CN116421577A

CN116421577A - miRNA bionic nano-selenium particles for targeting liver and improving lipid deposition, and preparation method and application thereof

Info

Publication number: CN116421577A
Application number: CN202310670993.2A
Authority: CN
Inventors: 黄家强; 李桐; 罗云; 王连顺; 董玉兰; 王鹏杰
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2023-06-08
Filing date: 2023-06-08
Publication date: 2023-07-14
Anticipated expiration: 2043-06-08
Also published as: CN116421577B

Abstract

The invention discloses miRNA bionic nano-selenium particles for targeting liver and improving lipid deposition, and preparation and application thereof; adsorbing miR-148a-3p inhibitor on the surface of chitosan-modified nano-selenium particles through electrostatic action, further coating a platelet membrane on the surface of a carrier, realizing targeting to liver parts through intravenous injection, and prolonging the circulation time of the carrier in vivo; the nano selenium particles improve the blood lipid level by enhancing the expression of low density lipoprotein receptor (Low density lipoprotein receptor, LDLR) in liver cells; and releasing selenium element to regulate the intracellular oxidation-reduction balance, so as to finally relieve liver lipid deposition; the preparation method has wide application prospect in the non-alcoholic fatty liver gene therapy drug.

Description

miRNA bionic nano-selenium particles for targeting liver and improving lipid deposition, and preparation method and application thereof

Technical Field

The invention relates to the technical field of medicines, and provides a preparation method and application of miRNA bionic nano-selenium particles based on platelet membrane coating to target liver and improve lipid deposition.

Background

Nonalcoholic fatty liver disease (Nonalcoholic fatty liver, NAFLD) is a chronic inflammatory metabolic disease characterized by hepatic parenchymal cell steatosis and fat accumulation without history of excessive alcohol consumption. Currently, the prevalence of NAFLD is up to 30% worldwide, and patients often have symptoms of obesity, type II diabetes and insulin resistance, further developing liver fibrosis, even liver cancer. Furthermore, epidemiological studies have found that blood selenium levels in NAFLD patients are significantly reduced, indicating that there is a link between trace element-selenium and glycolipid metabolism. For several years, although there are a large variety of medicines for treating NAFLD clinically, there are problems of large side effects, inaccurate curative effects, etc., and the risk of NAFLD accompanying complications and lack of approved therapies are major obstacles for treating the disease, so there is an urgent need to design or modify existing medicines to treat NAFLD or reverse related liver complications.

At present, most of medicines for treating diseases clinically are chemical small molecule medicines and antibody medicines, and targets of the medicines are proteins including kinase, antigen, receptor and the like. In the human genome, about 80% of pathogenic proteins associated with human diseases are non-patent proteins, which are difficult to target. Therefore, in order to meet clinical demands, small nucleic acid drugs have been developed, so that drug targets are expanded to upstream of proteins, and the expression of target genes can be specifically up-regulated or down-regulated, so that the treatment is more accurate and personalized, and great potential is presented in the treatment of serious human diseases. Wherein micrornas (micrornas, mirnas) are a type of non-coding single-stranded RNA molecules of about 22 nucleotides in length encoded by endogenous genes, which degrade or inhibit translation of target genes by complementary pairing with the 3' -non-coding region (Untranslated region, UTR) of the target genes, thereby inhibiting downstream protein expression and achieving the effect of disease treatment. However, in vitro synthesized unmodified mirnas are easily degraded by nucleases in serum after entering the body, and are difficult to deliver efficiently and stably; the synthesis cost of the chemically modified miRNA is high, and the clinical effect can be influenced by serious toxic and side effects caused by non-targeting effects. Therefore, the development of low-toxicity and high-efficiency nano-carriers for targeted delivery of miRNA to disease sites and prolongation of the cycle time of miRNA in vivo has important clinical significance.

Selenium (Se) is a trace element essential for human body, and has been paid attention to by researchers at home and abroad due to its narrow nutrition-toxicity dosage range. Researches show that the nano-sized zero-valent selenium particles (Selenium nanoparticles, seNPs) have unique oxidation resistance and good biocompatibility, and are very ideal nano-drugs and drug carriers. Furthermore, recent studies have demonstrated that platelet membranes offer potential advantages for nanoparticle coatings. Platelets are bioactive small masses of cytoplasm which are dissociated from the cytoplasm of mature megakaryocytes in bone marrow, and are produced in a large amount in human body, and survive for 7-10 days on average in circulation. Platelets can avoid activation of the immune system by membrane surface CD 47-mediated macrophage escape and CD 55/59-mediated complement activation and endocytosis by hepatocytes in a gpibα glycoprotein-dependent manner. Therefore, by utilizing the characteristics of natural homing of platelets to the liver and immune escape, a platelet-like nano-selenium drug-carrying system is designed and constructed, and miRNA is coated, so that the targeted delivery of miRNA to the liver is expected to be increased. Finally, the synergistic effect of selenium and miRNA is realized, the drug concentration at the target part is improved, and the curative effect is improved.

Research shows that no related research and related patent application for improving lipid deposition by targeting liver by using nano-selenium particles coated by platelet membrane to load miR-148a-3p exist at present.

Disclosure of Invention

In order to overcome the defects in the prior art, the following technical scheme is provided:

the first aspect of the invention provides a bionic nano-selenium particle, which consists of a miRNA bionic nano-selenium particle coated by a platelet membrane, wherein the miRNA is miR-148a-3p inhibitor. In a specific embodiment, the miR-148a-3p inhibitor has a sequence of ACAAAGUUCUGUAGUGCACUGA (SEQ ID NO: 1); preferably, the miR-148a-3p inhibitor sequence is modified by methylation, further wherein the modification is a methylation modification of each base in the inhibitor, and the sequence is mamcmamamamgmum umcmumnmtmumgmumgm m amcmumgmma (SEQ ID NO: 2); in a specific embodiment, the nano-selenium is chitosan which reduces Na in the presence of vitamin C ₂ SeO ₃ Is prepared by the method; the diameter of the bionic nano-selenium particles is 70+/-5 nm, and the encapsulation rate of the bionic nano-selenium particles for adsorbing miRNA is 73+/-5%.

The second aspect of the invention provides a preparation method of bionic nano-selenium particles, which comprises the following steps:

1) In situ reduction of Na using Vitamin C (VC) ₂ SeO ₃ Preparing chitosan-nano selenium particles by the method;

2) mixing miR-148a-3p inhibitor mother liquor and chitosan-nano selenium solution thoroughly, and carrying out vortex oscillation;

3) Collecting platelet precipitate from whole blood, re-suspending with PBS solution containing protease inhibitor, repeatedly freezing and thawing to obtain platelet membrane fragments, and performing ultrasonic treatment for 10-15 min to obtain platelet membrane vesicles;

4) Passing the platelet membrane vesicles obtained in the step 3) through a liposome extruder of a filter membrane, and obtaining platelet membranes after physical extrusion to uniform particle size;

5) Mixing the platelet membrane obtained in the step 4) with the nano-selenium solution obtained in the step 2), incubating, performing ultrasound, passing through a liposome extruder of a filter membrane, co-extruding, and centrifuging to remove superfluous vesicles to obtain encapsulated bionic nano-selenium particles;

6) Performing transmission electron microscope observation, and measuring a dispersion coefficient and a zeta unit; and (5) measuring the particle size.

In a specific embodiment, the operation of step 1) is: chitosan is dissolved in 1 percent glacial acetic acid, and the weight-volume ratio is 1 to 2 percent; 500-800r/min light-shielding magnetic stirring for 10-14h; slowly dripping 15-30mmol/L sodium selenite solution, and magnetically stirring for 20-40min at 00-800 r/min; slowly dripping 80mmol/L Vc solution, magnetically stirring for 30min at 600r/min, transferring into a reagent bottle, and storing in a refrigerator at 4 ℃, wherein the volumes of the sodium selenite solution and the Vc solution are the same as the volume of glacial acetic acid.

In another specific embodiment, the operation of step 2) is to take 10. Mu.M FAM standard miR-148a-3p inhibitor mother liquor and chitosan-nano-selenium solution, wherein the ratio of 1: mixing at a volume ratio of 60-80, vortex oscillating, and incubating at 50-60deg.C for 1-2 hr to allow them to combine completely to form nucleic acid complex; centrifuging to obtain supernatant, placing in a quartz cuvette, measuring fluorescence intensity (excitation wavelength 485nm, emission wavelength 524 nm) with a fluorescence spectrophotometer, and calculating encapsulation efficiency;

encapsulation efficiency (%) = (a) _{Before centrifugation} -A _{After centrifugation} ）/A _{Before centrifugation} ×100%。

In another specific embodiment, the operation of step 4) is to pass the platelet membrane vesicles obtained in step 3) through a liposome extruder of a filter membrane of 800nm, 400nm and 200nm for 8-13 times in sequence, and physically extrude the liposome extruder to obtain platelet membranes with uniform particle size.

In another specific embodiment, the operation of the step 5) is to mix the platelet membrane obtained in the step 4) with the nano-selenium solution obtained in the step 2) according to the volume ratio of 1-2:4-6, incubate for 10-15min at 37 ℃, ultrasonically process for 10-15min at 80-120Hz and 20-30 ℃ for 8-13 times by a liposome extruder with a 200nm filter membrane, and centrifuge for 10-50min at 8000-8500rpm after coextrusion to remove superfluous vesicles, thus obtaining the encapsulated bionic nano-selenium particles.

The third aspect of the invention provides the bionic nano-selenium particles of the first aspect or the bionic nano-selenium particles prepared by the method of the second aspect, and the application of the bionic nano-selenium particles in preparation of preparations for improving the oxidation resistance of cells; preferably, the antioxidant capacity includes, but is not limited to, anti-superoxide anion activity, inhibition of hydroxyl radical capacity, increased superoxide dismutase activity, increased glutathione peroxidase activity.

In a fourth aspect, the present invention provides use of the biomimetic nano-selenium particles according to the first aspect or the biomimetic nano-selenium particles prepared by the method according to the second aspect in the preparation of a formulation for reducing lipid accumulation in a subject, preferably a non-alcoholic fatty liver disease patient; more preferably, the in vivo fat accumulation is liver lipid accumulation.

In a fifth aspect, the present invention provides an application of the bionic nano-selenium particles according to the first aspect or the bionic nano-selenium particles prepared by the method according to the second aspect in preparation of a preparation for improving expression of LDL receptor, preferably, the LDL receptor is an LDL receptor of liver cells.

Compared with the prior art, the invention has the following beneficial effects:

1. The invention constructs miRNA bionic nano-selenium Particles (PSM) coated by platelet membranes, firstly, chitosan is modified on the surface of nano-selenium through Se-O bonds to stabilize the structure of nano-selenium, and at the moment, amino groups on the chitosan are protonated to endow the whole system with positive potential; finally, the platelet membrane is coated on the outer layer. The compound system can realize targeted delivery of miRNA to the liver through intravenous injection of the tail of a mouse, and can reduce the blood lipid level through enhancing LDLR expression in the liver, and selenium element is released to synthesize selenoprotein to regulate intracellular redox balance. According to the technical scheme, the treatment effect equivalent to that of a commercial liposome group can be realized by less miR-148a-3p inhibitor, and the problem of high miR-148a-3p inhibitor cost is solved.

Finally, the curative effect of targeted synergistic treatment of the non-alcoholic fatty liver is realized.

Drawings

Fig. 1 shows macroscopic and microscopic morphology of nano-selenium: (a) Nano selenium macroscopic morphology, (b) transmission electron microscope, scale: 500nm, (c) transmission electron microscope, scale bar: 200nm.

Fig. 2 is a fourier transform infrared spectrometer result.

Fig. 3 is an X-ray photoelectron spectrum.

Fig. 4 is an encapsulation efficiency of nano-selenium.

Fig. 5 is a physical characterization of platelet membrane coated miRNA biomimetic nano-selenium particles: (a) A macroscopic morphology of the platelet membrane coated with nano-selenium, (b) a transmission electron microscope, a scale bar: 1.0 μm; (c) transmission electron microscope, scale bar: 200nm; (d) transmission electron microscope, scale bar: 200nm. .

Fig. 6 is a hepatocyte targeting effect of platelet membrane coated miRNA biomimetic nano-selenium particles: (a) laser confocal viewing; (b) quantitative analysis of fluorescence intensity results by flow cytometry.

Fig. 7 is a graph showing macrophage escape effect of platelet membrane coated miRNA biomimetic nano-selenium particles.

Fig. 8 is the lysosome escape capacity of platelet membrane coated miRNA biomimetic nano-selenium particles.

Fig. 9 is a graph showing the effects of platelet membrane coating miRNA biomimetic nano-selenium particles on reducing hepatocyte lipid deposition: (a) lipid staining; (b) The content of intracellular triglycerides is determined by the method,

shows significant difference compared with sodium oleate groupP< 0.05); (c) The oil red O is quantified,

shows significant difference compared with sodium oleate groupP＜0.05）。

Figure 10 is the effect of platelet membrane coated miRNA biomimetic nano-selenium particles on expression of lipid metabolism genes,

Shows significant difference compared with sodium oleate groupP＜0.05）。

Fig. 11 is the effect of platelet membrane coated miRNA biomimetic nano-selenium particles on LDLR expression.

FIG. 12 is a graph showing the correlation of platelet membrane coated miRNA biomimetic nano-selenium particles against oxidationInfluence of index: (a) anti-superoxide anion activity; (b) hydroxyl radical inhibition capability; (c) superoxide dismutase enzyme activity; (d) glutathione peroxidase enzyme activity.

Shows significant difference compared with sodium oleate groupP< 0.05); n.d. indicates below the detection line.

Fig. 13 is a schematic of the establishment and treatment of a non-alcoholic fatty liver animal model.

Fig. 14 shows changes in animal body fat: (a) a mouse stature morphology; (b) weight change; (c) nmr body fat imaging, yellow arrow: white fat; (d) The body fat percentage of the human body,

indicating significant differences compared with the high-fat groupP＜0.05）。

FIG. 15 shows the body surface temperature of animals.

FIG. 16 is a mouse liver oil red O staining.

Fig. 17 is a mouse liver LDLR immunohistochemistry, scale bar: 50 μm.

Fig. 18 is mouse liver LDLR immunofluorescence, scale bar: 50 μm.

Fig. 19 is an in vivo safety evaluation: (a) main organs of mice were HE stained, scale bar: 50 μm, 20 μm; (b) optical image of major organs of mice; (c) The organ indexes of mice are marked with different marked letters to show obvious difference P＜0.05）。

Detailed Description

The objects and functions of the present invention and methods for achieving these objects and functions will be elucidated with reference to the exemplary embodiments. However, the present invention is not limited to the exemplary embodiments disclosed below; this may be implemented in different forms. The essence of the description is merely to aid one skilled in the relevant art in comprehensively understanding the specific details of the invention.

Example 1 preparation of nano selenium biomimetic particles

1. Preparation of chitosan-nano selenium

Vitamins are adoptedIn situ reduction of Na by plain C (VC) ₂ SeO ₃ The method for preparing the nano selenium particles comprises the following specific steps: 0.3g chitosan (95% deacetylation degree, 100 mpa.s) was dissolved in 30mL glacial acetic acid (1%), and magnetically stirred at 600r/min in the dark for 12h; slowly dripping 30mL of 20mmol/L sodium selenite solution, and magnetically stirring for 30min at 600 r/min; slowly dripping 80mmol/L Vc solution 30mL, magnetically stirring for 30min at 600r/min, transferring into a reagent bottle, and storing in a refrigerator at 4 ℃. The macroscopic morphology and morphology under an electron microscope of the chitosan-nanoselenium particles obtained in the above steps are shown in fig. 1.

2. Fourier transform infrared spectroscopy

Grinding and mixing the nano selenium freeze-dried sample with KBr (the proportion is about 1:50), tabletting, baking for several minutes under an infrared lamp, and sampling to collect KBr background; wavenumber range: 800-4000 cm-1, resolution: 4 cm-1, number of scans: 32. as shown in FIG. 2, the Fourier transform infrared spectrometer result shows that the-OH bending vibration and the C-O stretching vibration on the chitosan molecular chain exist in the wave number range of 1050-1500, and the successful incorporation of chitosan in the system is proved; bending vibration absorption of-NH exists in the wave number range of 1500-1700, which proves that chitosan NH3 ⁺ Protonation, which plays a role in stabilizing nano selenium, and the whole system is positively charged; the existence of hydroxyl absorption peak in the wave number range of 3000-3650 proves that the hydrogen bond combination exists between the molecules of the system.

3. X-ray photoelectron spectroscopy

And (3) placing the chitosan-nano selenium solution in a temperature of minus 80 ℃ for prefreezing for 12 hours, and performing vacuum freeze drying for 48 hours in a dark place. 0.1g of freeze-dried sample is fixed on a sample table by using conductive adhesive, sample introduction and vacuum pumping are carried out for testing, and the binding energy is corrected by using C1s=284.8 eV as a reference. The main parameters are as follows: 500 μm beam spot, power 150W, monochromatic alca (where hv= 1486.6 eV). As shown in fig. 3, the elemental valence composition of nano-selenium was investigated using X-ray photoelectron spectroscopy. Characteristic peaks exist on the nitrogen element and carbon element orbitals, and both elements are derived from chitosan, so that the successful doping of the chitosan is proved. As can be seen from fig. 3d, the characteristic peak of the zero-valent selenium at 55.3 and eV shows that the valence of Se in the system is converted from +4 to 0, which proves that the nano-selenium is successfully prepared and no other impurities exist.

4. miRNA load experiment

Taking 10 mu M FAM standard miR-148a-3p inhibitor (with a sequence of ACAAAGUUCUGUAGUGCACUGA (SEQ ID NO: 1)), wherein the inhibitor sequence is subjected to methylation modification to form mAmCmAmAmAmAmAmGmUmUmCmUmMmUmMmGmMmMmAmAmCmMmmA (SEQ ID NO: 2)) mother liquor and a chitosan-nano selenium solution, and mixing the chitosan-nano selenium solution with a ratio of 1:70, vortexing for 30s, and incubating at 55deg.C for 1h to allow sufficient binding to form nucleic acid complexes.

After centrifugation at 12000r/min for 15min, 70 μl of the supernatant was placed in a quartz cuvette, and fluorescence intensity (excitation wavelength 485nm, emission wavelength 524 nm) was measured by a fluorescence spectrophotometer and the encapsulation efficiency was calculated.

As shown in fig. 4, according to the calculation of the fluorescence spectrophotometer, the chitosan-nano selenium has good adsorption property, and the encapsulation rate is 73.8%.

5. Preparation and purification of platelet membranes

Whole blood is collected from C57bl/6J mice by an eyeball blood taking method and is added into an anticoagulation tube containing heparin sodium, 10% of citric acid glucose solution is added into the anticoagulation tube, 800g of the anticoagulation tube is centrifuged for 15min after uniform mixing, an upper blood platelet-rich plasma layer is collected, and 3000g of the anticoagulation tube is further centrifuged for 15min, so that platelet precipitation is obtained. The pellet was resuspended in 10 volumes of red blood cell lysate and lysed on ice for 10min. Again centrifuged at 800g for 15min to obtain platelet pellet, resuspended in PBS containing protease inhibitor, repeatedly freeze-thawing for 3 times to obtain platelet membrane fragments, and sonicating (100 Hz,25 ℃) for 10min to obtain platelet membrane vesicles for subsequent experiments.

6. Preparation of miRNA bionic nano-selenium particles coated by platelet membrane

Platelet membrane vesicles sequentially pass through a liposome extruder of 800nm, 400nm and 200nm filter membranes for 11 times, and are physically extruded to uniform particle size, and then are mixed with nano selenium solution according to a ratio of 1:5, incubating for 10min at 37 ℃, performing ultrasonic treatment (100 Hz,25 ℃) for 10min, passing through a liposome extruder with a 200nm filter membrane for 11 times, centrifuging at 8500rpm/min after coextrusion for 15 min to remove superfluous vesicles, and placing in a refrigerator at 4 ℃ for subsequent experiments.

7. Observation by transmission electron microscope

And 5 mu L of sample liquid to be detected is dripped on a carbon support film copper net, and is dried overnight and then placed in a drying dish until the detection voltage is 30 kV in the subsequent experiment. As shown in fig. 5, the platelet membrane coated miRNA bionic nano-selenium particle solution is clear and transparent. Transmission electron microscopy shows that the system has a typical shell-core structure, a layer of cell membrane is coated on the outer layer, the cell membrane is about 10nm, and the polymer dispersity is good.

8. Determination of polydispersity and zeta potential

The polydispersity and zeta potential were measured using a Delsa-Nano particle analyzer at room temperature of 23.+ -. 2 ℃ and a scattering angle of 15 ℃ and the refractive index of the medium (water) was 1.333.

9. Measurement of particle size

The particle size is measured by using a Fu-flow nanoflow instrument NanoFCM, a laser with the wavelength of 532nm is selected, and a detection channel is a scattering channel.

Example 2 evaluation of biomimetic nanoselenium particle targeting hepatocytes

1. Hepatocyte targeting assay

And loading nano-selenium by using a 100 mM coumarin-6 fluorescent probe, and dialyzing away from light for 48 hours to remove redundant dye, so as to prepare the green fluorescence-marked platelet membrane-miR 148a-3 p-nano-selenium particles (C6-PSM) and the green fluorescence-marked miRNA-nano-selenium particles (C6-SM).

Mouse liver parenchymal cells AML-12 are planted in a confocal small dish, and after the cells are attached to the wall, 1 mu M of C6-PSM and C6-SM are added for further culture for 2 hours. The PBS was washed 3 times for 5min each to remove material that was not endocytosed by the cells. After cells were fixed with 4% paraformaldehyde for 15min, PBS was washed 3 times for 5min each to remove excess fixative. DAPI dye solution is added to cover cells for 10min, PBS is used for washing 3 times, each time lasts for 5min, and redundant dye solution is removed. The sample was observed under a laser confocal microscope with a C6 maximum excitation/emission wavelength of: 320/455, nm; the DAPI maximum excitation/emission wavelength is: 340/488 nm (fig. 6 a).

2. Quantitative analysis of hepatocyte targeting

AML-12 was plated in 6-well plates, and after cell density reached about 80% and adhesion, 1. Mu.M of C6-PSM and C6-SM were added thereto for further culturing for 2 hours. The PBS was washed 3 times for 5min each to remove material that was not endocytosed by the cells. After cells were fixed with 4% paraformaldehyde for 15min, PBS was washed 3 times for 5min each to remove excess fixative. Cells were trypsinized, centrifuged at 1000g for 5min, washed twice with PBS and resuspended in 1mL of PBS. After being blown to a single cell suspension state for many times, the mixture is passed through a cell mesh screen of 40 mu m and placed in a flow tube for light shielding at 4 ℃ for standby. C6 positive cells were analyzed and detected by flow cytometry at a channel of excitation light 320nm (fig. 6 b).

As shown in fig. 6, the liver cells AML-12 endocytose the platelet membrane coated miRNA bionic nano-selenium particles more at 2h, indicating that the platelet membrane coated miRNA bionic nano-selenium particles can be taken up by liver cells more rapidly. This is achieved by the nature of platelets homing to the liver, being endocytosed by hepatocytes in a gpibα glycoprotein dependent manner.

Example 3 bionic nanoselenium particle immune escape assessment

1. Macrophages RAW264.7 are planted in a 6-well plate, and after the cell density reaches about 80% and the cells are attached, 1 mu M of C6-PSM and C6-SM are added for continuous culture for 30min. The PBS was washed 3 times for 5min each to remove material that was not endocytosed by the cells. After cells were fixed with 4% paraformaldehyde for 15min, PBS was washed 3 times for 5min each to remove excess fixative. DAPI dye solution is added to cover cells for 10min, PBS is used for washing 3 times, each time lasts for 5min, and redundant dye solution is removed. The sample was observed under a laser confocal microscope with a C6 maximum excitation/emission wavelength of: 320/455, nm; the DAPI maximum excitation/emission wavelength is: 340/488 nm.

Exogenous drug-loaded nanoparticles enter the body and are easily recognized by macrophages, so that the activated natural immune system is cleared away, and the exogenous drug-loaded nanoparticles are difficult to function in the body. Because platelets can avoid the activation of the immune system through membrane surface CD47 mediated macrophage escape and CD55/59 mediated complement activation, as shown in figure 7, the miRNA bionic nano-selenium particles coated by the platelet membrane can be less endocytosed by the macrophages RAW264.7, and have the macrophage escape capability.

2. Lysosomal escape assay

AML-12 is planted in a confocal small dish, after cells are attached, 1 mu M of C6-PSM and C6-SM are added for continuous culture for 1h and 9h. The PBS was washed 3 times for 5min each to remove material that was not endocytosed by the cells. DAPI dye solution is added to cover cells for 10min, PBS is used for washing 3 times, each time lasts for 5min, and redundant dye solution is removed. After adding the Dil lysosome staining working solution preheated at 37 ℃, the culture was continued for 30min in the incubator. Washing with DMEM basal medium at 37deg.C for 3 times each for 5min, and removing excessive dye solution. The sample was observed under a laser confocal microscope with a C6 maximum excitation/emission wavelength of: 320/455, nm; the DAPI maximum excitation/emission wavelength is: 340/488 nm; the Dil maximum excitation/emission wavelength is: 549/565 nm.

The drug-loaded nano-particles are easy to be phagocytized by lysosomes after entering cytoplasm, so that the drug-loaded nano-particles cannot be effectively released, and therefore, the laser confocal fluorescence co-localization is adopted to examine the lysosome escape capability of the nano-particles. As shown in fig. 8, the red fluorescent-labeled lysosome and the green fluorescent-labeled nanomaterial are fluorescent-coincident to each other at 1h to appear yellow, indicating that the nanomaterial enters the lysosome at this time; at 9h, the fluorescence of the two channels is crossed, which shows that the nano material escapes from the lysosome to enter cytoplasm and is not phagocytized by the lysosome, thus further playing a biological function.

Example 4 in vitro action of biomimetic nanoselenium particles and Signal pathway analysis

1. Assay for reducing hepatocyte lipid deposition

AML-12 was seeded in 24-well plates and after cell density was about 80% and adherence, it was divided into 6 experimental groups of at least three replicate wells each. Blank group: DMEM complete medium; sodium oleate group: DMEM complete medium containing 0.5mM sodium oleate; bare miR-148a-3p inhibitor group: DMEM complete medium containing 50nM miR-148a-3p inhibitor; lipo-miR-148a-3p inhibitor group: commercial liposome lipo3000 transfected with 50nM miR-148a-3p inhibitor; platelet membrane-nanoselenium group: DMEM complete medium containing 1 μm platelet membrane-nanoselenium; platelet membrane-nanoselenium-miR-148 a-3p inhibitor group: DMEM complete medium containing 1 μm platelet membrane-nanoselenium.

Pretreatment of cells with 0.5mM sodium oleate after 12h establishment of a model of high lipid hepatocytes, PBS was washed three times. Adding sodium oleate group, naked miR-148a-3p inhibitor group, lipo-miR-148a-3p inhibitor group, platelet membrane-nano selenium group and platelet membrane-nano selenium-miR-148 a-3p inhibitor group samples, continuously incubating for 12 hours, washing with PBS for three times, removing redundant materials, and respectively carrying out nile red staining, oil red O quantitative analysis and intracellular triglyceride detection.

Nile red staining: cells were fixed with 4% paraformaldehyde for 10min, washed three times with PBS for 5min each, and excess fixative was removed. Adding nile red staining working solution, continuously incubating for 5min in an incubator, washing with PBS for three times, and removing redundant staining solution every 5min. DAPI dye solution is added to cover cells for 10min, PBS is used for washing 3 times, each time lasts for 5min, and redundant dye solution is removed. Cell staining was observed under a fluorescence microscope, where DAPI maximum excitation/emission wavelength was: 340/488 nm; the nile red maximum excitation/emission wavelength is: 530nm/635nm.

Oil red O staining: cells were fixed with 4% paraformaldehyde for 30min and washed three times with PBS. After 1h incubation with oil red O staining working solution, the staining solution was aspirated and washed three times with PBS for 5min each. And photographing under a microscope to observe the staining condition of the cells.

Oil red O quantification: after photographing, 1mL of isopropanol is added into the well plate to extract intracellular lipid, after incubation for 5min at room temperature, 100 mu L of liquid is sucked into the 96 well plate, and the absorbance is measured at 510 nm. Negative control: 100% isopropyl alcohol.

Determination of intracellular triglycerides: AML-12 was seeded in 6-well plates and after cell density was about 80% and adherence, it was divided into the above 6 experimental groups of at least three multiplex wells each. Pretreatment of cells with 0.5mM sodium oleate after 12h establishment of a model of high lipid hepatocytes, PBS was washed three times. Sodium oleate, naked miR-148a-3p inhibitor, lipo-miR-148a-3p inhibitor, platelet membrane-nano selenium and platelet membrane-nano selenium-miR-148 a-3p inhibitor are added, and after incubation for 12 hours, PBS is used for three times to remove redundant materials. 200 mu L of cell lysate containing protease inhibitor is added into each well, the mixture is treated on ice for 5min, and after blowing and sucking, the supernatant is obtained by centrifugation at 12000rpm for 5min. After BCA assay intracellular protein concentration, the assay was performed according to triglyceride kit instructions.

As shown in fig. 9a, the effect of platelet membrane-coated miRNA bionic nano-selenium particles on hepatocyte lipid deposition was determined using nile red fluorescent labeling of intracellular lipids and oil red O-stained lipids. Wherein, the naked miR-148a-3p inhibitor group is degraded soon after being incubated with a cell culture medium containing serum due to no modification, and cannot exert biological functions; and the platelet membrane-nano selenium-miR-148 a-3p inhibitor group has the dual functions of resisting oxidation of nano selenium and protecting miRNA from degradation, so that lipid deposition of liver cells induced by sodium oleate can be remarkably relieved. As shown in fig. 9b and c, further measurement of intracellular triglyceride content proves that platelet membrane coated miRNA bionic nano-selenium particles can significantly reduce hepatocyte lipid deposition.

2. Determination of expression of lipid metabolism-related Gene in liver cells

Total RNA extraction: to each well of the 6-well plate, 500. Mu.L of Trizol was added, and the mixture was subjected to ice lysis and air-aspiration mixing. The liquid was transferred to a new rnase free 1.5mL centrifuge tube. 100. Mu.L of precooled chloroform was added, mixed well by vortexing for 15s, left to stand on ice for 5min, and centrifuged at 12000rpm for 10min at 4 ℃. The sample was divided into upper, middle and lower 3 layers and the upper aqueous phase was carefully removed into a new 1.5mL centrifuge tube. Adding the pre-cooled isopropanol with equal volume, mixing the mixture upside down, standing for 10min, and centrifuging at 12000rpm for 10min at 4 ℃. The supernatant was discarded to obtain RNA pellet. 500. Mu.L of pre-chilled 75% ethanol (DEPC water) was added, the pellet was flicked off the walls of the flick tube, centrifuged at 12000rpm for 10min at 4℃and the supernatant was discarded. The cover is opened and air-dried in an ultra clean bench, 50 mu L of DEPC water is added into each pipe to fully dissolve RNA, the RNA is blown and sucked for a plurality of times by a pipetting gun and uniformly mixed, and the concentration and purity of the RNA are measured by a Nanodrop nucleic acid tester.

Reverse transcription: using the extracted total RNA as a template, cDNA was synthesized using abm reverse transcription kit: the 20. Mu.L reaction system contained 4. Mu.L of 5 Xall-In-One RT Master mix, 500ng of total RNA, and the total volume of nucleic-free water was made up to 20. Mu.L. Setting a PCR program: lid,105 ℃, 25 ℃ for 10min;42 ℃ for 50min;85 ℃ for 5min; cooling at 4 ℃; the cDNA samples were stored at-20 ℃.

QPCR fluorescent quantitation: RT-qPCR Using Takara fluorescent dye kit, 20. Mu.L of the reaction system contained 0.5. Mu.L of each of the upstream/downstream primers (10. Mu.M); cDNA template, 1. Mu.L; TB Green ™ Premix Ex Taq ™, 10. Mu.L; DEPC water, 8. Mu.L.

Reaction conditions: 95 ℃ for 30s; amplification: denaturation, 95 ℃,20s; annealing at 60 ℃ for 10s; extending at 72 ℃ for 10s; melting curve: 95 ℃ for 10s;65 ℃ and 60s;97℃for 1s. The primer sequences are shown in Table 1.

TABLE 1 QPCR primer sequences

As shown in fig. 10, the influence of platelet membrane coated miRNA biomimetic nano-selenium particles on lipid metabolism related genes after sodium oleate-induced hepatocyte lipid deposition was measured. Wherein, the fas, scd-1 and srebp1c gene expression is obviously reduced compared with sodium oleate group; foxo1, ldlr, pprγ gene expression was significantly elevated compared to the sodium oleate group. The miRNA bionic nano-selenium particles coated by the platelet membrane reduce the expression level of the genes related to lipid synthesis after treatment, and improve the expression level of the genes related to lipid decomposition, thereby relieving the lipid deposition of liver cells.

3. Determination of expression of lipid metabolism-related proteins in hepatocytes

Protein extraction and quantification: 200 mu L of cell lysate containing protease inhibitor is added into each well, the mixture is treated on ice for 5min, and after blowing and sucking, the supernatant is obtained by centrifugation at 12000rpm for 5 min. After the BCA determines intracellular protein concentration, the concentration was adjusted using a protein loading buffer.

Preparing a protein electrophoresis gel: preparation of a separation gel (pH 8.8): adding solution A, solution B and ultrapure water (volume is shown in table 2) into a clean beaker, mixing uniformly, adding ammonium persulfate, mixing uniformly, adding TEMED, and mixing uniformly (about 5 mL/block); immediately pouring the glue to a height of about 6mL at the center of the glue plate by using a 1mL liquid-transferring gun, enabling the glue to flow down along the glass plate without generating bubbles, and reserving a height of 1.5cm above the glue; lightly adding about 500 mu L of ultrapure water from one side, standing at room temperature for about 40min to wait for gel; after the gel (a line of refraction between the water and the gel can be seen), the aqueous layer was decanted and wiped clean with filter paper. Finally, wiping the adhesive surface again by using 4 layers of filter paper without touching the adhesive surface; preparation of concentrated gel (pH 6.8): adding solution A, solution C and ultrapure water (volume is shown in Table 2) into a clean beaker, uniformly mixing, adding ammonium persulfate, uniformly mixing, adding TEMED, and fully mixing; and (5) immediately pouring glue until the short board just overflows. The comb was inserted and left standing at room temperature for about 30min to wait for gel.

Table 2 formulation of protein electrophoresis gel

Protein loading: adding 5 Xloading buffer solution (4:1) into the sample, mixing, and boiling in boiling water for 5min to denature protein; putting the SDS-PAGE protein gel prepared in advance into an electrophoresis tank, and adding 1X electrophoresis solution; pulling out the comb, sucking a sample or a protein pre-dyeing (6 mu L) Marker sample application; and (3) carrying out constant-pressure electrophoresis for 25min at 80V, adjusting the voltage to 120V when bromophenol blue reaches the boundary between the separating gel and the concentrated gel, taking bromophenol blue and a pre-dyeing Marker as references, and carrying out running for 1-2h according to the molecular weight of the protein which needs to be imprinted, thus ending the electrophoresis.

Transferring: preparing membrane transferring liquid, shearing PVDF membrane with required size, soaking in methanol for about 15s, and soaking the membrane transferring filter paper in the membrane transferring liquid. Cutting the glue containing the target strip by taking the pre-dyeing Marker as a reference, and placing the glue into the transfer film liquid. And sequentially placing the membrane clamp, the sponge, the filter paper, the membrane and the glue according to the correct sequence to prevent bubbles. After the assembly, the film transferring interlayer is placed into a film transferring groove, a proper amount of film transferring liquid is added, and the film is transferred for 1h at a constant flow of 300mA under the low temperature condition.

Closing: after the membrane is transferred, the membrane is completely immersed in 5% of skim milk solution, and the membrane is placed on a shaking table to shake at low speed for incubation for 2 hours.

Incubation resistance: the primary antibody with proper concentration is diluted by primary antibody diluent in proportion, the sealed membrane is washed off by pure water to remove residual skim milk, and then is placed in the primary antibody for incubation at 4 ℃ overnight. After incubation of the primary antibody, the primary antibody was placed on a shaker and washed 5 times with PBST at room temperature for 5min each.

Secondary antibody incubation: the corresponding secondary antibodies were diluted in proportion with 5% skim milk, the membranes were placed in the secondary antibodies for incubation, and the shaker was incubated at low speed for 1h at room temperature. After the secondary antibody incubation, the secondary antibody was placed on a shaker and washed 5 times with PBST at room temperature for 5 min each time.

Developing: ECL developing solution (equal volume mixing of developing solution A and B) is prepared, a film is placed on a developing plate, the mixed developing solution is dripped (uniformly spread to each position to avoid film drying), and the film is placed on a gel imager for development and analysis.

As shown in FIG. 11, the protein expression level of the miR-148a-3p target gene LDLR was measured. In the case of high lipids, hepatocyte surface LDLR expression is significantly down-regulated, reducing LDL-C uptake in the blood, leading to hepatocyte lipid deposition and accumulation of triglycerides in the blood. The measurement result shows that the platelet membrane coated miRNA bionic nano-selenium particles improve the expression of the hepatic cell LDLR protein, and prove that the nano-particles can successfully deliver miR-148a-3p inhibitor into hepatic cells and improve lipid metabolism.

Example 5 determination of bionic nano-selenium particles ability to reduce oxidative damage to hepatocytes

AML-12 was seeded in 24-well plates and after cell density was about 80% and adherence, it was divided into the above 6 experimental groups of at least three multiplex wells each. Pretreatment of cells with 0.5mM sodium oleate after 12h establishment of a model of high lipid hepatocytes, PBS was washed three times. Sodium oleate, naked miR-148a-3p inhibitor, lipo-miR-148a-3p inhibitor, platelet membrane-nano selenium and platelet membrane-nano selenium-miR-148 a-3p inhibitor are added, incubation is continued for 12 hours, PBS is used for washing three times, redundant materials are removed, and ROS staining and intracellular antioxidant enzyme level measurement are respectively carried out.

ROS staining: adding DCFH-DA-ROS fluorescent probe working solution, incubating for 20min in an incubator, washing with PBS three times, and then observing cell fluorescence under a fluorescence microscope, wherein the maximum excitation/emission wavelength of the DCFH-DA is as follows: 488/525nm.

Determination of intracellular antioxidant enzyme levels: AML-12 was seeded in 6-well plates and after cell density was about 80% and adherence, it was divided into the above 6 experimental groups of at least three multiplex wells each. Pretreatment of cells with 0.5mM sodium oleate after 12h establishment of a model of high lipid hepatocytes, PBS was washed three times. Sodium oleate, naked miR-148a-3p inhibitor, lipo-miR-148a-3p inhibitor, platelet membrane-nano selenium and platelet membrane-nano selenium-miR-148 a-3p inhibitor are added, and after incubation for 12 hours, PBS is used for three times to remove redundant materials.

200 mu L of cell lysate containing protease inhibitor is added into each well, the mixture is treated on ice for 5min, and after blowing and sucking, the supernatant is obtained by centrifugation at 12000rpm for 5 min. After BCA was assayed for intracellular protein concentration, it was assayed using a superoxide anion (O2. Cndot. -), hydroxyl radical (. OH), glutathione peroxidase (Glutathione peroxidase, GSH-Px), and superoxide dismutase (Superoxide dismutase, SOD) kit.

As shown in fig. 12, an index of antioxidant correlation in hepatocytes was measured. The platelet membrane coated miRNA bionic nano selenium particles obviously enhance the activity of intracellular superoxide anions and inhibit the ability of hydroxyl radicals, so that the composite material has stronger ability of scavenging the free radicals. In addition, the composite material obviously enhances the enzyme activity of intracellular superoxide dismutase and glutathione peroxidase, and the capability can be derived from the antioxidant capability of the carrier nano selenium.

Example 6 in vivo lipid-lowering experiments with biomimetic nanoparticles

1. Experimental animals: after animal experiments are approved by the animal welfare and animal experiment ethical examination committee of the Chinese agricultural university, 48C 57BL/6J male mice (Beijing Vitre Lihua laboratory animal technology Co., ltd.) of 6-8 weeks old are purchased, and are sent to animal houses without specific pathogens and SPF (Specific Pathogen Free, SPF) in the Western school area of the Chinese agricultural university after being subjected to professional cleaning-grade packaging treatment, the relative humidity of the raising environment is 55+/-10%, the raising environment temperature is 22+/-2 ℃, and the lighting conditions are strictly followed by alternate illumination for 12 hours at night and day.

2. Grouping animals: animals were randomly divided into 6 groups of 8 animals each, fed and drunk freely, and were kept for one week for environmental adaptation. After the adaptation period is over, group feeding and drug treatment are carried out for 16 weeks. The food intake and body weight of the mice were measured weekly. Low-fat group: feeding low-fat feed with 10% of calories for 16 weeks; high-fat group: feeding 60% of high-fat feed for 16 weeks; negative control group: feeding 60% caloric high-fat feed for 16 weeks, i.v. from the twelfth week, each mouse tail was given an antagomir miR-148a-3p negative control of 50nM, once every three days for 4 weeks; antagomir group: feeding 60% caloric high-fat feed for 16 weeks, and intravenous injection of 50nM antagomir miR-148a-3p into each mouse tail from the twelfth week, once every three days, for 4 weeks; platelet membrane-nanoselenium group: feeding 60% caloric high-fat feed for 16 weeks, and injecting platelet membrane-nano selenium with selenium content of 0.03mg/kg into tail vein from twelfth week, once every three days for 4 weeks; platelet membrane-nanoselenium-miR-148 a-3p inhibitor group: platelet membrane-nano-selenium-miR-148 a-3p inhibitor with selenium content of 0.03mg/kg was injected into tail vein from twelfth week for 16 weeks after feeding 60% caloric high-fat feed, once every three days for 4 weeks (experimental procedure is shown in FIG. 13).

3. Determination of animal body fat content

The mice are put into a component analyzer of awake animals under the awake state, and body fat is measured by utilizing the nuclear magnetic resonance principle. After the measurement, the anesthetic was injected intraperitoneally (Avertin, 400 mg/kg BW dose), and after the anesthesia, the mice were spread horizontally in the instrument for imaging measurement. As shown in fig. 14, at the end of the treatment at week 16, the body weight and body fat of each group of mice had significant changes. Compared with a high-fat group, the platelet membrane-nano selenium-miR-148 a-3p inhibitor group has obviously reduced weight, and has no obvious difference with a positive drug antagomir group, so that the composite nano material can obviously reduce the weight increase of a non-alcoholic fatty liver mouse. In addition, imaging and quantitative detection are carried out on the body fat rate of each group of mice, and the result shows that the platelet membrane-nano selenium-miR-148 a-3p inhibitor group can obviously reduce the fat content of the mice, and has no influence on the lean meat content.

4. Thermal imaging of animal body surface temperature

The body surface temperature of the mice after cold stimulation is measured by a thermal imager. The mice were first stimulated for 1h at 4℃and immediately removed for thermal imaging measurements.

Since the body temperature of the warm-blooded animal is not changed by the external environment temperature and remains relatively stable all the time, when the warm-blooded animal is stimulated by cold, the metabolism of the warm-blooded animal needs to be improved in various ways to maintain the constant body temperature. As shown in fig. 15, after each group of mice was subjected to cold stimulation at 4 ℃ for 1 hour, the body surface temperature of the mice was measured by a thermal infrared imager. Wherein, the body surface temperature of the abdomen of the high-fat mice is lower, which indicates that the abdomen of the mice is more white fat, and the adaptive heat production level is blocked. And the platelet membrane-nano selenium-miR-148 a-3p inhibitor group has higher surface temperature, so that the normal metabolism level is further recovered.

5. Collection of tissue samples

The experimental mice were sacrificed after blood collection and cervical dislocation, body length was measured, and body weight was measured. After dissection, the whole heart, liver, kidney, testis, spleen and lung were taken, each tissue was weighed and fixed in 10 volumes of 4% paraformaldehyde fixing solution.

6. Liver oil red O staining

Re-heating and drying frozen slices, fixing in fixing solution for 15min, washing with tap water, and air drying. The slices are immersed in oil red dye liquor for 8-10min (covered and protected from light). The slices were taken out and left to stand for 3s, and then immersed in two cylinders of 60% isopropanol in sequence for differentiation for 3s and 5s respectively. The slices were immersed in 2 cylinders of pure water sequentially for 10s each. Taking out the slices, standing for 3s, immersing in hematoxylin for counterstaining for 3-5min, immersing in 3-cylinder pure water, and immersing for 5s, 10s and 30s respectively. Differentiation liquid (60% alcohol is used as solvent) is differentiated for 2-8s, distilled water in 2 cylinders is used for washing for 10s respectively, blue returning liquid is used for returning blue for 1s, the slices are lightly immersed in tap water in 2 cylinders for immersion washing, and the dyeing effect is inspected for 5s and 10s respectively. The glycerogelatin tablet sealing tablet is sealed. Microscopic examination, image acquisition and analysis. The lipid drop is orange to bright red, and the nucleus is blue.

As shown in fig. 16, the liver of the mice was stained with oil red O, and the liver lipid deposition level of each group of mice was measured. Wherein, the red areas of the high-fat group and the negative control group are larger, the oil red dyeing area of the platelet membrane-nano selenium-miR-148 a-3p inhibitor group is smaller, and the overall color is lighter. It was shown that the high-fat mice had developed severe fatty liver, while the other treatment groups could have significant liver fat deposition.

7. Immunohistochemistry

Sequentially placing paraffin sections into dewaxing liquid I for 15min, dewaxing liquid II for 15min, dewaxing liquid III for 15min, absolute ethyl alcohol I for 5min, absolute ethyl alcohol II for 5min,85% alcohol for 5min,75% alcohol for 5min, and washing with distilled water.

Antigen retrieval: the tissue slice is placed in a repair box filled with EDTA antigen repair buffer solution (pH9.0) for antigen repair in a microwave oven, medium fire is kept for 8min to boiling, the fire is stopped for 8min, the heat is preserved, then medium fire and low fire are changed for 7min, and excessive evaporation of the buffer solution is prevented in the process, and the slice is not dried. After natural cooling, the slide was washed with PBS (pH 7.4) with shaking on a decolorizing shaker for 3 times, 5min each.

Blocking endogenous peroxidases: the sections were incubated in 3% hydrogen peroxide solution at room temperature for 25min in the absence of light, and the slides were washed 3 times with shaking in PBS (pH 7.4) on a decolorizing shaker for 5min each.

Serum blocking, namely 3% BSA is dripped into the organized ring to uniformly cover the tissue, and the room temperature is blocked for 30min. (primary antibody was goat-derived blocked with rabbit serum and other sources blocked with BSA)

Adding an antibody: the blocking solution is gently thrown away, PBS is dripped on the slice, the slice is horizontally placed in a wet box for incubation at 4 ℃ for overnight. (A small amount of water was added to the wet box to prevent evaporation of antibody)

Adding a secondary antibody: the slide was washed with shaking 3 times, 5min each time, in PBS (pH 7.4) on a decolorizing shaker. And (3) dripping secondary antibodies (HRP marks) of corresponding species with the primary antibodies into the circles to cover tissues after the sections are slightly dried, and incubating for 50 minutes at room temperature.

DAB color development: the slide was washed with shaking 3 times, 5min each time, in PBS (pH 7.4) on a decolorizing shaker. And (3) dripping freshly prepared DAB color development liquid into the ring after the slice is slightly dried, controlling the color development time under a microscope, and washing the slice with tap water to terminate the color development, wherein the positive color is brown.

Counterstaining the nuclei: the hematoxylin counterstain is carried out for about 3min, the water washing is carried out, the hematoxylin differentiation liquid is differentiated for a plurality of seconds, the tap water washing is carried out, the hematoxylin blue returning liquid returns blue, and the running water washing is carried out.

And (3) removing the water sealing piece: sequentially placing the slices into 75% alcohol for 5min,85% alcohol for 5min, absolute alcohol for 5min, n-butanol for 5min, and xylene for 5min for dehydration and transparency, taking out the slices from xylene, air drying, and sealing with sealing glue. Microscopic examination, image acquisition and analysis. Hematoxylin-stained nuclei were blue and DAB showed positive expression as brown yellow.

As shown in fig. 17, the mouse livers were subjected to immunohistochemical staining, and the expression levels of LDLR in the livers of each group of mice were measured. Among them, consistent with the report in the literature, the stained sections of the low-fat group showed more brown-yellow positive signals as a whole, while the expression of LDLR was inhibited in the high-fat group due to excessive accumulation of fat in the liver. Because the platelet membrane-nano selenium-miR-148 a-3p inhibitor group is successfully loaded with miR-148a-3p inhibitor for targeted delivery to the liver, more brown yellow positive signals appear in the dyed slices, and the expression of LDLR is recovered.

8. Immunofluorescence

Paraffin sections dewaxed to water: sequentially placing the slices into xylene I15 min-xylene II 15 min-absolute ethanol I5 min-absolute ethanol II 5min-85% ethanol 5min-75% ethanol 5 min-distilled water for washing.

Antigen retrieval: the tissue sections were placed in a repair box filled with EDTA (pH 9.0) antigen retrieval solution and subjected to antigen retrieval in a microwave oven. Middle fire is carried out for 9min until boiling, fire is stopped for 7min, and then middle fire and low fire are carried out for 7min. After natural cooling, the slide was washed 3 times with shaking in PBS (pH 7.4) on a decolorizing shaker for 5min each.

Circling serum sealing: the sections were slightly spun off and then circled around the tissue with a histochemical pen to prevent antibody from running off, spun off PBS, BSA added dropwise, and blocked for 30min. (primary antibody was blocked with 10% donkey serum from goat source and 3% BSA from other sources)

Adding an antibody: gently throwing away the sealing liquid, dripping the first anti-LDLR prepared by PBS according to a certain proportion on the slice, and horizontally placing the slice in a wet box for incubation at 4 ℃ for overnight.

Adding a secondary antibody: the slide was washed with shaking 3 times, 5min each time, in PBS (pH 7.4) on a decolorizing shaker. And (3) dripping secondary antibody covering tissues corresponding to the primary antibody into the circle after the sections are slightly dried, and incubating for 50min at room temperature in a dark place.

DAPI counterstaining nuclei: the slide was washed with shaking 3 times, 5min each time, in PBS (pH 7.4) on a decolorizing shaker. And (3) dripping DAPI dye solution into the ring after the slices are slightly dried, and incubating for 10min at room temperature in a dark place.

Quenching tissue autofluorescence: the slide was washed with shaking 3 times, 5min each time, in PBS (pH 7.4) on a decolorizing shaker. Adding an autofluorescence quenching agent into the ring for 5min, and washing with running water for 10min.

Sealing piece: and (5) after the slices are slightly dried, sealing the slices by using an anti-fluorescence quenching sealing tablet.

And (5) microscopic examination and photographing: sections were observed under a fluorescence microscope and images were acquired. (DAPI ultraviolet excitation wavelength 330-380nm, emission wavelength 420nm, blue light emission; CY3 excitation wavelength 510-560, emission wavelength 590nm, red light emission).

As shown in fig. 18, immunofluorescent staining was performed on mouse livers to further verify the expression level of LDLR in the livers of each group of mice. Wherein blue fluorescence indicates dapi dye-labeled nuclei and red fluorescence indicates cy 3-labeled LDLR antibodies. Consistent with the immunohistochemical results, immunofluorescent-stained sections of the low-fat group had more red fluorescent signal; the red fluorescence area in the high-fat group is smaller, and the fluorescence signal intensity is weaker, which indicates that the LDLR expression is reduced. The platelet membrane-nano selenium-miR-148 a-3p inhibitor group fluorescence staining slice restores part of red fluorescence intensity, which shows that the treatment group enhances the expression of part of LDLR.

9. Tissue HE staining

Firstly embedding a tissue in paraffin, soaking paraffin sections in xylene I for 10min, in xylene II for 10min, in absolute ethanol for 5min, in 95% ethanol for 5min, in 80% ethanol for 5min, in 70% ethanol for 5min, in 50% ethanol for 5min, and in distilled water for 5min. Hematoxylin stains cell nuclei, is washed by tap water for 10min to return blue, is soaked in 70% ethanol for 5min, is soaked in 80% ethanol for 5min, and is soaked in 95% ethanol for 5min. Eosin staining for 15s, soaking in 95% ethanol for 5min, soaking in absolute ethanol for 5min, soaking in xylene I for 10min, and soaking in xylene II for 10min. And sealing the neutral resin, airing and observing and photographing by a microscope.

After the non-alcoholic fatty liver mice are treated by tail vein injection for 4 weeks, the changes of main organs of the mice are measured, and the influence of nano-drugs on the safety of the mice in vivo is evaluated. As can be seen from FIG. 19a, the HE staining patterns of the heart, spleen, lung and kidney of each group of mice were not significantly abnormal. In the optical morphology of each organ, the liver appearance of the high-fat group and the negative control group is uniformly increased, the surface is greasy, the edge is blunt and thick, the liver belongs to obvious fatty liver morphology, and other main organs have no obvious abnormality.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that it will be apparent to those skilled in the art that several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the scope of the invention.

Claims

1. The bionic nano-selenium particle consists of a platelet membrane coated and adsorbed miRNA nano-selenium particle, wherein the miRNA is miR-148a-3p inhibitor.

2. The bionic nano-selenium particle according to claim 1, wherein the diameter of the bionic nano-selenium particle is 70+/-5 nm, and the encapsulation rate of the bionic nano-selenium particle for adsorbing miRNA is 73+/-5%; the sequence of the miR-148a-3p inhibitor is ACAAAGUUCUGUAGUGCACUGA (SEQ ID NO: 1).

3. A method of preparing the biomimetic nano-selenium particles of claim 1 or 2, the method comprising:

4. A method according to claim 3, wherein the operation of step 1) is: chitosan is dissolved in 1 percent glacial acetic acid, and the weight-volume ratio is 1 to 2 percent; 500-800r/min light-shielding magnetic stirring for 10-14h; slowly dripping 15-30mmol/L sodium selenite solution, and magnetically stirring for 20-40min at 00-800 r/min; slowly dripping 80mmol/L Vc solution, magnetically stirring for 30min at 600r/min, transferring into a reagent bottle, and storing in a refrigerator at 4 ℃, wherein the volumes of the sodium selenite solution and the Vc solution are the same as the volume of glacial acetic acid.

5. The method of claim 3, wherein step 2) is performed by mixing 10 μm FAM standard miR-148a-3p inhibitor mother liquor with chitosan-nanoselenium solution at a ratio of 1: mixing at a volume ratio of 60-80, vortex oscillating, and incubating at 50-60deg.C for 1-2 hr to allow them to combine completely to form nucleic acid complex; centrifuging to obtain supernatant, placing in a quartz cuvette, measuring fluorescence intensity with a fluorescence spectrophotometer, exciting wavelength 485nm, emitting wavelength 524nm, and calculating encapsulation efficiency;

6. A method according to claim 3, wherein the operation of step 4) is to pass the platelet membrane vesicles obtained in step 3) through a liposome extruder of a filter membrane of 800nm, 400nm, 200nm, a liposome extruder of a filter membrane of 8-13 times in sequence, and obtain platelet membranes after physically extruding to uniform particle size.

7. A method according to claim 3, wherein the operation of step 5) is to mix the platelet membrane obtained in step 4) with the nano-selenium solution obtained in step 2) in a volume ratio of 1-2:4-6, incubate at 37 ℃ for 10-15min,80-120hz, sonicate at 20-30 ℃ for 10-15min, pass through a liposome extruder of 200nm filter membrane 8-13 times, centrifuge at 8000-8500rpm/min for 10-50min after coextrusion to remove excess vesicles, and obtain encapsulated biomimetic nano-selenium particles.

8. Use of the biomimetic nano-selenium particles of claim 1 or the biomimetic nano-selenium particles prepared by the method of any one of claims 3-7 for preparing a preparation for improving the antioxidant capacity of cells, wherein the antioxidant capacity comprises, but is not limited to, anti-superoxide anion activity, hydroxyl radical inhibition, superoxide dismutase activity improvement and glutathione peroxidase activity improvement.

9. Use of the biomimetic nano-selenium particles of claim 1 or the biomimetic nano-selenium particles prepared by the method of any of claims 3-7 in the preparation of a formulation for reducing lipid accumulation in a subject, said subject being a non-alcoholic fatty liver patient; the in vivo fat accumulation is liver lipid accumulation.

10. Use of the biomimetic nano-selenium particles of claim 1 or the biomimetic nano-selenium particles prepared by the method of any one of claims 3-7 in the preparation of a preparation for increasing the expression of LDL receptor, which is LDL receptor of liver cells.