure of the fluorescent quantitative PCR amplification, which can be set according to the annealing temperature of the primer set and the fluorescent quantitative PCR amplification reagent.

In the present invention, the reagent for detecting the reference gene is used to perform fluorescence quantitative PCR amplification on the reference gene to obtain the amplification Ct ₂ value of the reference gene. The reference gene of the present invention preferably includes but not limited to the ACTB gene, and the reagents for detecting the ACTB gene preferably include a primer set and a universal probe; the nucleotide sequences of the upstream primer, the downstream primer and the universal probe of the primer set are respectively As shown in SEQ ID NO.10～SEQ ID NO.12; the nucleotide sequence shown in said SEQ ID NO.10～SEQ ID NO.12 is specifically as follows from the 5' end to the 3' end: SEQ ID NO. 10: AGGCATCCTCCACCCTGAAG; SEQ ID NO.11: CATT GTAGAAGGTGTGGTGCC; SEQ ID NO.12: GCATCGTCACCAACTGGGACG, the 5' and 3' ends of the SEQ ID NO.12 are marked with TAMRA and BHQ fluorescent markers, namely TAMRA-GCATCGTCACCAACTGGGACG -BHQ.

After obtaining the amplified Ct ₁ value of the mutated gene and the amplified Ct ₂ value of the reference gene, the present invention determines the difference ΔCt between the amplified Ct ₁ value of the mutated gene and the amplified Ct ₂ value of the reference gene Whether the test sample contains the gene mutation.

The determination method of the present invention preferably includes: the Ct difference ΔCt ₁ obtained by amplifying the wild-type sample The calculation formula of ΔCt in the present invention is preferably as follows: ΔCt ₁ =Ct[mutated gene]-Ct[reference gene]-3 × SD [mutated gene]; when the ΔCt is higher than ΔCt ₁ , it is mutation-negative or below the detection limit and cannot be detected; when the ΔCt is lower than ΔCt ₁ , it is mutation-positive.

The present invention uses the mutation enrichment detection system to perform fluorescent quantitative PCR on the sample to be tested to achieve efficient enrichment of mutant templates. On this basis, by calculating the amplification Ct value of the mutant gene and the amplification Ct value of the reference gene The difference of the value difference is obtained to obtain the detection result. This method is simple to operate, low in cost and strong in specificity.

The enrichment detection method of the present invention can also realize gene mutation detection for disease diagnosis, and the detection steps are the same as above, and will not be repeated here.

In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

Example 1

A gene mutation enrichment detection method, the steps are as follows:

The components of the highly sensitive mutation enrichment detection system are shown in step 1) and step 2):

1) Primer set for T790M mutation of EGFR gene (abbreviated as EGFR T790M), design wild-specific upstream blocking primers, mutation-specific downstream primers and nucleosides of universal fluorescent probes based on wild-type gene templates and mutant-type gene templates The acid sequence is shown in SEQ ID NO.1～SEQ ID NO.3 respectively; The nucleotide sequence shown in said SEQ ID NO.1～SEQ ID NO.3 is specifically as follows from the 5' end to the 3' end: SEQ ID NO.1～SEQ ID NO.3 ID NO.1: CGCAGCTCATGCCCTTCGGCTGCCTCTTGAGCAGGTAC TGGGAG; SEQ ID NO.2: CCGTGCAGCTCATCAT; the sequence of the 5' end and 3' end of SEQ ID NO.3 after fluorescent labeling: ROX-GGACTATGTCCGGGAACACAAAGA-BHQ.

2) The reaction volume of HBC-qPCR is 30μL, containing 2mM MgCl ₂ , 0.2mM dNTPs, wild-type specific upstream blocking primer 0.2μM, mutation-specific primer 0.03μM, universal fluorescent probe 0.07μM, 0.03U/μL heat Start the polymerase; 10 μL of templates with different mutation ratios. When performing qPCR amplification, the templates with different mutation ratios are separately formed into tubes, and the reaction volume of each tube is 30 μL. The templates for each mutation ratio include templates with mutation ratios of 0%, 0.01%, 0.1%, 1%, 10% and 50% respectively; in this embodiment, the mutation ratio refers to the ratio of the mutation template to the total template For example, a template with a mutation ratio of 10% refers to a mixture of 9,000 copies of a mutant template and 81,000 copies of a wild-type template. In the actual configuration, the wild-type template is continuously diluted to obtain templates with different mutation ratios. In this example, the wild-type template is plasmid DNA (synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.), and the mutant-type template is 293T genomic DNA (genomic DNA extracted from 293T cell line).

3) Perform qPCR amplification on the mutation enrichment detection system in step 1) and step 2). The specific procedure is: enzyme activation at 95°C for 3min; denaturation at 95°C for 10s, annealing and extension at 56°C for 30s, 55 cycles.

4) Use the ABIQuantStudio Test system for qPCR amplification and signal acquisition, and the results are shown in Figure 2.

It can be concluded from Fig. 2 that the detection method of the present invention has the ability to detect one in ten thousand mutations.

Example 2

A gene mutation enrichment detection method, the steps are as follows:

The components of the highly sensitive mutation enrichment detection system are shown in step 1) and step 2):

5) Primer set for V600E mutation of BRAF gene (abbreviated as BRAF V600E), design wild-specific upstream blocking primers, mutation-specific downstream primers and nucleosides of universal fluorescent probes based on wild-type gene templates and mutant-type gene templates The acid sequence is shown in SEQ ID NO.4～SEQ ID NO.6 respectively; The nucleotide sequence shown in said SEQ ID NO.4～SEQ ID NO.6 is specifically as follows from the 5' end to the 3' end: SEQ ID NO.4～SEQ ID NO.6 ID NO.4: ACTGTAGCTAGACCAAAAATCACCTATTTAATGAGATCT ACTGTTTTCCT; SEQ ID NO.5: CCACTCCATCGAGATTTCT; the sequence of the 5' end and 3' end of SEQ ID NO.6 after fluorescent labeling: FAM-ACTACACCTCAGATATATTTCT TCATGA-BHQ.

2) The reaction volume of HBC-qPCR is 30 μL, containing 2mM MgCl ₂ , 0.2mM dNTPs, wild-type specific upstream blocking primer 0.2μM, mutation-specific primer 0.2μM, universal fluorescent probe 0.05μM, 0.03U/μL heat Start the polymerase; 10 μL of templates with different mutation ratios. When performing qPCR amplification, the templates with different mutation ratios are separately formed into tubes, and the reaction volume of each tube is 30 μL. The templates for each mutation ratio include templates with mutation ratios of 0%, 0.01%, 0.1%, 1%, 10% and 50% respectively; in this embodiment, the mutation ratio refers to the ratio of the mutation template to the total template For example, a template with a mutation ratio of 10% refers to a mixture of 9,000 copies of a mutant template and 81,000 copies of a wild-type template. In the actual configuration, the wild-type template is continuously diluted to obtain templates with different mutation ratios. In this embodiment, the wild-type template is the genomic DNA of the BHT101 cell line, and the mutant template is the genomic DNA of the 293T cell line.

3) Perform qPCR amplification on the mutation enrichment detection system in step 1) and step 2). The specific procedure is: enzyme activation at 95°C for 3min; denaturation at 95°C for 10s, annealing and extension at 56°C for 30s, 55 cycles.

4) Use the ABIQuantStudio Test system for qPCR amplification and signal acquisition, and the results are shown in Figure 3.

It can be concluded from Fig. 3 that the detection method of the present invention has the ability to detect one in ten thousand mutations.

Example 3

A gene mutation enrichment detection method, the steps are as follows:

The components of the highly sensitive mutation enrichment detection system are shown in step 1) and step 2):

1) Using this method to multiplex detect the V600E mutation of the BRAF gene (abbreviated as BRAF V600E), the L858R mutation of the EGFR gene (abbreviated as EGFR L858R), design wild-specific upstream blocking primers based on the wild-type gene template and the mutant gene template, Mutation-specific downstream primers and universal probes, as shown in Table 1:

Table 1 Multiple detection primer set sequence

2) The reaction volume of HBC-qPCR is 30 μL, containing 2.5 mM MgCl ₂ , 0.2 mM dNTPs, wild-type specific Blocker upstream primer of BRAF V600E 0.2 μM, mutation-specific downstream primer 0.2 μM, universal fluorescent probe 0.05 μM; EGFR The wild-specific Blocker upstream primer of L858R is 0.2 μM, the mutation-specific downstream primer is 0.2 μM, and the universal fluorescent probe is 0.05 μM; the upstream primer of ACTB is 0.2 μM, the downstream primer is 0.2 μM, and the universal fluorescent probe is 0.05 μM; 0.03 U/ μL of hot-start polymerase, 10 μL of templates with different ratios of mutations. When the templates with different mutation ratios were amplified by qPCR, they were separately formed into tubes, and the reaction volume of each tube was 30 μL. The templates for each mutation ratio include templates with mutation ratios of 0%, 0.01%, 0.1%, 1%, and 10% in turn; in this embodiment, the mutation ratio refers to the ratio of the mutation template to the total template, such as mutation The template ratio of 10% refers to the mixture of 9000 copies of the mutant template and 81000 copies of the wild-type template. In the actual configuration, the wild-type template is continuously diluted to obtain templates with different mutation ratios. In this embodiment, the wild-type template is the genomic DNA of the BHT101 cell line and the synthetic plasmid DNA, and the mutant template is the genomic DNA of the 293T cell line.

3) Perform qPCR amplification on the mutation enrichment detection system in step 1) and step 2). The specific procedure is: enzyme activation at 95°C for 3min; denaturation at 95°C for 10s, annealing and extension at 56°C for 30s, 55 cycles.

4) Use the ABIQuantStudio Test system for qPCR amplification and signal acquisition, and the results are shown in Figure 4.

It can be concluded from Fig. 4 that the detection method of the present invention has the ability to detect one in ten thousand mutations.

Example 4

Using the gene mutation enrichment detection method of the present invention to detect the mutation of B RAFV600E in puncture samples of patients with thyroid cancer and EGFR L858R in plasma ctDNA samples of lung cancer patients; a total of 24 puncture DNA samples of thyroid cancer and 12 plasma ctDNA samples of lung cancer patients used. The reaction system of multiplex HBC-PCR is the same as that in Example 3. The results are shown in Figure 5, where A is the Ct value of 24 thyroid cancer puncture DNA samples detected by HBC-PCR, the positive control (PC), the negative control (NC) and the ΔCt value compared with the reference gene; The control is wild-type 293T genomic DNA with a total concentration of 50ng; the positive control is adding mutant DNA to wild-type 293T genomic DNA, and the final mutation ratio configured is 0.1%.

Samples with a ΔCt greater than 17 (indicated by the dotted line) were considered negative and less than 17 were considered positive. An asterisk (*) indicates no amplified signal and was assigned a Ct value of 50. B is the Ct value of 12 lung cancer plasma ctDNA samples detected by HBC-PCR, the positive control (P-C), the negative control (N-C) and the ΔCt value compared with the reference gene. Samples with a ΔCt greater than 18 (indicated by the dotted line) were considered negative and less than 18 were considered positive. An asterisk (*) indicates no amplified signal and was assigned a Ct value of 50.

It can be concluded from FIG. 5 that the gene mutation enrichment detection method (HBC-PCR) in the present invention can be successfully applied to the detection of punctured tissue DNA and plasma ctDNA samples.

Although the foregoing embodiment has described the present invention in detail, it is only a part of the embodiments of the present invention, rather than all embodiments, and people can also obtain other embodiments according to the present embodiment without inventive step, these embodiments All belong to the protection scope of the present invention.

Claims (10)

1. A highly sensitive mutation enrichment detection system, characterized in that it comprises a primer set and a fluorescent quantitative PCR amplification reagent; The primer set includes a wild-specific blocking primer and a mutation-specific primer; the wild-specific blocking primer is composed of a complementary sequence and a protruding sequence, the complementary sequence is located at the 3' end, and the 5' of the complementary sequence is end is complementary to the wild-type gene, the overhanging sequence is located at the 5' end, the 5' end of the overhanging sequence is complementary to the base of the wild-type gene, and does not pair with the mutant base of the mutant gene; the mutation-specific primer The base at the 3' end of the gene is complementary to the mutant base of the mutant gene. 2. The mutation enrichment detection system according to claim 1, characterized in that, the length of the complementary sequence is 15-25 bases, and the length of the protruding sequence is 15-35 bases. 3. The mutation enrichment detection system according to claim 1, characterized in that the length of the mutation-specific primer is 15-25 bases. 4. The mutation enrichment detection system according to claim 1, wherein the primer set includes a first primer set or a second primer set, and the first primer set includes a wild-specific upstream blocking primer and a mutant Specific downstream primers; The second primer set includes mutation-specific upstream primers and wild-type specific downstream blocking primers. 5. The mutation enrichment detection system according to claim 1, characterized in that, the mutation enrichment detection system further comprises a universal luminescence probe. 6. The mutation enrichment detection system according to claim 5, wherein the nucleotide sequences of the primer set and the universal luminescent probe in the mutation enrichment detection system are as in combination A) to combination C). Any one or more of: The nucleotide sequences of the wild-specific blocking primer, the mutation-specific downstream primer and the universal luminescent probe in the combination A) are respectively shown in SEQ ID NO.1 to SEQ ID NO.3; The nucleotide sequences of the wild-specific blocking primer, the mutation-specific downstream primer and the universal luminescent probe in the combination B) are respectively shown in SEQ ID NO.4 to SEQ ID NO.6; The nucleotide sequences of the wild-type specific blocking primer, the mutation-specific downstream primer and the universal luminescent probe in the combination C) are respectively shown in SEQ ID NO.7-SEQ ID NO.9. 7. The mutation enrichment detection system according to claim 5 or 6, wherein the concentrations of the wild-specific blocking primers, mutation-specific primers and universal luminescent probes are independently 0.01-3 μM. 8. Application of the mutation enrichment detection system according to any one of claims 1 to 8 in the preparation of gene mutation detection reagents. 9. The application according to claim 8, wherein the gene mutation comprises detecting one or more of the T790M mutation of the EGFR gene, the V600E mutation of the BRAF gene and the L858R mutation of the EGFR gene. 10. A gene mutation enrichment detection method for non-disease diagnosis, characterized in that it comprises the following steps: Perform fluorescence quantitative PCR amplification on the DNA of the sample to be tested with the mutation enrichment detection system described in any one of claims 1 to 8 to obtain the amplified Ct ₁ value of the mutant gene; Perform fluorescent quantitative PCR amplification on the reference gene with reagents for detecting the reference gene to obtain the amplification Ct ₂ value of the reference gene; By calculating the difference ΔCt between the amplification Ct ₁ value of the mutated gene and the amplification Ct ₂ value of the reference gene, it is determined whether the test sample contains the gene mutation.

Images