CN116426617A - High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application - Google Patents

High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application Download PDF

Info

Publication number
CN116426617A
CN116426617A CN202310456362.0A CN202310456362A CN116426617A CN 116426617 A CN116426617 A CN 116426617A CN 202310456362 A CN202310456362 A CN 202310456362A CN 116426617 A CN116426617 A CN 116426617A
Authority
CN
China
Prior art keywords
mutation
primer
gene
specific
wild
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202310456362.0A
Other languages
Chinese (zh)
Other versions
CN116426617B (en
Inventor
刘兆成
邹健
张瑞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuxi Peoples Hospital
Original Assignee
Wuxi Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuxi Peoples Hospital filed Critical Wuxi Peoples Hospital
Priority to CN202310456362.0A priority Critical patent/CN116426617B/en
Publication of CN116426617A publication Critical patent/CN116426617A/en
Application granted granted Critical
Publication of CN116426617B publication Critical patent/CN116426617B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biological medicine and gene detection, and particularly relates to a high-sensitivity mutation detection system based on a hairpin structure and an enzyme digestion mechanism and application thereof. The invention uses the mutation enrichment detection system to carry out fluorescence quantitative PCR, can realize enrichment of rare gene mutation, and realizes selective high-efficiency amplification of rare gene mutation with mutation templates accounting for one ten thousandth or more. Meanwhile, the invention does not need special reaction reagent and special modification of base, and the cost is low; no special reaction procedure is needed, and the operation is simple.

Description

High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application
Technical Field
The invention belongs to the technical field of biological medicine and gene detection, and particularly relates to a high-sensitivity mutation detection system based on a hairpin structure and an enzyme digestion mechanism and application thereof.
Background
Genetic variations such as DNA point mutations and SNPs (single nucleotide polymorphisms) play an important role in disease progression and thus can be used as molecular markers for disease diagnosis. For example, BRAF V600E is the most common genetic mutation in thyroid cancer, and BRAF V600E detection based on FNBAs (fine needle biopsy specimens) is routinely used to aid in diagnosis of thyroid cancer. Liquid biopsy is a non-invasive diagnostic technique that can well analyze tumor genomes, including detection of circulating tumor DNA (ctDNA), circulating tumor cells, or exosomes in different liquids. ctDNA liquid biopsies have several advantages, including sample availability, non-invasiveness, and lower tumor heterogeneity. Enrichment of rare mutations in ctDNA of cancer patients holds great promise in guiding therapy, monitoring cancer recurrence and even early cancer screening. For example, to determine whether EGFR (epidermal growth factor receptor) tyrosine kinase inhibitors are the optimal treatment regimen, EGFR mutation detection is recommended for all patients with advanced NSCLC tumors.
However, rare single nucleotide variations are difficult to detect with high sensitivity due to the presence of a large background of wild template, which prevents the clinical and diagnostic application of mutation detection. Currently, many hybridization and PCR-based methods have been developed, such as CRISPR-Cas systems, endonuclease IV-based assays, ARMS, ASB-PCR, PCR using toehold-hairpin primers, BDA technology, COLD-PCR, etc. However, most of these genotyping methods require specific modified bases, are complicated to operate, have limited sensitivity or have limited multiplex detection capability. Because of the technical principle advantages, although digital PCR can detect rare mutations well, special equipment is required, the operation is complex and the degree of flexibility of multiplexing is low.
Disclosure of Invention
The invention aims to provide a high-sensitivity mutation detection system based on a hairpin structure and an enzyme digestion mechanism and application thereof, wherein the mutation enrichment detection system can realize efficient enrichment of rare mutation and can detect single or multiple detection of rare mutation of ten-thousandth or more.
The invention provides a high-sensitivity mutation enrichment detection system, which comprises a primer group and a fluorescent quantitative PCR amplification reagent;
the primer group comprises a wild specific blocking primer and a mutation specific primer; the wild specific blocking primer consists of a complementary sequence and a protruding sequence, wherein the complementary sequence is positioned at the 3 'end, the 5' end of the complementary sequence is complementary to a wild type gene, the protruding sequence is positioned at the 5 'end, and the 5' end of the protruding sequence is complementary to a base of the wild type gene and is not paired with a mutant base of the mutant gene; the base at the 3' end of the mutation specific primer is complementarily paired with the mutation base of the mutant gene.
Preferably, the length of the first sequence is 15 to 25 bases, and the length of the protruding sequence is 15 to 35 bases.
Preferably, the length of the mutation specific primer is 15-25 bases; the base at the 3' end of the mutation specific primer is complementarily paired with the mutation base of the mutant gene.
Preferably, the primer set comprises a first primer set or a second primer set, the first primer set comprising a wild-specific upstream blocking primer and a mutation-specific downstream primer;
the second primer set includes a mutation-specific upstream primer and a wild-type specific downstream blocking primer.
Preferably, the mutation enrichment detection system further comprises a universal luminescent probe.
Preferably, the nucleotide sequences of the primer set and the universal probe sequence in the mutation enrichment detection system are as shown in any one or more of the combinations a) to C):
the nucleotide sequences of the wild specific blocking primer, the mutation specific downstream primer and the universal luminescent probe in the combination A) are respectively shown as SEQ ID NO. 1-SEQ ID NO. 3;
the nucleotide sequences of the wild specific blocking primer, the mutation specific downstream primer and the universal luminescent probe in the combination B) are respectively shown as SEQ ID NO. 4-SEQ ID NO. 6;
the nucleotide sequences of the wild specific blocking primer, the mutation specific downstream primer and the universal luminescent probe in the combination C) are respectively shown as SEQ ID NO. 7-SEQ ID NO. 9.
Preferably, the concentrations of the wild specific blocking primer, the mutation specific primer and the universal luminescent probe are respectively and independently 0.01-3 mu M.
The invention also provides application of the mutation enrichment detection system in preparing a gene mutation detection reagent.
Preferably, the genetic mutation comprises detecting one or more of a T790M mutation of the EGFR gene, a V600E mutation of the BRAF gene, and an L858R mutation of the EGFR gene.
The invention also provides a non-disease diagnosis gene mutation enrichment detection method, which comprises the following steps:
the mutation enrichment detection system disclosed by the technical scheme is used for carrying out fluorescent quantitative PCR amplification on DNA of a sample to be detected to obtain amplified Ct of a mutant gene 1 A value;
fluorescent quantitative PCR amplification is carried out on the reference gene by using a reagent for detecting the reference gene, so as to obtain the amplified Ct of the reference gene 2 A value;
by calculating the amplified Ct of the mutant gene 1 Amplified Ct of value and reference Gene 2 And judging whether the sample to be tested contains the gene mutation or not according to the value difference delta Ct.
The beneficial effects are that:
the invention provides a high-sensitivity mutation enrichment detection system, which comprises a primer group and a fluorescent quantitative PCR amplification reagent; the primer group comprises a wild specific blocking primer and a mutation specific primer; the wild specific blocking primer consists of a complementary sequence and a protruding sequence, wherein the complementary sequence is positioned at the 3 'end, the 5' end of the complementary sequence is complementary to a wild type gene, the protruding sequence is positioned at the 5 'end, and the 5' end of the protruding sequence is complementary to a base of the wild type gene and is not paired with a mutant base of the mutant gene; the base at the 3' end of the mutation specific primer is complementarily paired with the mutation base of the mutant gene. The mutation enrichment detection system is used for fluorescence quantitative PCR, so that enrichment of rare gene mutation can be realized, and selective and efficient amplification of rare gene mutation with a mutation template of one ten thousandth or more can be realized. Meanwhile, the invention does not need special reaction reagent and special modification of base, and the cost is low; no special reaction procedure is needed, and the operation is simple.
The principle of the detection (figure 1) is that the invention realizes the non-specific amplification inhibition to a greater extent by combining the wild-type template detection method HBC-PCR (hairpin blocker cleavage PCR) by using the wild-type specific blocking primer and the mutation-specific primer, wherein the 5 '-end base of the wild-type specific blocking primer and the wild base are complementary and paired, so that the possibility of mismatch between the 3' -end base of the mutation-specific primer and the wild template is further hindered. For mutant templates, the 3 '-end base of the mutation specific primer is complementarily paired with the mutant template, so that primer extension and template amplification are realized, while the 5' -end base of the wild specific blocking primer cannot be paired with the mutation base of the mutation site, and is digested by the exonuclease activity of Taq enzyme in the subsequent amplification, and based on the hairpin and enzyme digestion mechanism, the specific amplification of the mutant template is realized, so that the effective detection of rare variation of ten-thousandth is realized.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a schematic diagram of the detection method of the present invention;
FIG. 2 shows the amplification curves of HBC-PCR detection of EGFR T790M mutant templates at different concentration ratios in example 1 of the present invention;
FIG. 3 is a graph showing the sequencing peaks of the mutant template of BRAF V600E with different concentration ratios detected by HBC-PCR in example 2 of the present invention;
FIG. 4 shows the Ct values of mutant templates with different concentration ratios for multiplex detection by HBC-PCR in example 3 of the present invention;
fig. 5 is a graph showing the detection results of mutation in BRAF V600E in thyroid cancer puncture samples and EGFR L858R in lung cancer plasma ctDNA samples using HBC-PCR in example 4 of the present invention.
Detailed Description
The invention provides a high-sensitivity mutation enrichment detection system, which comprises a primer group and a fluorescent quantitative PCR amplification reagent; the primer set comprises a wild specific blocking primer (a blocker primer) and a mutation specific primer; the wild specific blocking primer consists of a complementary sequence and a protruding sequence, wherein the complementary sequence is positioned at the 3 'end, the 5' end of the complementary sequence is complementary to a wild type gene, the protruding sequence is positioned at the 5 'end, and the 5' end of the protruding sequence is complementary to a base of the wild type gene and is not paired with a mutant base of the mutant gene; the base at the 3' end of the mutation specific primer is complementarily paired with the mutation base of the mutant gene.
In the invention, the primer group is preferably designed according to a wild type template and a mutant template of the gene mutation; the reference set includes wild-specific blocking primers and mutation-specific primers. The 3 'end of the wild specific blocking primer is a first sequence complementary with a wild type gene template, the 5' end of the wild specific blocking primer is a protruding sequence complementary with an extended wild type amplicon to form a hairpin structure, and the first sequence and the protruding sequence form the wild specific blocking primer. The 5' end of the protruding sequence is complementary with the base of the wild type gene and does not match with the mutant base of the mutant gene. The length of the first sequence is preferably 15-25 bases; the protruding sequence is preferably 15 to 35 bases.
In the present invention, the length of the mutation-specific primer is preferably 15 to 25 bases; the base at the 3' end of the mutation specific primer is complementarily paired with the mutation base of the mutant gene.
The wild-specific blocking primers and mutation-specific primers of the invention are preferably synthetic single-stranded DNA or modified DNA that alters hybridization affinity, more preferably comprising one or more of Locked Nucleic Acid (LNA), peptide Nucleic Acid (PNA) or minor groove binder of DNA (MGB).
In the present invention, the primer set preferably exists in a combination of two forms, i.e., preferably includes a first primer set, which preferably includes a wild-specific upstream blocking primer and a mutation-specific downstream primer, or a second primer set; the second primer set includes a mutation-specific upstream primer and a wild-specific downstream blocking primer. The characteristics of each component in the first primer group and the second primer group are the same as the characteristics of the wild specific blocking primer and the mutation specific primer in the primer group, and the specific blocking primer and the mutation specific primer are not repeated, so that the specific blocking primer and the mutation specific primer are flexibly designed according to the specific detected gene mutation.
In the present invention, the mutation enrichment detection system preferably further comprises a universal luminescent probe. The universal luminescent probes of the present invention include, but are not limited to, taqman probes, molecular beacons, or fluorescent dyes. The specificity of qPCR amplification can be enhanced when universal probes are used.
The concentrations of the wild specific blocking primer, the mutation specific primer and the universal luminescent probe are preferably 0.01-3 mu M respectively and independently.
In the present invention, the mutation enrichment detection system is a single detection system or a multiplex detection system. When the mutation enrichment detection system comprises a gene mutation, the mutation enrichment detection system is a single-weight detection system; when the mutation enrichment detection system comprises two or more gene mutations, the mutation enrichment detection system is a multiplex detection system.
In the present invention, the nucleotide sequences of the primer set and the universal probe sequence in the mutation enrichment detection system are as shown in any one or more of the combinations a) to C):
the nucleotide sequences of the wild specific blocking primer, the mutation specific primer and the universal luminescent probe in the combination A) are respectively shown as SEQ ID NO. 1-SEQ ID NO. 3; the nucleotide sequences shown in SEQ ID NO. 1-SEQ ID NO.3 are specifically as follows from the 5 'end to the 3' end: SEQ ID NO.1: CGCAGCTCATGCCCTTCGGCTGCCTCTTGAGCAGGTACTGGGAG; SEQ ID NO.2: CCGTGCAGCTCATCAT; SEQ ID NO.3: GGACTATGTCCGGGAACA CAAAGA, the 5 'and 3' ends of the SEQ ID NO.3 are respectively marked with ROX and BHQ fluorescent markers, namely ROX-GGACTATGTCCGGGAACACAAAGA-BHQ.
The nucleotide sequences of the wild specific blocking primer, the mutation specific primer and the universal luminescent probe in the combination B) are respectively shown as SEQ ID NO. 4-SEQ ID NO. 6; the nucleotide sequences shown in SEQ ID NO. 4-SEQ ID NO.6 are specifically as follows from the 5 'end to the 3' end: SEQ ID NO.4: ACT GTAGCTAGACCAAAATCACCTATTTAATGAGATCTACTGTTTTCCT; SEQ ID NO.5: CCACTCCATCGAGATTTCT; SEQ ID NO.6: ACTACACCTCAGATAT ATTTCTTCATGA, FAM and BH Q fluorescent markers, namely FAM-ACTACACCTCAGATATATTTCTTCATGA-BHQ, are respectively marked at the 5 'end and the 3' end of the SEQ ID NO. 6.
The nucleotide sequences of the wild specific blocking primer, the mutation specific primer and the universal luminescent probe in the combination C) are respectively shown as SEQ ID NO. 7-SEQ ID NO. 9; the nucleotide sequences shown in SEQ ID NO. 7-SEQ ID NO.9 are specifically as follows from the 5 'end to the 3' end: SEQ ID NO.7: AG CCCAAAATCTGTGATCTTGAATGAACTACTTGGAGGACCG; SEQ ID NO.8: CCAGCAGTTTGGCCC; SEQ ID NO.9: CTGGCAGCCAGGAACGTACTGGT, the 5 'and 3' ends of the SEQ ID NO.9 are respectively marked with ROX and BHQ fluorescent markers, namely RO X-CTGGCAGCCAGGAACGTACTGGT-BHQ.
In the present invention, the fluorescent quantitative PCR amplification reagent preferably comprises a hot start polymerase, a polymerase buffer, dNTPs and MgCl 2 . The sources of the components of the fluorescent quantitative PCR amplification reagent are not particularly limited, and the fluorescent quantitative PCR amplification reagent is a conventional commercial product.
The wild specific blocking primer and the mutation specific primer can specifically amplify the mutant template and inhibit or reduce the amplification of the wild template, so that enrichment of the mutant template is realized, and detection of rare gene mutation is realized.
Based on the advantages, the invention also provides application of the mutation enrichment detection system in preparing a gene mutation detection reagent. The mutation detection of the present invention preferably comprises one or more of liquid biopsy, noninvasive prenatal screening, nucleic acid amplification, in vitro tumor diagnosis and genotyping.
In the present invention, the genetic mutation preferably includes, but is not limited to, the mutation detection reagent includes detecting one or more of a T790M mutation of the EGFR gene, a V600E mutation of the BRAF gene, and an L858R mutation of the EGFR gene. The nucleotide sequences of the primer group and the universal probe for detecting the T790M mutation of the EGFR gene, the V600E mutation of the BRAF gene and the L858R mutation of the EGFR gene are sequentially shown in the combination A) to the combination C) in the technical scheme, namely the primer group and the universal probe sequence of the T790M mutation of the EGFR gene are shown in the combination A), the primer group and the universal probe sequence of the V600E mutation of the BRAF gene are shown in the combination B), and the like, and are not repeated.
The invention also provides a non-disease diagnosis gene mutation enrichment detection method, which comprises the following steps:
the mutation enrichment detection system disclosed by the technical scheme is used for carrying out fluorescent quantitative PCR amplification on DNA of a sample to be detected to obtain amplified Ct of a mutant gene 1 A value;
fluorescent quantitative PCR amplification is carried out on the reference gene by using a reagent for detecting the reference gene, so as to obtain the amplified Ct of the reference gene 2 A value;
by calculating the amplified Ct of the mutant gene 1 Amplified Ct of value and reference Gene 2 And judging whether the sample to be tested contains the gene mutation or not according to the value difference.
The mutation enrichment system disclosed by the technical scheme of the invention is used for carrying out fluorescent quantitative PCR amplification on DNA of a sample to be detected to obtain amplified Ct of a mutant gene 1 Values. The sample to be tested according to the present invention is preferably a sample containing the gene mutation and/or the wild-type gene. The DNA of the present invention preferably includes cDNA obtained by reverse transcription, synthetic plasmid DNA or single-stranded DNA. The method for extracting the DNA of the sample to be detected is not particularly limited, and the method can be a conventional preparation method in the field. The procedure of the fluorescent quantitative PCR amplification is not particularly limited, and the fluorescent quantitative PCR amplification reagent is set according to the annealing temperature of the primer group.
The invention uses the reagent for detecting the reference gene to carry out fluorescent quantitative PCR amplification on the reference gene to obtain the amplified Ct of the reference gene 2 Values. The reference genes of the invention preferably include, but are not limited to, ACTB genes, and the reagents for detecting ACTB genes preferably include primer sets and universal probes; the nucleotide sequences of the upstream primer, the downstream primer and the universal probe of the primer group are respectively shown as SEQ ID NO. 10-SEQ ID NO. 12; the nucleotide sequences shown in SEQ ID NO. 10-SEQ ID NO.12 are specifically as follows from the 5 'end to the 3' end: SEQ ID NO.10: AGGCATCCTCACCCTGAAG; SEQ ID NO.11: CATT GTAGAAGGTGTGGTGCC; SEQ ID NO.12:GCATCGTCACCAACTGGGACG, TAMRA and BHQ fluorescent markers, namely TAMRA-GCATCGTCACCAACTGGGACG-BHQ, are respectively marked at the 5 'and 3' ends of the SEQ ID NO. 12.
Obtaining amplified Ct of the mutant Gene 1 Amplified Ct of value and reference Gene 2 After the value, the invention calculates the amplified Ct of the mutant gene 1 Amplified Ct of value and reference Gene 2 And judging whether the sample to be tested contains the gene mutation or not according to the value difference delta Ct.
The determination method of the present invention preferably includes: ct difference ΔCt obtained by amplifying wild type samples 1 The calculation formula of the delta Ct is preferably as follows: delta Ct 1 =ct [ mutant gene]-Ct [ reference gene]-3 XSD mutant gene]The method comprises the steps of carrying out a first treatment on the surface of the When the delta Ct is higher than the delta Ct 1 Is mutation negative or is not detectable below the limit of detection when the ΔCt is below ΔCt 1 Is mutation positive.
The invention uses the mutation enrichment detection system to carry out fluorescence quantitative PCR on the sample to be detected to realize the efficient enrichment of the mutant template, and on the basis, the detection result is obtained by calculating the difference value between the amplified Ct value of the mutant gene and the amplified Ct value of the reference gene. The method has the advantages of simple operation, low cost and strong specificity.
The enrichment detection method can also realize the gene mutation detection of disease diagnosis, and the detection steps are the same as above, and are not repeated.
The technical solutions provided by the present invention are described in detail below with reference to the drawings and examples for further illustrating the present invention, but they should not be construed as limiting the scope of the present invention.
Example 1
A method for detecting gene mutation enrichment comprises the following steps:
the components of the high-sensitivity mutation enrichment detection system are shown in the steps 1) and 2):
1) Primer groups for T790M mutation of EGFR gene (abbreviated as EGFR T790M) are designed, a wild-type specific upstream blocking primer is designed according to a wild-type gene template and a mutant-type gene template, and nucleotide sequences of a mutant-type specific downstream primer and a universal fluorescent probe are respectively shown as SEQ ID NO. 1-SEQ ID NO. 3; the nucleotide sequences shown in SEQ ID NO. 1-SEQ ID NO.3 are specifically as follows from the 5 'end to the 3' end: SEQ ID NO.1: CGCAGCTCATGCCCTTCGGCTGCCTCTTGAGCAGGTAC TGGGAG; SEQ ID NO.2: CCGTGCAGCTCATCAT; the 5 'and 3' ends of SEQ ID NO.3 plus a fluorescently labeled sequence: ROX-GGACTATGTCCGGGAACACAAAGA-BHQ.
2) The reaction volume of HBC-qPCR was 30. Mu.L containing 2mM MgCl 2 0.2mM dNTPs, 0.2. Mu.M wild-specific upstream blocking primer, 0.03. Mu.M mutant-specific primer, 0.07. Mu.M universal fluorescent probe, 0.03U/. Mu.L hot start polymerase; the templates with different mutation ratios were 10. Mu.L, and when qPCR amplification was performed, the templates with different mutation ratios were each independently formed into tubes, and the reaction volume of each tube was 30. Mu.L. Wherein the templates of each mutation ratio sequentially comprise templates with mutation ratios of 0%, 0.01%, 0.1%, 1%, 10% and 50%, respectively; in this example, the mutation ratio refers to the ratio of the mutant template to the total template, e.g., a 10% mutant template refers to: the 9000 copies of mutant template and 81000 copies of wild template were mixed, and in the actual configuration, the wild template was continuously diluted to obtain templates with different mutation ratios. In this example, the wild type template was plasmid DNA (synthesized by Shanghai Biotechnology services Co., ltd.) and the mutant template was 293T genomic DNA (genomic DNA extracted from 293T cell line).
3) The mutation enrichment detection system in the step 1) and the step 2) is subjected to qPCR amplification, and the specific procedures are as follows: enzyme activation at 95deg.C for 3min; denaturation at 95℃for 10s and annealing at 56℃for 30s,55 cycles.
4) qPCR amplification and signal acquisition were performed using the ABIQuantStudio Test system, the results are shown in fig. 2.
From fig. 2, it can be derived that: the detection method of the invention has the capability of detecting mutation in ten thousandth.
Example 2
A method for detecting gene mutation enrichment comprises the following steps:
the components of the high-sensitivity mutation enrichment detection system are shown in the steps 1) and 2):
5) A primer group for V600E mutation of the BRAF gene (BRAF V600E for short) is designed, a wild-type specific upstream blocking primer is designed according to a wild-type gene template and a mutant-type gene template, and the nucleotide sequences of a mutant-type specific downstream primer and a universal fluorescent probe are respectively shown as SEQ ID NO. 4-SEQ ID NO. 6; the nucleotide sequences shown in SEQ ID NO. 4-SEQ ID NO.6 are specifically as follows from the 5 'end to the 3' end: SEQ ID NO.4: ACTGTAGCTAGACCAAAATCACCTATTTAATGAGATCT ACTGTTTTCCT; SEQ ID NO.5: CCACTCCATCGAGATTTCT; the 5 'and 3' ends of SEQ ID NO.6 plus a fluorescently labeled sequence: FAM-ACTACACCTCAGATATATTTCT TCATGA-BHQ.
2) The reaction volume of HBC-qPCR was 30. Mu.L containing 2mM MgCl 2 0.2mM dNTPs, 0.2. Mu.M wild-specific upstream blocking primer, 0.2. Mu.M mutant-specific primer, 0.05. Mu.M universal fluorescent probe, 0.03U/. Mu.L hot start polymerase; the templates with different mutation ratios were 10. Mu.L, and when qPCR amplification was performed, the templates with different mutation ratios were each independently formed into tubes, and the reaction volume of each tube was 30. Mu.L. Wherein the templates of each mutation ratio sequentially comprise templates with mutation ratios of 0%, 0.01%, 0.1%, 1%, 10% and 50%, respectively; in this example, the mutation ratio refers to the ratio of the mutant template to the total template, e.g., a 10% mutant template refers to: the 9000 copies of mutant template and 81000 copies of wild template were mixed, and in the actual configuration, the wild template was continuously diluted to obtain templates with different mutation ratios. In this example, the wild type template is BHT101 cell line genomic DNA and the mutant template is 293T cell line genomic DNA.
3) The mutation enrichment detection system in the step 1) and the step 2) is subjected to qPCR amplification, and the specific procedures are as follows: enzyme activation at 95deg.C for 3min; denaturation at 95℃for 10s and annealing at 56℃for 30s,55 cycles.
4) qPCR amplification and signal acquisition were performed using the ABIQuantStudio Test system, the results are shown in fig. 3.
From fig. 3, it can be derived that: the detection method of the invention has the capability of detecting mutation in ten thousandth.
Example 3
A method for detecting gene mutation enrichment comprises the following steps:
the components of the high-sensitivity mutation enrichment detection system are shown in the steps 1) and 2):
1) The method is used for detecting the V600E mutation (BRAF V600E for short) of the BRAF gene in multiple ways, the L858R mutation (EGFR L858R for short) of the EGFR gene is designed into a wild-type upstream blocking primer, a mutation-specific downstream primer and a universal probe according to a wild-type gene template and a mutant-type gene template, and the method is specifically shown in the following table 1:
TABLE 1 multiplex detection primer set sequences
Figure BDA0004199677250000091
Figure BDA0004199677250000101
2) The reaction volume of HBC-qPCR was 30. Mu.L containing 2.5mM MgCl 2 0.2mM dNTPs,BRAF V600E, wild-specific Blocker upstream primer 0.2. Mu.M, mutation-specific downstream primer 0.2. Mu.M, universal fluorescent probe 0.05. Mu.M; wild-specific Blocker upstream primer 0.2. Mu.M, mutation-specific downstream primer 0.2. Mu.M, universal fluorescent probe 0.05. Mu.M for EGFR L858R; upstream primer 0.2. Mu.M, downstream primer 0.2. Mu.M, universal fluorescent probe 0.05. Mu.M of ACTB; 0.03U/. Mu.L of hot start polymerase, 10. Mu.L of templates with different mutation ratios. Templates with different mutation ratios were each independently piped and the reaction volume of each piped was 30 μl during qPCR amplification. Wherein the templates of each mutation ratio sequentially comprise templates with mutation ratios of 0%, 0.01%, 0.1%, 1% and 10%, respectively; in this example, the mutation ratio refers to the ratio of the mutant template to the total template, e.g., a 10% mutant template refers to: the 9000 copies of mutant template and 81000 copies of wild template were mixed, and in the actual configuration, the wild template was continuously diluted to obtain templates with different mutation ratios. In this example, the wild type template is BH T101 cell line genome DNA and synthetic plasmid DNA, and the mutant template is 293T cell line genomic DNA.
3) The mutation enrichment detection system in the step 1) and the step 2) is subjected to qPCR amplification, and the specific procedures are as follows: enzyme activation at 95deg.C for 3min; denaturation at 95℃for 10s and annealing at 56℃for 30s,55 cycles.
4) qPCR amplification and signal acquisition were performed using the ABIQuantStudio Test system, the results are shown in fig. 4.
From fig. 4, it can be derived that: the detection method of the invention has the capability of detecting mutation in ten thousandth.
Example 4
The gene mutation enrichment detection method is adopted to detect the mutation condition of B RAF V600E in a thyroid cancer patient puncture sample and EGFR L858R in a lung cancer patient plasma ctDNA sample; a total of 24 thyroid cancer penetrating DNA samples and 12 lung cancer patient plasma ctDNA samples were used. The reaction system of multiplex HBC-PCR was the same as in example 3. The results are shown in FIG. 5, wherein A is the Ct values of the Positive Control (PC), the Negative Control (NC) and the 24 thyroid cancer puncture DNA samples detected by HBC-PCR, and the delta Ct values obtained by comparison with the reference gene; wherein the negative control is wild type 293T genomic DNA at a total concentration of 50 ng; the positive control was a wild type 293T genomic DNA to which a mutant DNA was added, and the final mutation rate was 0.1%.
Samples with delta Ct greater than 17 (marked with dashed lines) were considered negative and samples with delta Ct less than 17 were considered positive. Asterisks indicate no amplified signal, a Ct value of 50 was assigned. B is Ct values of 12 lung cancer plasma ctDNA samples detected by HBC-PCR, positive control (P-C) and negative control (N-C) and delta Ct values obtained by comparing the Ct values with reference genes. Samples with delta Ct greater than 18 (marked with dashed lines) were considered negative and samples with delta Ct less than 18 were considered positive. Asterisks indicate no amplified signal, a Ct value of 50 was assigned.
As can be seen from FIG. 5, the gene mutation enrichment detection method (HBC-PCR) of the present invention can be successfully applied to the detection of DNA of a puncture tissue and ctDNA of blood plasma.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (10)

1. The high-sensitivity mutation enrichment detection system is characterized by comprising a primer group and a fluorescent quantitative PCR amplification reagent;
the primer group comprises a wild specific blocking primer and a mutation specific primer; the wild specific blocking primer consists of a complementary sequence and a protruding sequence, wherein the complementary sequence is positioned at the 3 'end, the 5' end of the complementary sequence is complementary to a wild type gene, the protruding sequence is positioned at the 5 'end, and the 5' end of the protruding sequence is complementary to a base of the wild type gene and is not paired with a mutant base of the mutant gene; the base at the 3' end of the mutation specific primer is complementarily paired with the mutation base of the mutant gene.
2. The mutation enrichment detection system according to claim 1, wherein the complementary sequence is 15 to 25 bases in length, and the protruding sequence is 15 to 35 bases in length.
3. The mutation enrichment detection system according to claim 1, wherein the mutation specific primer is 15-25 bases in length.
4. The mutation enrichment detection system according to claim 1, wherein the primer set comprises a first primer set or a second primer set, the first primer set comprising a wild-specific upstream blocking primer and a mutation-specific downstream primer;
the second primer set includes a mutation-specific upstream primer and a wild-type specific downstream blocking primer.
5. The mutation enrichment detection system of claim 1, further comprising a universal luminescent probe.
6. The mutation enrichment detection system according to claim 5, wherein the nucleotide sequences of the primer set and the universal luminescent probe in the mutation enrichment detection system are as shown in any one or more of combinations a) to C):
the nucleotide sequences of the wild specific blocking primer, the mutation specific downstream primer and the universal luminescent probe in the combination A) are respectively shown as SEQ ID NO. 1-SEQ ID NO. 3;
the nucleotide sequences of the wild specific blocking primer, the mutation specific downstream primer and the universal luminescent probe in the combination B) are respectively shown as SEQ ID NO. 4-SEQ ID NO. 6;
the nucleotide sequences of the wild specific blocking primer, the mutation specific downstream primer and the universal luminescent probe in the combination C) are respectively shown as SEQ ID NO. 7-SEQ ID NO. 9.
7. The mutation enrichment detection system according to claim 5 or 6, wherein the concentration of the wild-specific blocking primer, the mutation-specific primer and the universal luminescent probe is independently 0.01 to 3 μm.
8. Use of the mutation enrichment detection system according to any of claims 1-8 for the preparation of a gene mutation detection reagent.
9. The use of claim 8, wherein the genetic mutation comprises detecting one or more of a T790M mutation of the EGFR gene, a V600E mutation of the BRAF gene, and an L858R mutation of the EGFR gene.
10. The gene mutation enrichment detection method for non-disease diagnosis is characterized by comprising the following steps:
performing fluorescent quantitative PCR amplification on DNA of a sample to be detected by using the mutation enrichment detection system according to any one of claims 1-8 to obtain an amplified Ct of a mutant gene 1 A value;
test for detecting reference genesFluorescent quantitative PCR amplification is carried out on the reference gene by the reagent to obtain the amplified Ct of the reference gene 2 A value;
by calculating the amplified Ct of the mutant gene 1 Amplified Ct of value and reference Gene 2 And judging whether the sample to be tested contains the gene mutation or not according to the value difference delta Ct.
CN202310456362.0A 2023-04-25 2023-04-25 High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application Active CN116426617B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310456362.0A CN116426617B (en) 2023-04-25 2023-04-25 High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310456362.0A CN116426617B (en) 2023-04-25 2023-04-25 High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application

Publications (2)

Publication Number Publication Date
CN116426617A true CN116426617A (en) 2023-07-14
CN116426617B CN116426617B (en) 2024-04-16

Family

ID=87081397

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310456362.0A Active CN116426617B (en) 2023-04-25 2023-04-25 High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application

Country Status (1)

Country Link
CN (1) CN116426617B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102796817A (en) * 2012-07-06 2012-11-28 陕西北美基因股份有限公司 Method for rapidly detecting mutation of KRAS gene
CN103103269A (en) * 2013-01-18 2013-05-15 陕西北美基因股份有限公司 Method for detecting BRAF (block repeat active flag) gene mutation accurately based on probe fusion technology
CN105408495A (en) * 2013-04-26 2016-03-16 基纽拜奥股份有限公司 A method for blocking polymerase extension of 3 prime DNA ends by stem-loop structure
CN109355362A (en) * 2018-12-18 2019-02-19 苏州唯善生物科技有限公司 A kind of highly sensitive SNPs detection architecture and application
CN113122629A (en) * 2019-12-30 2021-07-16 香港城市大学深圳研究院 Primer and probe for hairpin amplification blocking method for gene mutation detection and application thereof
WO2023279042A2 (en) * 2021-07-02 2023-01-05 Siemens Healthcare Laboratory, Llc Compositions and methods for detection of severe acute respiratory syndrome coronavirus 2 variants

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102796817A (en) * 2012-07-06 2012-11-28 陕西北美基因股份有限公司 Method for rapidly detecting mutation of KRAS gene
CN103103269A (en) * 2013-01-18 2013-05-15 陕西北美基因股份有限公司 Method for detecting BRAF (block repeat active flag) gene mutation accurately based on probe fusion technology
CN105408495A (en) * 2013-04-26 2016-03-16 基纽拜奥股份有限公司 A method for blocking polymerase extension of 3 prime DNA ends by stem-loop structure
CN109355362A (en) * 2018-12-18 2019-02-19 苏州唯善生物科技有限公司 A kind of highly sensitive SNPs detection architecture and application
CN113122629A (en) * 2019-12-30 2021-07-16 香港城市大学深圳研究院 Primer and probe for hairpin amplification blocking method for gene mutation detection and application thereof
WO2023279042A2 (en) * 2021-07-02 2023-01-05 Siemens Healthcare Laboratory, Llc Compositions and methods for detection of severe acute respiratory syndrome coronavirus 2 variants

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
XIONG DING等: "Cleavable hairpin beacon-enhanced fluorescence detection of nucleic acid isothermal amplification and smartphone-based readout", SIENTIFIC REPORTS, vol. 10, no. 1, pages 1 - 9 *

Also Published As

Publication number Publication date
CN116426617B (en) 2024-04-16

Similar Documents

Publication Publication Date Title
CN107034277B (en) Method for detecting low-abundance gene mutation
EP2314717A1 (en) Polynucleotide primers for the detection of mutations in EGFR
CN105164280A (en) Method for DNA amplification with blocking oligonucleotide
CN110541033B (en) Composition for EGFR gene mutation detection and detection method
KR20140010093A (en) Kit and method for sequencing a target dna in a mixed population
CN108456721B (en) Method for synchronously detecting gene mutation and methylation and application thereof
CN112824535A (en) Primer composition for gene mutation multiplex detection and kit thereof
CN112029837A (en) Kit for detecting SNP (Single nucleotide polymorphism) sites based on locked nucleic acid modified recombinase-mediated isothermal amplification method and detection method thereof
CN113186259A (en) Fluorescent isothermal amplification method, amplification system and application for detecting stem-loop nucleic acid
CN110511984B (en) Rapid fluorescence detection method for EGFR gene exon 19 deletion mutation and application
CN114250276B (en) MicroRNA detection system and method based on exponential amplification reaction and Argonaute nuclease
US10851408B2 (en) Methods and kits for detecting gene mutations
CN106498029B (en) Method for increasing diagnostic efficiency of T790M mutation of EGFR
CN106498028B (en) Diagnostic method and kit for T790M mutation of EGFR
CN110295218B (en) Method for quantifying mutant allele burden of target gene
CN116103411A (en) Primer probe composition and kit for detecting helicobacter pylori drug-resistant gene mutation in sample
CN116426617B (en) High-sensitivity mutation detection system based on hairpin structure and enzyme digestion mechanism and application
CN109136367B (en) Method for improving diagnosis efficiency of BRAF gene V600E mutation
CN113881759A (en) EGFR gene mutation detection kit and detection method thereof
CN112779322A (en) Gene mutation detection kit based on non-fluorescence labeled probe and high-resolution melting curve, detection method and application thereof
CN113930501A (en) Digital PCR detection method for human EGFR gene mutation and application
CN118497369B (en) Primer probe composition, ARMS-PCR kit and detection method of human erythrocyte blood group antigen genes
CN116790717B (en) High-specificity universal probe detection system and application
CN115927610B (en) Application of reagent for detecting methylation level of target region in FOXO6 gene in preparation of bladder cancer diagnosis product
CN117821621B (en) Molecular marker of megacoccus equi and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant