CN116426519A - Bisulfite mediated DNA conversion and purification method - Google Patents

Bisulfite mediated DNA conversion and purification method Download PDF

Info

Publication number
CN116426519A
CN116426519A CN202310319470.3A CN202310319470A CN116426519A CN 116426519 A CN116426519 A CN 116426519A CN 202310319470 A CN202310319470 A CN 202310319470A CN 116426519 A CN116426519 A CN 116426519A
Authority
CN
China
Prior art keywords
solution
dna
centrifuge tube
placing
conversion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310319470.3A
Other languages
Chinese (zh)
Inventor
孔吉祥
王兴仔
殷剑峰
王春香
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Jianwei Medical Laboratory Co ltd
Jiangsu Kangwei Century Biotechnology Co ltd
Original Assignee
Beijing Jianwei Medical Laboratory Co ltd
Jiangsu Kangwei Century Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Jianwei Medical Laboratory Co ltd, Jiangsu Kangwei Century Biotechnology Co ltd filed Critical Beijing Jianwei Medical Laboratory Co ltd
Priority to CN202310319470.3A priority Critical patent/CN116426519A/en
Publication of CN116426519A publication Critical patent/CN116426519A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H1/00—Processes for the preparation of sugar derivatives
    • C07H1/06—Separation; Purification
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
    • C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application relates to a method for bisulphite mediated DNA conversion and purification, belonging to the technical field of molecular biology. The method comprises the steps of sulfonating DNA containing unmethylated cytosine in a bisulphite solution environment, deaminating the DNA in a high-concentration salt ion environment by a magnetic bead method, adding an alkaline solution for desulfonation, eluting the DNA, and determining the methylation level of the DNA by a downstream technology. The invention further discloses a bisulphite mediated DNA deamination and desulfonation step, and the sample type can comprise human genome DNA, human fecal nucleic acid, FFPE DNA, free DNA and the like, and has the characteristics of simple operation, short time consumption, high recovery efficiency and automatic operation. The invention improves and optimizes the existing methods in the current market, ensures that the conversion efficiency of unmethylated cytosine of DNA reaches 99 percent, and combines a magnetic bead method to deaminate and desulfonate the converted product to finally obtain the DNA with high conversion efficiency and high quality.

Description

Bisulfite mediated DNA conversion and purification method
Technical Field
The application relates to a method for converting and purifying DNA mediated by bisulphite, in particular to a method for combining deamination and desulfonation with magnetic beads in high-concentration salt ion solution after DNA is sulfonated in bisulphite solution, and converting unmethylated cytosine of the DNA into uracil, and further discloses a bisulphite reagent conversion flow and application of the magnetic beads in operation, and belongs to the technical field of molecular biology.
Background
With the rapid development of basic studies of embryology and oncology, DNA methylation has received increasing attention as one of the important mechanisms of gene epigenetics (epigenetics). Before detecting DNA methylation, the profile of DNA methylation in the genome is first known. Humans have about 30 hundred million base pairs and DNA methylation occurs predominantly at CpG sites (cytosine-phosphate-guanine sites, sites immediately following cytosine in the S DNA sequence). There are about 2800 ten thousand CpG sites in the genome, of which about 60-80% are methylated, whereas in some specific regions, such as promoters, there are sequences enriched for CpG sites, which we call CpG islands, which are usually unmethylated. However, in tumor cells, the overall methylation level is reduced to 20-50%, and 10-60% of CpG sites may be altered in methylation compared to normal cells. After the CpG island of the DNA is methylated, the protein cannot bind to the DNA, so that transcription is silenced and the gene is not expressed. That is, DNA methylation generally acts to inhibit gene transcription when the methylation is in a gene promoter region.
There are many methods currently available for DNA methylation, which can be broadly divided into two categories: one is from the viewpoint of DNA methyltransferases (DNMTs), and the other is from the viewpoint of the DNA methylation level, which in turn is divided into the detection of the overall DNA methylation level and the DNA methylation level of specific gene sequences. With the continued development of high throughput detection techniques, one of the most commonly used techniques for detecting DNA methylation levels is the bisulfite conversion method. During bisulfite treatment, unmethylated cytosine bases are converted to uracil bases in the DNA, which become thymine bases in subsequent PCR amplifications, while methylated cytosine bases remain unchanged. And then, the sequences of the processed and unprocessed DNA can be analyzed and compared through technologies such as sequencing, cloning, qPCR and the like, and the methylation site of the DNA sequence is determined, so that the methylation state of the DNA is determined, and the undetectable epigenetic information is converted into detectable sequence information at the base pair resolution. Compared with other DNA methylation methods, the DNA methylation analysis based on the bisulphite has higher quantitative accuracy, detection sensitivity, high efficiency and broad spectrum of sample analysis.
Taking human genomic DNA as an example, the traditional sulfite transformation method is to ensure the integrity of the DNA, the transformation condition is mild, and the time is long (for example, about 1-3 hours are needed). A method for converting and purifying DNA sulfite disclosed in chinese patent application 201610013476.8, which requires 45-90min of conversion; a method for converting and purifying DNA sulfite disclosed in Chinese patent application 202010479455.1 requires 120min of conversion; a method for converting the bisulfite of nucleic acid base and the method for extracting and purifying the bisulfite disclosed in Chinese patent application 202210667330.0 needs to be converted for 120min.
In addition, the prior art has the following technical problems: conversion and purification cannot be performed on multiple sample types, and only single-type samples are analyzed in most patents; the input range of the nucleic acid sample is not large enough; the conversion efficiency is not high enough; the sample stability is not high enough.
Disclosure of Invention
In view of the above, the invention provides a method for converting and purifying bisulfite mediated DNA, which improves and optimizes the existing methods in the current market, ensures that the conversion efficiency of unmethylated cytosine of the DNA reaches 99 percent, and finally obtains the DNA with high conversion efficiency and high quality by deaminizing and desulfonating the converted product by combining a magnetic bead method.
The bisulfite-mediated DNA conversion and purification method of the invention is a method for converting unmethylated cytosine bases of DNA into uracil bases, and methylated cytosine bases are unchanged. The DNA is bound to the magnetic beads during the deamination and/or desulfonation step.
In the invention, the specific technical scheme for solving the technical problems is as follows:
a method of bisulfite-mediated DNA conversion and purification comprising the steps of:
1) Adding 150-200 mu L of conversion solution and 20-25 mu L of DNA to be treated sample into a centrifuge tube for incubation;
2) Adding 300-500 mu L of buffer MB, 200-300 mu L of isopropanol and 10-20 mu L of uniformly mixed magnetic bead solution into the reaction product, and incubating for 5-10min at room temperature;
3) Placing the centrifuge tube on a magnetic rack for standing for 30s, and sucking and discarding the supernatant after the solution is clarified;
4) Adding 200-500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and after the solution is clarified, absorbing and discarding the supernatant;
5) Adding 200 mu L of buffer DB with pH of 9-12 into the centrifuge tube, oscillating for 10min at room temperature, removing the sulfonic acid group of cytosine bases in the DNA and converting the cytosine bases into uracil bases;
6) Adding 200-500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and after the solution is clarified, absorbing and discarding the supernatant;
7) Repeating the step f;
8) Drying the centrifuge tube at room temperature for 3-5min;
9) Adding 20-80 mu L of eluent into the centrifuge tube, lightly blowing and mixing by using a pipetting gun, oscillating for 10min at 65 ℃, and eluting the DNA from the magnetic beads;
10 Placing the centrifuge tube on a magnetic rack for standing for 30s, sucking the supernatant and placing the supernatant into a new centrifuge tube for storage.
Further, in the step 1), the conversion solution contains 3-6M sodium bisulphite, 3-8M magnesium bisulphite, 20% -50% ammonia bisulphite solution and 0.5% -10% dimethylformamide aqueous solution.
Further, in said step 1), the incubation procedure is as follows:
a1、95℃5min；
a2、60℃10min；
a3、95℃5min；
a4、60℃10min；
a5, keeping the temperature at 4 ℃.
Further, in the step 2), the buffer MB contains 2-6M guanidine isothiocyanate, 2-6M guanidine hydrochloride, 50mM-200mM zinc chloride, 10mM-100mM disodium ethylenediamine tetraacetate, 50mM-200mM sodium chloride, 10mM-80mM calcium chloride, and 50mM-200mM pH 6.8Tri-HCl solution.
Further, in the step 4), the rinsing solution WB contains 75% -85% of ethanol solution.
Further, in the step 5), the buffer DB with the pH of 9-12 contains 1% -10% (g/mL) of sodium hydroxide solution, 10mM-200mM of disodium ethylenediamine tetraacetate, 100mM-500mM of zinc chloride, 50% -80% of ethanol solution and 50mM-250mM of Tri-HCl solution with the pH of 6.8.
Further, in said step 9), the eluent contains 5-15mM of Tri-HCl and 1mM-5mM of EDTA, and the pH is 8-8.5.
In a preferred embodiment of the invention, the bisulfite-mediated DNA conversion and purification method comprises the steps of:
1) Adding 200 mu L of conversion solution and 20 mu L of DNA sample to be treated into a centrifuge tube for incubation;
2) Adding 400 mu L of buffer MB, 200 mu L of isopropanol and 20 mu L of uniformly mixed magnetic bead solution into the reaction product, vibrating and uniformly mixing, placing the mixture on a constant-temperature uniformly mixing instrument, vibrating at 1700rpm for 15min at room temperature (10-30 ℃) and carrying out instantaneous centrifugation;
3) Placing the centrifuge tube on a magnetic rack for standing for 30s, and sucking and discarding the supernatant after the solution is clarified;
4) Adding 500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and sucking the supernatant after the solution is clarified;
5) 200 mu L of buffer DB with pH of 11 is added into the centrifuge tube, the mixture is stirred and mixed uniformly, and then the mixture is placed on a constant temperature mixer, is stirred for 10min at 1700rpm at room temperature (10-30 ℃), and is subjected to instantaneous centrifugation. Desulfonating cytosine bases in the DNA and converting them to uracil bases;
6) Adding 500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and sucking the supernatant after the solution is clarified;
7) Repeating the step f;
8) Drying the centrifuge tube at room temperature for 3-5min;
9) Adding 30 mu L of eluent into the centrifuge tube, lightly blowing and mixing by a pipetting gun, shaking and mixing uniformly, placing on a constant-temperature mixing instrument, shaking at 1700rpm for 10min at room temperature (10-30 ℃), and performing instantaneous centrifugation;
10 Placing the centrifuge tube on a magnetic rack for standing for 30s, sucking the supernatant and placing the supernatant into a new centrifuge tube for storage.
Wherein, the liquid crystal display device comprises a liquid crystal display device,
in the step 1), the conversion solution contains 5M sodium bisulphite, 3M magnesium bisulphite, 40% v/v ammonia bisulphite solution and 1% v/v dimethylformamide water solution.
In said step 1), the incubation procedure is as follows:
a1、95℃5min；
a2、60℃10min；
a3、95℃5min；
a4、60℃10min；
a5, keeping the temperature at 4 ℃.
In said step 2), buffer MB contains 4M guanidine isothiocyanate, 2M guanidine hydrochloride, 40mM disodium edetate, 150mM zinc chloride, 150mM sodium chloride, 50mM calcium chloride and 100mM solution of Tri-HCl at pH 6.8.
In said step 4), the rinse solution WB contains 80% v/v ethanol solution.
In the step 5), the buffer DB having a pH of 11 contains 2% (g/mL) of sodium hydroxide solution, 150mM of disodium ethylenediamine tetraacetate, 200mM of zinc chloride, 70% of ethanol solution and 100mM of Tri-HCl solution having a pH of 6.8.
In said step 9), the eluate contained 10mM Tri-HCl and 1mM EDTA, pH 8-8.5.
According to the invention, the rapid conversion of DNA can be realized by a sulfite conversion method, the DNA denaturation is combined into one by the combination of the bisulfite conversion under the combined action of the thermal denaturation and the chemical denaturation, 20 mu L of DNA sample is added into 200 mu L of conversion solution (PH 5.0) to denature for 5min at 95 ℃ and convert for 10min at 60 ℃ and the mixture is circulated twice; after the conversion is completed, 600 mu L of binding solution is added to mix the silicon-based magnetic beads to bind nucleic acid for 15min, the rinsing solution is washed once, 200 mu L of desulfonation solution is added to desulfonate for 10min, the rinsing solution is washed twice, and the purified DNA is eluted from the magnetic beads by adding the eluent for DNA methylation analysis. Compared with similar products in the market, the product remarkably improves the conversion efficiency, further obtains high-quality DNA, and makes important contribution to exploring the relationship between DNA methylation and other epigenetic phenomena and the relationship between abnormal DNA methylation and the occurrence and development of cancers.
Compared with the prior art, the method solves the following problems:
1) The prior art has long conversion time, and the common conversion time is 1-5 h; the invention adopts a circulating PCR program, shortens the conversion time, and ensures that the conversion time is only 30min; solves the problem of long conversion time;
2) The prior art can not convert and purify various sample types, and the invention can simultaneously convert and purify DNA sulfite of various samples, such as human genome DNA, plasma cf DNA, FFPE and human fecal nucleic acid;
3) The input range of the nucleic acid sample in the prior art is not large enough, and the input span of the nucleic acid is large, for example, the DNA sample with the input amount of 2 mug-2 ng can be transformed and purified.
4) The conversion efficiency in the prior art is not high enough, and the conversion efficiency can reach 99% after the second generation sequencing;
5) The sample in the prior art has poor stability, and the sample recovery stability is good;
6) The invention can realize automatic extraction.
Compared with the prior art, the bisulfite mediated DNA conversion and purification method has the following technical effects:
1) The conversion solution of the method can improve the conversion efficiency of unmethylated cytosine of DNA to 99%, and obtain DNA with higher quality for subsequent experiments. The present invention has a large nucleic acid input span, and can be used for transformation and purification of DNA samples with input amount of 2 mug-2 ng. The dimethylformamide contained in the conversion solution can be covalently bound with the nucleophilic center of the DNA, so that the DNA sample can stably exist in the experimental reaction at high temperature. The buffer MB contains calcium chloride, so that impurities such as proteins can be reduced, and the buffer MB and the buffer DB contain zinc chloride and can precipitate DNA, so that the recovery rate is effectively improved.
2) The invention can make DNA conversion reach 99% through two-time temperature changing actions of 95-60 ℃, and simultaneously greatly reduce conversion time, and finally purify the obtained DNA by combining the magnetic bead method and desulfonation under alkaline condition. After analysis and verification, the method has the characteristics of high conversion efficiency and high recovery rate, and the converted sample can be directly subjected to qPCR or sequencing detection, so that the sensitivity is higher;
3) DNA transformation and purification using the kit required about 3.5 hours for treatment of one sample and 4.5 hours for treatment of a batch of samples (20 samples); the method adjusts the conversion time and the purification method of the DNA after conversion, and the method takes 1.5 hours for processing one sample and only 2.5 hours for processing one batch of samples (20 samples), compared with the method, the method has more advantages when processing a large batch of samples, and simultaneously the method can realize the automatic operation of a 32-channel and 96-channel nucleic acid extractor, realize the extraction and purification of a larger batch of samples, and has shorter time and lower labor cost.
Drawings
In order to more clearly illustrate the technical solution of the implementation of the invention, the following description of the drawings will be given with illustrative data. It is evident that the drawings in the following description are only some embodiments of the present invention and that other drawings may be obtained from these drawings without inventive effort for a person of ordinary skill in the art.
FIG. 1 is a real-time fluorescence PCR amplification curve of a sample of human genomic Hela cells genomic DNA transformed and purified at the same concentration by the method of the present invention.
FIG. 2 is a real-time fluorescence PCR amplification curve of human genomic DNA, plasma cf DNA, FFPE, human fecal DNA transformed and purified by the method of the present invention and the commercial kit method; wherein 1 is the real-time fluorescence PCR amplification curve of the human genome DNA converted and purified by the method and the commercialized kit method, 2 is the real-time fluorescence PCR amplification curve of the plasma cf DNA converted and purified by the method and the commercialized kit method, 3 is the real-time fluorescence PCR amplification curve of FFPE converted and purified by the method and the commercialized kit method, and 4 is the real-time fluorescence PCR amplification curve of the human fecal DNA converted and purified by the method and the commercialized kit method.
FIGS. 3 and 4 show the conversion efficiency of unmethylated cytosines by second generation sequencing after transformation and purification of human genomic DNA by the methods of the present invention and commercial kit methods.
Detailed Description
The technical scheme in the embodiment of the present invention will be specifically described below in connection with the embodiment of the present invention. The implementation scheme is only a part of the invention and does not comprise all the implementation modes. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, are intended to fall within the scope of the present invention.
The magnetic bead solution of the invention is purchased from YB-100OH produced by medical wave biotechnology company of suppliers; hela cells, 293T cells, plasma cf DNA, FFPE samples, human fecal nucleic acid were all from Jiangsu kang, a century biotechnology Co., ltd.
EXAMPLE 1 bisulphite conversion and purification of human genomic HeLa cell DNA at the same concentration Using the present invention
The Hela cell DNA sample employed in this example was human genomic Hela cell DNA extracted by a commercial human genome extraction kit.
1. Reagent preparation
(1) Preparation of conversion solution
The conversion solution contained 5M sodium bisulphite, 3M magnesium bisulphite, 40% v/v ammonia bisulphite solution and 1% v/v dimethylformamide aqueous solution.
The preparation method comprises the following steps: 0.5mol of sodium bisulfite, 0.3mol of magnesium bisulfite, 40mL of ammonium bisulfite solution, 1mL of dimethylformamide solution and 30mL of sterile water are put into a water bath kettle to be heated to be completely dissolved, and after the temperature of the solution is reduced to room temperature, the sterile water is added to be added for supplementing 100mL.
(2) Preparation of buffer MB
Buffer MB contains 4M guanidine isothiocyanate, 2M guanidine hydrochloride, 40mM disodium edetate, 150mM zinc chloride, 150mM sodium chloride, 50mM calcium chloride, and 100mM Tris-HCl solution at pH 6.8.
The preparation method comprises the following steps: to 10mL of 1mol/L solution of 6.8Tri-HCl and 10mL of sterile water were added 0.4mol of guanidine isothiocyanate, 0.2mol of guanidine hydrochloride, 4mmol of disodium ethylenediamine tetraacetate, 15mmol of zinc chloride, 15mmol of sodium chloride, and 5mmol of calcium chloride, and the mixture was heated to dissolve, cooled to room temperature, and the solution was fixed to 100mL with sterile water.
(3) Preparation of rinsing solution WB
The rinse solution WB contained 80% v/v ethanol solution.
The preparation method comprises the following steps: 10mL of sterile water was added to 40mL of ethanol and mixed well for use.
(4) preparation of buffer DB at pH 11
The buffer DB at pH 11 contained 2% (g/mL) sodium hydroxide solution, 150mM disodium ethylenediamine tetraacetate, 200mM zinc chloride, 70% ethanol solution and 100mM Tri-HCl solution at pH 6.8.
The preparation method comprises the following steps: 1g of NaOH, 7.5mmol of disodium ethylenediamine tetraacetate, 10mmol of zinc chloride and 35mL of ethanol solution are added, 5mL of 1mol/L of solution of 6.8Tri-HCl with pH and 5mL of sterile water are heated for dissolution, and after cooling to room temperature, the solution is fixed to 50mL.
(5) Preparation of eluent
The eluate contained 10mM Tri-HCl and 1mM EDTA, pH 8-8.5.
The preparation method comprises the following steps: to 1mmol EDTA solid was added 10mmol Tri-HCl to a volume of 1L.
2. Bisulphite mediated DNA transformation and purification
The Hela cell DNA sample employed in this example was human genomic Hela cell DNA extracted by a commercial human genome extraction kit.
The method for bisulfite mediated DNA transformation and purification is carried out as follows:
1) Adding 200 mu L of prepared conversion solution and 20 mu L of DNA to be treated into a centrifuge tube, reversing, uniformly mixing, and centrifuging for a short time;
2) Placing the centrifuge tubes in a PCR instrument, and performing thermal cycling reaction according to the following table setting conditions:
temperature (temperature) Time
95℃ 5min
60℃ 10min
95℃ 5min
60℃ 10min
4℃ Holding
3) Taking a new 1.5mL centrifuge tube, sequentially adding 400 mu L of buffer MB, 200 mu L of isopropanol, 220 mu L of converted product and 20 mu L of magnetic bead solution, shaking and uniformly mixing, placing on a constant temperature mixer, shaking at 1700rpm for 15min at room temperature (10-30 ℃) and performing instantaneous centrifugation.
4) Placing the centrifuge tube on a magnetic rack for standing for 30s, and sucking and discarding the waste liquid.
5) Adding 500 mu L of rinsing solution WB into the centrifuge tube, performing instantaneous centrifugation after blowing or shaking and mixing uniformly by a pipetting gun, standing on a magnetic rack for 30s, and sucking and discarding waste liquid.
6) 200 mu L of buffer DB is added into a centrifuge tube, a pipetting gun blows or shakes and mixes uniformly, the mixture is placed on a constant temperature mixing instrument, the mixture is incubated at 1700rpm for 10min at room temperature (10-30 ℃) and centrifuged instantaneously, and the mixture is placed on a magnetic rack for standing for 30s, and waste liquid is sucked and removed.
7) Adding 500 mu L of rinsing solution WB into the centrifuge tube, blowing or vibrating the rinsing solution WB by a pipetting gun, uniformly mixing, standing on a magnetic rack for 30s after instantaneous centrifugation, and sucking and discarding waste liquid.
8) Adding 500 mu L of rinsing solution WB into the centrifuge tube, blowing or vibrating the rinsing solution WB with a liquid transferring gun, uniformly mixing, standing on a magnetic rack for 30s after short centrifugation, absorbing and discarding waste liquid, and drying the waste liquid as clean as possible at room temperature for 3-5min (observing that the surface of the magnetic bead becomes matt and the magnetic bead has no dry crack).
9) Adding 30 mu L of eluent into the centrifuge tube, blowing by a liquid-transferring gun or shaking and mixing by vortex, placing the mixture on a constant-temperature mixing instrument, shaking at 1700rpm for 10min at room temperature (10-30 ℃) and standing for 30s on a magnetic rack after instantaneous centrifugation, and transferring the eluted product into a new centrifuge tube for later use.
Referring to example 1 above, 5 sets of parallel assays were performed simultaneously with bisulfite conversion, and after conversion was completed, 3 μl of the eluted product was aspirated for methylation detection by real-time fluorescent PCR.
The detection results are shown in Table 1 and FIG. 1, and the methylation status was detected by real-time fluorescence PCR using the methylation specific primer SDC2 and the human genome reference ACTB by performing bisulfite conversion of human genome Hela cell DNA using the above-described reagents.
Table 1 shows the real-time fluorescence PCR data of the human genome Hela cell genome DNA sample transformed and purified by the method of the invention; wherein FAM-SDC2 represents the Ct value of the SDC2 gene amplified by the fluorescent probe with FAM, and VIC-ACTB represents the Ct value of the ACTB gene amplified by the fluorescent probe with FAM; FIG. 1 is a real-time fluorescence PCR amplification curve of a sample of human genomic Hela cells genomic DNA transformed and purified at the same concentration by the method of the present invention.
TABLE 1
Figure BDA0004151153400000091
The results showed that the Ct values of the 5 groups were substantially equivalent. The bisulfite mediated DNA conversion and purification method has high conversion efficiency and recovery rate, and is simple and convenient to operate.
Example 2 comparison of the method of the invention with the method of ZYMO RESEARCH commercial kit
The 293T cell DNA sample adopted in the embodiment is human genome 293T cell DNA extracted by a commercial human genome extraction kit, and the rest of blood plasma cf DNA, FFPE and human fecal nucleic acid are all from Jiangsu kang which is century biotechnology Co.
1. The bisulfite-mediated DNA conversion and purification method is carried out as follows:
1) Taking 2 eight-row tubes, adding 200 mu L of conversion solution respectively, and respectively adding 20 mu L of 100 ng/mu L of 293T cell DNA sample to be treated, 20 mu L of 10 ng/mu L of 293T cell DNA sample to be treated, 20 mu L of 1 ng/mu L of 293T cell DNA sample to be treated, 20 mu L of 0.1 ng/mu L of 293T cell DNA sample to be treated and 20 mu L of real plasma cf DNA sample into each eight-row tube added with the conversion solution (3 biological replicates); 20 μl FFPE samples (3 biological replicates); 20 μl of human fecal nucleic acid (3 biological replicates), mixed upside down, and centrifuged briefly;
each eight rows of tubes were placed in a PCR instrument and subjected to a thermal cycling reaction under the following table set conditions:
temperature (temperature) Time
95℃ 5min
60℃ 10min
95℃ 5min
60℃ 10min
4℃ Holding
2) Taking a new 1.5mL centrifuge tube, sequentially adding 400 mu L of buffer MB, 200 mu L of isopropanol, 220 mu L of converted product and 20 mu L of magnetic bead solution, shaking and uniformly mixing, placing on a constant temperature mixer, shaking at 1700rpm for 15min at room temperature (10-30 ℃) and performing instantaneous centrifugation.
3) Placing the centrifuge tube on a magnetic rack for standing for 30s, and sucking and discarding the waste liquid.
4) Adding 500 mu L of rinsing solution WB into the centrifuge tube, performing instantaneous centrifugation after blowing or shaking and mixing uniformly by a pipetting gun, standing on a magnetic rack for 30s, and sucking and discarding waste liquid.
5) 200 mu L of buffer DB is added into a centrifuge tube, a pipetting gun blows or shakes and mixes uniformly, the mixture is placed on a constant temperature mixing instrument, the mixture is incubated at 1700rpm for 10min at room temperature (10-30 ℃) and centrifuged instantaneously, and the mixture is placed on a magnetic rack for standing for 30s, and waste liquid is sucked and removed.
6) Adding 500 mu L of rinsing solution WB into the centrifuge tube, blowing or vibrating the rinsing solution WB by a pipetting gun, uniformly mixing, standing on a magnetic rack for 30s after instantaneous centrifugation, and sucking and discarding waste liquid.
7) Adding 500 mu L of rinsing solution WB into the centrifuge tube, blowing or vibrating the rinsing solution WB with a liquid transferring gun, uniformly mixing, standing on a magnetic rack for 30s after short centrifugation, absorbing and discarding waste liquid, and drying the waste liquid as clean as possible at room temperature for 3-5min (observing that the surface of the magnetic bead becomes matt and the magnetic bead has no dry crack).
8) Adding 30 mu L of eluent into the centrifuge tube, blowing by a liquid-transferring gun or shaking and mixing by vortex, placing the mixture on a constant-temperature mixing instrument, shaking at 1700rpm for 10min at room temperature (10-30 ℃) and standing for 30s on a magnetic rack after instantaneous centrifugation, and transferring the eluted product into a new centrifuge tube for later use.
9) After the conversion was completed, 3. Mu.L of each eluted product was aspirated for methylation detection by real-time fluorescent PCR.
2. Comparison of the method of the invention with the method of ZYMO RESEARCH commercial kit
The 293T cell DNA sample adopted in the embodiment is human genome 293T cell DNA extracted by a commercial human genome extraction kit, and the rest of blood plasma cf DNA, FFPE and human fecal nucleic acid are all from Jiangsu kang which is century biotechnology Co.
The 15 DNA samples to be treated were bisulphite converted and purified according to the instructions of the ZYMO RESEARCH commercial kit. After the conversion was completed, 3. Mu.L of each eluted product was aspirated and methylation was detected by real-time fluorescent PCR.
When the converted DNA is subjected to real-time fluorescence PCR methylation detection, the sample to be treated of the DNA with 14 concentrations before conversion is used as a control, and the CT values of the 15 DNA samples after conversion are compared.
The test results are shown in the following table:
tables 2-5 are real-time fluorescence PCR data for human genomic DNA, plasma cf DNA, FFPE, human fecal DNA transformed and purified by the methods of the present invention and commercial kit methods; wherein FAM-SDC2 represents the Ct value of the SDC2 gene amplified by the fluorescent probe with FAM, and VIC-ACTB represents the Ct value of the ACTIN gene amplified by the fluorescent probe with FAM; FIG. 2 is a real-time fluorescence PCR amplification curve of human genomic DNA, plasma cf DNA, FFPE, human fecal DNA transformed and purified by the method of the present invention and by the method of commercial kits.
a. 293T cell DNA
TABLE 2
Figure BDA0004151153400000121
b. Plasma cf DNA
TABLE 3 Table 3
Figure BDA0004151153400000122
c、FFPE
TABLE 4 Table 4
Figure BDA0004151153400000123
d. Human fecal nucleic acid sample
TABLE 5
Figure BDA0004151153400000124
In the above table, the transformation efficiency was determined by detecting 293T cell DNA,3 plasma cf DNA,3 FFPE,3 human fecal nucleic acids at 4 concentrations. Methylation detection was performed on different treated DNA samples by methylation specific primer SDC2 and human genome reference ACTB, wherein the template for the negative control was water. The result shows that the DNA sample before transformation, the reference gene (ACTB) and the target gene (SDC 2) have no values, the Ct value of the sample after transformation and purification is equivalent to that of a ZYMO RESEARCH commercial kit (shown in tables 2-5), the quantitative curve is similar (shown in figure 2), and the DNA methylation detection by combining the bisulfite transformation and the magnetic bead purification is equivalent to that of the ZYMO RESEARCH commercial kit method.
The DNA sample of the human genome 293T cell with the input amount of 2ng is selected for second generation sequencing, as shown in FIG. 3 (the invention) and FIG. 4 (ZYMO RESEARCH), the conversion and purification method has no obvious difference with the conversion efficiency of the ZYMO RESEARCH kit, and both reach 99%. In particular, the method has the advantages of simpler and more convenient operation, short time consumption, low cost of the used reagent, high DNA conversion efficiency and purification rate after treatment, high detection sensitivity, and capability of being converted into full-automatic and standardized operation.
In fig. 3 and 4, the sequences of DNA1 and DNA2 are as follows:
SEQ ID NO.1homo DNA1 (before conversion):
gggtcaaatggtatttctagttctagatccctgaggaatcgccacactgacttcctcaatggttgaactagtttacagtc ccaccaacagtgtaaaagtgttcctatt
SEQ ID NO.2 homoDNA 2 (after transformation):
gggtTaaatggtatttTtagttTtagatTTTtgaggaatTgTTaTaTtgaTttTTtTaatggttgaaTtagttta TagtTTTaTTaaTagtgtaaaagtgttTTtatt
in FIGS. 3 and 4, the DNA1 sequences in both figures are identical, as are the DNA2 sequences in both figures.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.

Claims (9)

1. A method for bisulfite-mediated DNA conversion and purification comprising the steps of:
1) Adding 150-200 mu L of conversion solution and 20-25 mu L of DNA to be treated sample into a centrifuge tube for incubation;
2) Adding 300-500 mu L of buffer MB, 200-300 mu L of isopropanol and 10-20 mu L of uniformly mixed magnetic bead solution into the reaction product, and incubating for 5-10min at room temperature;
3) Placing the centrifuge tube on a magnetic rack for standing for 30s, and sucking and discarding the supernatant after the solution is clarified;
4) Adding 200-500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and after the solution is clarified, absorbing and discarding the supernatant;
5) Adding 200 mu L of buffer DB with pH of 9-12 into the centrifuge tube, and oscillating for 10min at room temperature;
6) Adding 200-500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and after the solution is clarified, absorbing and discarding the supernatant;
7) Repeating the step f;
8) Drying the centrifuge tube at room temperature for 3-5min;
9) Adding 20-80 mu L of eluent into the centrifuge tube, lightly blowing and mixing by using a pipetting gun, oscillating for 10min at 65 ℃, and eluting the DNA from the magnetic beads;
10 Placing the centrifuge tube on a magnetic rack for standing for 30s, sucking the supernatant and placing the supernatant into a new centrifuge tube for storage.
2. The method according to claim 1, wherein in the step 1), the conversion solution contains 3-6M sodium bisulphite, 3-8M magnesium bisulphite, 20% -50% ammonia bisulphite solution and 0.5% -10% dimethylformamide aqueous solution.
3. The method according to claim 1, wherein in step 1), the incubation procedure is as follows:
a1、95℃5min；
a2、60℃10min；
a3、95℃5min；
a4、60℃10min；
a5, keeping the temperature at 4 ℃.
4. The method according to claim 1, wherein in step 2), the buffer MB contains 2-6M guanidine isothiocyanate, 2-6M guanidine hydrochloride, 50mM-200mM zinc chloride, 10mM-100mM disodium ethylenediamine tetraacetate, 50mM-200mM sodium chloride, 10mM-80mM calcium chloride, and 50mM-200mM pH 6.8Tri-HCl solution.
5. The method of claim 1, wherein in step 4), the rinse solution WB comprises 75% -85% ethanol solution.
6. The method according to claim 1, wherein in the step 5), the buffer DB having a pH of 9-12 contains 1% -10% (g/mL) sodium hydroxide solution, 10mM-200mM disodium edetate, 100mM-500mM zinc chloride, 50% -80% ethanol solution, and 50mM-250mM Tri-HCl solution having a pH of 6.8.
7. The method according to claim 1, wherein in step 9), the eluent contains 5-15mM Tri-HCl and 1mM-5mM EDTA, pH 8-8.5.
8. The method of any one of claims 1-7, wherein the method of bisulfite-mediated DNA conversion and purification comprises the steps of:
1) Adding 200 mu L of conversion solution and 20 mu L of DNA sample to be treated into a centrifuge tube for incubation;
2) Adding 400 mu L of buffer MB, 200 mu L of isopropanol and 20 mu L of uniformly mixed magnetic bead solution into the reaction product, vibrating and uniformly mixing, placing the mixture on a constant-temperature uniformly mixing instrument, vibrating at 1700rpm for 15min at room temperature (10-30 ℃) and carrying out instantaneous centrifugation;
3) Placing the centrifuge tube on a magnetic rack for standing for 30s, and sucking and discarding the supernatant after the solution is clarified;
4) Adding 500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and sucking the supernatant after the solution is clarified;
5) Adding 200 mu L of buffer solution DB with pH of 11 into the centrifuge tube, shaking and uniformly mixing, placing on a constant-temperature mixing instrument, shaking at 1700rpm at room temperature (10-30 ℃) for 10min, and performing instantaneous centrifugation; desulfonating cytosine bases in the DNA and converting them to uracil bases;
6) Adding 500 mu L of rinsing solution WB into the centrifuge tube, oscillating for 1-2min, cleaning DNA adsorbed on the magnetic beads, placing the centrifuge tube on a magnetic rack, standing for 30s, and sucking the supernatant after the solution is clarified;
7) Repeating the step f;
8) Drying the centrifuge tube at room temperature for 3-5min;
9) Adding 30 mu L of eluent into the centrifuge tube, lightly blowing and mixing by a pipetting gun, shaking and mixing uniformly, placing on a constant-temperature mixing instrument, shaking at 1700rpm for 10min at room temperature (10-30 ℃), and performing instantaneous centrifugation;
10 Placing the centrifuge tube on a magnetic rack for standing for 30s, sucking the supernatant and placing the supernatant into a new centrifuge tube for storage.
9. The method of claim 8, wherein the step of determining the position of the first electrode is performed,
in the step 1), the conversion solution contains 5M sodium bisulphite, 3M magnesium bisulphite, 40% v/v ammonia bisulphite solution and 1% v/v dimethylformamide water solution;
in said step 1), the incubation procedure is as follows:
a1、95℃5min；
a2、60℃10min；
a3、95℃5min；
a4、60℃10min；
a5, keeping the temperature at 4 ℃;
in the step 2), the buffer MB contains 4M guanidine isothiocyanate, 2M guanidine hydrochloride, 40mM disodium ethylenediamine tetraacetate, 150mM zinc chloride, 150mM sodium chloride, 50mM calcium chloride and 100mM solution of Tri-HCl with pH of 6.8;
in the step 4), the rinsing water WB contains 80% v/v ethanol solution;
in the step 5), the buffer DB with the pH of 11 contains 2% (g/mL) of sodium hydroxide solution, 150mM of disodium ethylenediamine tetraacetate, 200mM of zinc chloride, 70% of ethanol solution and 100mM of Tri-HCl solution with the pH of 6.8;
in said step 9), the eluate contained 10mM Tri-HCl and 1mM EDTA, pH 8-8.5.
CN202310319470.3A 2023-03-29 2023-03-29 Bisulfite mediated DNA conversion and purification method Pending CN116426519A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310319470.3A CN116426519A (en) 2023-03-29 2023-03-29 Bisulfite mediated DNA conversion and purification method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310319470.3A CN116426519A (en) 2023-03-29 2023-03-29 Bisulfite mediated DNA conversion and purification method

Publications (1)

Publication Number Publication Date
CN116426519A true CN116426519A (en) 2023-07-14

Family

ID=87089999

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310319470.3A Pending CN116426519A (en) 2023-03-29 2023-03-29 Bisulfite mediated DNA conversion and purification method

Country Status (1)

Country Link
CN (1) CN116426519A (en)

Similar Documents

Publication Publication Date Title
CN109722431B (en) Non-alcohol virus nucleic acid extraction kit based on magnetic bead method
CN111269963B (en) One-step nucleic acid extraction and transformation kit and use method thereof
WO2013064066A1 (en) Method for constructing methylated high-throughput sequencing library for whole genome and use thereof
US20060286577A1 (en) Methods for detection of methylated DNA
US10648032B2 (en) High-throughput sequencing method for methylated CpG island in trace DNA
CN107858409A (en) A kind of micro degrading genes group DNA methylation builds storehouse sequence measurement and its kit
CN109295500B (en) Single cell methylation sequencing technology and application thereof
CN113943763A (en) Method for reducing nucleic acid and detection method thereof
CN113604540A (en) Method for rapidly constructing RRBS sequencing library by using blood circulation tumor DNA
TW201321520A (en) Method and system for virus detection
CN112941635A (en) Second-generation sequencing library building kit and method for improving library conversion rate
CN109837344B (en) Methylated EphA7 nucleotide fragment, detection method and application thereof
CN116426519A (en) Bisulfite mediated DNA conversion and purification method
WO2020135347A1 (en) Method for detecting dna methylation, test kit, device and application
CN116004608B (en) Method and composition for rapidly extracting nucleic acid
CN114574560A (en) Rapid DNA sulfite conversion reagent and method
CN113846160A (en) Forward-screening cytosine methylation rapid detection method and application of peroxytungstate in oxidation of 5hmC to thT
CN112375809A (en) Hybridization capture kit and method for performing hybridization capture by using same
CN111593092A (en) Method for converting and purifying DNA bisulfite
WO2020135650A1 (en) Method for constructing a gene sequencing library
CN113373237A (en) Primer group and method for detecting sheep FecB gene polymorphism by utilizing qPCR technology
CN112301118B (en) Method and kit for simultaneously obtaining RNA abundance and active RNA polymerase sites in full transcriptome range
CN110438120A (en) A kind of kit and its method extracting microbe genome DNA from blood
CN117089598B (en) Methylation detection sample pretreatment kit for urine extraction-free direct sulfite conversion and application thereof
CN103509785A (en) Legionella DNA (deoxyribonucleic acid) extraction kit and method for extracting legionella DNA

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination