CN116400066A - Method and kit for detecting concentration of target molecules in mixed system - Google Patents

Method and kit for detecting concentration of target molecules in mixed system Download PDF

Info

Publication number
CN116400066A
CN116400066A CN202211411451.5A CN202211411451A CN116400066A CN 116400066 A CN116400066 A CN 116400066A CN 202211411451 A CN202211411451 A CN 202211411451A CN 116400066 A CN116400066 A CN 116400066A
Authority
CN
China
Prior art keywords
molecule
ssdna
target molecule
concentration
reporter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211411451.5A
Other languages
Chinese (zh)
Inventor
张翀
牛晨启
邢新会
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Jushu Biotechnology Co ltd
Original Assignee
Beijing Jushu Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Jushu Biotechnology Co ltd filed Critical Beijing Jushu Biotechnology Co ltd
Publication of CN116400066A publication Critical patent/CN116400066A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for quantitatively detecting the concentration of a target molecule X, which comprises the following steps: adding a reporter molecule a to a reaction system comprising said target molecule X for at least a first given time, wherein said reporter molecule a has a specific binding activity with the target molecule X; adding a competitor molecule B to the reaction system, wherein the competitor molecule B has a specific binding activity with the reporter molecule A and no binding activity with the target molecule X, and when the target molecule X is not present, the competitor molecule B emits fluorescence intensity L with given intensity when bound with the reporter molecule A 0 The method comprises the steps of carrying out a first treatment on the surface of the Mixing the systems uniformly and waiting at least a second given time before detecting the fluorescence intensity L of the systems; within the desired concentration range, the concentration of the target molecule X may be equal to L 0 -the L values establish a linear relationship; the linear relation established above is used as a standard curve, and the actual measured fluorescence intensity change value L can be used 0 -L derives the concentration of the target molecule X. The invention also relates to a kit matched with the method.

Description

Method and kit for detecting concentration of target molecules in mixed system
This application is a divisional application of an invention patent application of which the application date is 12/10/2020, the application number is 202011434928.2, and the invention name is a method and a kit for detecting the concentration of a target molecule in a mixed system.
Technical Field
The invention relates to the technical field of chemical analysis, in particular to a method and a kit for detecting the concentration of target molecules in a mixed system.
Background
The detection of the concentration of the substance is widely applied in the fields of chemical industry, biological medicine, medicine and the like. Research into nucleic acid aptamers developed and developed in the 90 s of the 20 th century has prompted the development of this field. The aptamer is a small oligonucleotide sequence or short polypeptide obtained by in vitro screening, can be combined with the corresponding ligand with high affinity and strong specificity, provides a new research platform for high-efficiency and quick identification for the chemical biology field and the biomedical field, and has good application prospect in many aspects.
The traditional detection method for the concentration of the target molecules by using the nucleic acid aptamer mostly needs to involve G4 conjunct color development, fluorescence energy resonance transfer, complex primer probe design and more complicated experimental processes. This results in the inability of individual detection methods to achieve a good uniformity in time, cost, specificity, sensitivity, and simplicity.
The Cas12a protein and crRNA complex can recognize and bind to a DNA single strand of a particular sequence, and then exhibit surprising trans-cleavage activity (trans-cleavage). The single-stranded DNA fluorescent reporter in the Cas12a binding system is therefore used in research on DNA detection. Recently, team Zhang Lixin and Tan Gaoyi developed a "cat nose" method that uses the feature of small molecule allosteric proteins to release DNA in the presence of specific small molecules, and combines Cas12a for detection of target molecules. However, the method can only detect small molecules with corresponding allosteric proteins, and has great limitation.
Disclosure of Invention
Thus, the present application developed a detection method for binding aptamer to target molecule and CRISPR technology, named molecular radar #random Molecular aptamer-dependent CRISPR-assistreporter). The method can quantitatively detect any small molecule within 0.5 h.
The technical scheme of this application provides:
1. a method for quantitatively detecting the concentration of a target molecule X, comprising:
adding a reporter molecule a to a reaction system comprising said target molecule X and waiting for at least a first given time, wherein said reporter molecule a has a specific binding activity with the target molecule X;
adding a competitor molecule B to the reaction system, wherein the competitor molecule B has a specific binding activity with the reporter molecule A and no binding activity with the target molecule X, and when the target molecule X is not present, the competitor molecule B emits fluorescence intensity L with given intensity when bound with the reporter molecule A 0 ；
Mixing the systems uniformly and waiting at least a second given time before detecting the fluorescence intensity L of the systems;
within the desired concentration range, the concentration of the target molecule X may be equal to L 0 -the L values establish a linear relationship;
the linear relation established above is used as a standard curve, and the actual measured fluorescence intensity change value L can be used 0 -L derives the concentration of the target molecule X.
2. The method according to item 1, wherein the target molecule X is any molecule suitable for screening nucleic acid aptamers.
3. The method of item 2, wherein the reporter a is ssDNA comprising at least two parts: a nucleic acid aptamer ssDNA capable of binding specifically to the target molecule X, and a fluorescence-quenching probe ssDNA carrying a fluorescent group and a quenching group and an immobilization sequence.
4. The method of item 3, wherein the competitor molecule B is a Cas12a/crRNA complex, wherein the crRNA is capable of specifically binding to the aptamer ssDNA in reporter a.
5. The method of item 4, wherein the target molecule is ATP, the sequence of the aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.2;
SEQ ID NO.1(5’-3’):
ACCTGGGGGAGTATTGCGGAGGAAGGT
SEQ ID NO.2(5’-3’):
UAAUUUCUACUAAGUGUAGAUUCCUCCGCAAUACUCCCCCA。
6. the method of item 4, wherein the ratio of Cas12a/crRNA complex to the aptamer ssDNA at the time of use is 3:1 to 1.05:1.
7. The method of item 4, wherein the concentration of the fluorescence-quenching probe ssDNA is excessive relative to the concentration of the nucleic acid aptamer ssDNA or Cas12a/crRNA complex.
8. The method according to item 1, wherein a fluorescence analyzer is used for the fluorescence intensity measurement.
9. The method of item 4, wherein the desired concentration range is 25. Mu.M to 0.5mM.
10. The method of item 4, wherein the first given time is 15 minutes.
11. The method of item 4, wherein the second given time is 10 minutes.
12. A kit for determining the concentration of a target molecule X comprising at least a reporter molecule a and a competitor molecule B, wherein the reporter molecule a is capable of specifically binding to the target molecule X and the competitor molecule B is capable of specifically binding to the reporter molecule a and does not undergo any binding to the target molecule XA combination of modes; when the target molecule X is not present, the competing molecule B emits a fluorescent intensity L of a given intensity when bound to the reporter molecule A 0 。
13. The kit of item 12, wherein the target molecule X is any molecule suitable for screening for a nucleic acid aptamer.
14. The kit of item 13, wherein the reporter a is ssDNA comprising at least two parts: a nucleic acid aptamer ssDNA capable of binding specifically to the target molecule X, and a fluorescence-quenching probe ssDNA carrying a fluorescent group and a quenching group and an immobilization sequence.
15. The kit of item 14, wherein the competitor molecule B is a Crispr-Cas12a/crRNA complex, wherein the crRNA is capable of specifically binding to the aptamer ssDNA in reporter a.16. The kit of item 15, wherein the target molecule is ATP, the sequence of the aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.2.
17. The kit of item 15, wherein the ratio of Cas12a/crRNA complex to the aptamer ssDNA at the time of use is 3:1 to 1.05:1.
18. The kit of item 15, wherein the concentration of the fluorescence-quenching probe ssDNA at the time of use is excessive relative to the concentration of the nucleic acid aptamer ssDNA or Cas12a/crRNA complex.
The beneficial technical effects that the technical scheme of this application obtained:
compared with other detection technologies, the technical scheme has the advantages that the detection method is potentially established to replace the traditional method by screening out the proper nucleic acid aptamer for various types of molecules, and meanwhile, the method is simple to operate, takes very short time (the result can be obtained within 10-30 min) and can be used for quantification.
Drawings
FIG. 1 is a schematic diagram of Cas12 a-mediated detection of small molecules;
FIG. 2 is a feasibility verification schematic; wherein A shows that the positive control group can reduce the fluorescence signal after adding ATP; whereas B shows that the signal drop is not due to the effect of ATP on the activity of the protein;
FIG. 3 is the effect of different buffers on the trans-cleavage activity of Cas12 a;
FIG. 4 is a graph of fluorescence increase over time at different concentrations of Cas12a/crRNA complex; (a) a positive control; (B) 5mM ATP;
FIG. 5 is a schematic illustration of Cas12a: crRNA addition ratio optimization;
fig. 6 shows that Cas12a possesses different trans-cleavage activity at different concentrations of DNA activator. A. Curves of fluorescence values of ssDNA (no PAM sequence) (ATP aptamer) at different concentrations over time; a bar graph drawn by fluorescence values at 30min in a B.A graph; C. bar graphs of fluorescence values of different concentrations of ssDNA (with PAM sequence) at 30 min; D. bar graphs of fluorescence values plotted at 30min for different concentrations of dsDNA (with PAM sequence);
FIG. 7 shows the effect of different F-Q probe concentrations on trans-cleavage. A. Fluorescence value versus time curve for the first 40 min. B. All curves reached plateau fluorescence values at 90 min.
FIG. 8A is the kinetics of fluorescence at different ATP concentrations; b is quantification of ATP concentration by monitoring inhibition; c is specificity for 1mM nucleoside; wherein ATP is adenosine triphosphate; TTP: thymidine triphosphate; CTP: cytidine triphosphate; GTP is guanosine triphosphate; UTP is uridine triphosphate.
Detailed Description
It should be noted that certain terms are used throughout the description and claims to refer to particular components. Those of skill in the art will understand that a person may refer to the same component by different names. The description and claims do not identify differences in terms of components, but rather differences in terms of the functionality of the components. As used throughout the specification and claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth a preferred embodiment for practicing the invention, but is not intended to limit the scope of the invention, as the description proceeds with reference to the general principles of the description. The scope of the invention is defined by the appended claims.
The present application relates in a first aspect to a method for detecting a low concentration of a target molecule in a mixed system.
In one embodiment, a method for quantitatively detecting the concentration of a target molecule X is provided, comprising: adding a reporter molecule a to a reaction system comprising said target molecule X for at least a first given time, wherein said reporter molecule a has a specific binding activity with the target molecule X;
adding a competitor molecule B to the reaction system, wherein the competitor molecule B has a specific binding activity with the reporter molecule A and no binding activity with the target molecule X, and when the target molecule X is not present, the competitor molecule B emits fluorescence intensity L with given intensity when bound with the reporter molecule A 0 ；
Mixing the systems uniformly and waiting at least a second given time before detecting the fluorescence intensity L of the systems;
within the desired concentration range, the concentration of the target molecule X may be equal to L 0 -the L values establish a linear relationship;
the linear relation established above is used as a standard curve, and the actual measured fluorescence intensity change value L can be used 0 -L derives the concentration of the target molecule X.
In the context of the present specification, a "reaction system" is to be understood in a broad sense, as it may be a product solution of a chemical reaction, a product solution of a biological reaction, a cell culture solution, a fermentation broth, a blood sample taken from a patient or a test animal, etc.
In a specific embodiment, the target molecule X is any molecule suitable for screening for nucleic acid aptamers.
In the context of the present specification, the term "target molecule X" encompasses molecules of various molecular weights, which can be targeted for screening of aptamers from a specific pool of oligonucleotides, for example target molecules such as ATP or macromolecules such as influenza, E.coli, salmonella surface proteins.
In yet another embodiment, the reporter a is ssDNA comprising at least two parts: a nucleic acid aptamer ssDNA capable of binding specifically to the target molecule X, and a fluorescence-quenching probe ssDNA carrying a fluorescent group and a quenching group and an immobilization sequence. And the competitor molecule B is a Cas12a/crRNA complex, wherein the crRNA is capable of specifically binding to the aptamer ssDNA in reporter a.
In yet another specific embodiment, the competitor molecule B is a Cas12a/crRNA complex, wherein the crRNA is capable of specifically binding to the aptamer ssDNA in reporter a.
In the context of the present specification, a "competitor molecule B" may be a complex of Cas12a protein and crRNA. Wherein CRISPR-Cas is an abbreviation for Clustered Regularly Interspaced Short Palindromic Repeats-associtedprotain (clustered regularly interspaced short palindromic repeat related protein); whereas crRNA is an abbreviation for CRISPR RNA. Cas12a is the name of a particular protein in this family of proteins. Here, the crRNA functions to specifically recognize and hybridize to a nucleotide substrate; while Cas12a functions to cleave the nucleotide substrate after crRNA recognizes and hybridizes to it and cleaves the free surrounding ssDNA substrate.
In the context of the present specification, the chemical nature of "reporter a" is ssDNA, which is an english abbreviation for single-stranded DNA. In some embodiments, the ssDNA reporter is composed of two separate moieties: "aptamer" ssDNA "and" fluorescence-quenching probe (F-QProbe) ssDNA ". Wherein the aptamer ssDNA can specifically bind to a target molecule (the binding belongs to physical binding, and the binding force is basically composed of hydrogen bonds, intermolecular forces and pi-pi stacking forces) due to the specific sequence, and can also specifically bind to a competing molecule B (a complex of Cas12a protein and crRNA) so as to excite the cleavage activity of Cas12a protein. Wherein the fluorescent-quenching probe ssDNA is a fixed sequence, one end of the fixed sequence is marked as a FAM fluorescent group, the other end of the fixed sequence is marked as a BHQ quenching group, and the nucleic acid sequence is 5'-FAM-TTTTT-BHQ-3', which can be called a fluorescent probe (F-QProbe, namely, the English abbreviation of fluorescent-Quenchen) in the specification; the fluorescence-quenching probe ssDNA is free in a system, FAM and BHQ groups are closer in distance under a natural state, fluorescence is quenched, and no fluorescence signal exists; and when the fluorescent probe is cut off by the trans-cleavage activity of the Cas12a protein, the FAM fluorescent group and the BHQ quenching group are separated, and the whole system presents a fluorescent signal. It is noted that when Crispr-Cas12a is triggered to cleave trans-cleavage activity, all surrounding ssDNA will be cleaved indiscriminately, naturally also including fluorescent-quenched probe ssDNA. Thus, for competitor B (a complex of the Crispr-Cas12a protein and crRNA), the aptamer ssDNA acts as the "activating substrate" and the fluorescent-quenching probe ssDNA acts as the "reaction substrate".
In yet another embodiment, the target molecule is ATP, the sequence of the aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.2;
SEQ ID NO.1(5’-3’):ACCTGGGGGAGTATTGCGGAGGAAGGT
SEQ ID NO.2(5’-3’):
UAAUUUCUACUAAGUGUAGAUUCCUCCGCAAUACUCCCCCA。
in a specific embodiment, the ratio of Cas12a/crRNA complex to the aptamer ssDNA at the time of use is 3:1 to 1.05:1. Specifically, the ratio may be 3:1, 2.8:1, 2.6:1, 2.4:1, 2.2:1, 2:1, 1.9:1, 1.8:1, 1.7:1, 1.6:1, 1.5:1, 1.45:1, 1.4:1, 1.35:1, 1.3:1, 1.25:1, 1.2:1, 1.15:1, 1.1:1, 1.05:1.
In yet another embodiment, the concentration of the fluorescent-quenching probe ssDNA is in excess relative to the concentration of the nucleic acid aptamer ssDNA or Cas12a/crRNA complex. "excess" as described herein may be understood, for example, as: the concentration of the fluorescence-quenching probe ssDNA is at least 15-fold, specifically, may be 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, or 50-fold that of the nucleic acid aptamer ssDNA.
In one embodiment, a fluorescence analyzer is used for the determination of fluorescence intensity.
In yet another embodiment, the desired concentration range is 25. Mu.M to 0.5mM.
In yet another embodiment, the first given time is 15 minutes; and the second given time is 10 minutes.
The present application relates in a second aspect to a detection kit for a target molecule X.
In one embodiment, a detection kit for a target molecule X for use with the above fluorescence analyzer is provided, comprising at least the above-mentioned reporter molecule a and a competitor molecule B, wherein the reporter molecule a is capable of specifically binding to the target molecule X and the competitor molecule B is capable of specifically binding to the reporter molecule a and does not bind to the target molecule X in any way; when the target molecule X is not present, the competing molecule B emits a fluorescent intensity L of a given intensity when bound to the reporter molecule A 0 。
In yet another embodiment, a test kit is provided wherein the kit further comprises a disposable container for mixing and testing and instructions describing relevant information regarding the use of the kit.
Optimally, the method involved in the present application can be designed as: the reaction system contains an aptamer ssDNA for ATP (embodiment of target molecule X) and a fluorescence-quenching probe ssDNA (embodiment of reporter a), a Cas12a protein, and crrnas (embodiment of competitor molecule B) and a reaction buffer that can specifically recognize the foregoing aptamer and complement the pairing. Applicants designed crrnas to be complementary to ssDNA aptamers that, when no target molecule is present in the reaction system, would bind to Cas12a/crRNA complex as an activator to form an aptamer/Cas 12a/crRNA trisome complex when Cas12a is activated, exhibiting trans-cleavage (trans-cleavage) activity, hydrolyzing all surrounding ssDNA (including fluorescent-quenching probe ssDNA). At this time, the fluorescent-quenched probe ssDNA becomes a trans-cleaved substrate of Cas12a, after it is hydrolyzed, its fluorescent group and quenching group are separated, the light emitted from the fluorescent group is not quenched any more, the whole system can read the fluorescent value, and the fluorescent value at this time is used as a positive control group. When the target molecule exists in the reaction system, the specific aptamer can be combined with the target molecule with high affinity and strong specificity, and the aptamer/Cas 12a/crRNA trisome complex formed by combining with the Cas12a/crRNA complex is reduced, so that the quantity of activated Cas12a is reduced, F-Q probe hydrolyzed by trans-cleavage activity in unit time is reduced, and finally the fluorescence intensity in unit time is reduced. The principle of operation of the present reaction system can be seen in FIG. 1.
< examples section >
Specific embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. While specific embodiments of the invention are shown in the drawings, it should be understood that the invention may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
Example 1 feasibility verification experiment
To verify the feasibility of this approach, we selected the aptamer sequence of ATP (SEQ ID NO. 1) and based on this sequence, combined with the characteristics and properties of the Cas12a nuclease and its crRNA, designed the sequence of crRNA-ATP (SEQ ID NO. 2). Positive control (PC, dotted curve) by forming Cas12 a-crRNA-aptamer complex, cas12a is activated, cleavage of F-Q probe with trans-activity, obtaining higher fluorescence value; while the other group, by adding ATP target molecules as the experimental group (boxed curve), decreased fluorescence values due to the fact that the aptamer can bind specifically to ATP, resulted in a decrease in the effective aptamer for excitation (see fig. 2A).
Considering the decrease in signal after the addition of ATP, it is also possible that the target molecule affects the activity of the protein in the reaction system, thereby decreasing the fluorescent signal, and not the inhibition by competing aptamers. Thus, another crRNA-EGFR was designed to specifically recognize the EGFR gene. Here, the crRNA-EGFR sequence is SEQ ID NO.3 (5 '-3'): UAAUUUCUACUAAGUGUAGAUUCUUCCGCACCCAGCAGUUU, whereas neither the EGFR gene nor the crRNA-EGFR binds ATP. As a control group in a system in which the EGFR gene activates the Cas12a protein/crRNA complex, ATP and mercury ions are added separately (see fig. 2B), it can be seen that the fluorescence value does not significantly decrease after ATP addition, the ATP does not have a nonspecific inhibition of the activity of the Cas12a protein, but in contrast, mercury ions can severely affect the Cas12a protein activity. The influence of ATP on the activity of the protein is eliminated, and the feasibility of the experiment is verified.
Designed experimental conditions
Typical reaction system:
component (A) Additive amount Final concentration
Cutsmart buffer (10X) 8μL 1X
F-Qprobe(2μM) 8μL 200nM
Cas12a(0.1μM) 4μL 5nM
crRNA(0.1μM) 4μL 5nM
Aptamer (50 nM) 8μL 5nM
Adenosine triphosphate ATP 8μL
H2O Added to 80. Mu.L
Note that: all PC groups below were replaced with equal volumes of water by ATP in the table above. NC group is to replace the ATP and aptamer described above with an equal volume of water.
The operation steps are as follows:
1. taking 1.5ml of a light-resistant centrifuge tube, marking the centrifuge tube as tube A, adding ATP target molecules and an aptamer, incubating for 20min in advance, and starting 20min to count down.
2. When counting down to 15min, another 1.5ml centrifuge tube was taken and designated tube B, cas12a was incubated with crRNA in advance.
3. When counting down to 3min, H20, cutmart buffer, F-Q probe were added sequentially to tube A.
4. At a count down of 0min, tube B solution was mixed with tube a solution, gently shaken and centrifuged.
5. Subpackaging into black 96-well plates, and placing into an enzyme-labeled instrument to read fluorescence values.
Enzyme-labeled instrument procedure:
the temperature was maintained at 37℃and the primary fluorescence value was measured at intervals of 30 seconds. Excitation wavelength 492nm and emission wavelength 518nm.
And (3) data processing:
in this study, it is desirable that the fluorescence value increases linearly with time until the F-Q probe is completely cleaved, the fluorescence value reaches a maximum value, and the fluorescence value is kept from increasing in the plateau. The data were processed with graphpaprism 7 mapping software and fluorescence values were plotted as a function of time. When calculating the sensitivity, the data which does not reach the plateau and which is approximately linearly increased are regarded as effective data, and a parameter Inhibition Rate (%), IR (%)) is defined to represent the Inhibition degree of the target molecule to the positive control.
The formula is as follows
IR1(％)＝(A-B)/(A-C)×100
IR2(％)＝(A-B)/A×100
IR(％)＝MeanofIR1(％)andIR2(％)
A, fluorescence intensity of reaction system without ATP and PC group
Reaction system fluorescence intensity added with ATP, experimental group
Background fluorescence intensity, NC group
The difference between IR1 and IR2 is whether the effect of NC group was considered when calculating inhibition, and we considered that neither was the most perfect choice. For the data regressible into a straight line in the fluorescence value-time curve, the IR1 and IR2 values are extremely large and extremely small at the zero moment, but tend to be the same intermediate constant value along with the increase of time, and the curves of the two values are distributed in an axisymmetric mode. It is most reasonable to define IR to represent the mean of both.
Example 2 optimization experiments of the reaction System
1 optimization of reaction buffer system:
cas12a is a nuclease whose cleavage activity performance must be affected by the surrounding environment. In previous reports, NEB buffer 2.1, NEB buffer 3.1, NEB buffer 4, NEB cutmart buffer or self-configuring buffer was also used. We therefore studied the effect of buffers of different compositions on Cas12a cleavage activity (see figure 3). It can be seen that an important factor affecting Cas12a cleavage activity is the divalent cation Mg in the test solution 2+ Concentration. Because Cas12a RuvC domain cleaves ssDNA through a bimetallic ion mechanism, mg 2+ Ions induce conformational coordination of RuvC domains and ssDNA by altering the spatial distribution of ssDNA around RuvC active cleavage centers. This result is consistent with previous reports. But when Mg is 2+ At a constant concentration, different buffers also showed different cleavage activitiesThis is probably due to the effect of salt concentration, which is consistent with nuclease properties.
The components of the CutSmart buffer are: 50mM KAc,20mM Tris-Ac,10mM Mg (Ac) 2, 100. Mu.g/ml BSA (pH 7.9@25℃);
NE buffer 3.1:100mM NaCl,50mM Tris-HCl,10mM MgCl2,100. Mu.g/ml BSA (pH 7.9@25℃);
buffer a:50mM KAc,20mM Tris-Ac,1mM Mg (Ac) 2, 100. Mu.g/ml BSA (pH 7.9@25℃).
2. Protein and RNA concentration optimization:
the concentration of Cas12a/crRNA complex directly determines the number of trans-cleaving active sites and also determines the rate of increase of fluorescent signal in the system. We optimized the concentration of Cas12a/crRNA complex using a concentration ratio Cas12a: crrna=1:1 (see fig. 4). It can be seen that when the concentration of the Cas12a/crRNA complex is higher than 5nM, the reaction speed is high, and the PC group can only observe data in the platform phase, which is unfavorable for data processing; however, when the concentration of the Cas12a/crRNA complex is lower than 5nM, the fluorescence value of the experimental group added with the target molecule is extremely low, which causes difficulty in distinguishing from the NC group. Thus, comprehensively, the Cas12a/crRNA complex concentration was chosen to be 5nM for subsequent experiments. Compared with the previous report that the detection method adds 50nM of Cas12a and the HOLMES method adds 250nM of Cas12a, the concentration used in the study greatly reduces the use of reagents and greatly saves the cost. The different Cas12a/crRNA complexes in fig. 4 are of identical NC group fluorescence values, collectively denoted NC in the figure.
3. Optimizing the concentration ratio of protein and RNA:
in order to ensure that Cas12a effectively exerts trans-cleavage capability, it is necessary to ensure its efficient production of Cas12a/crRNA complex. In reported studies, cas12a in the detect method: rna=1:1.25, holmes method Cas12a: rna=1:2, it can be seen that there is a different Cas12a-RNA concentration ratio for different reaction systems. We therefore optimized for different Cas12a-RNA concentration ratios (see fig. 5). It can be seen that in the system of the present study, there is no obvious difference in the different addition ratios, and Cas12a was selected for cost saving: rna=1:1 for subsequent experiments.
4. Optimization of aptamer addition:
the aptamer added in the PC group is essentially a ssDNA activator, and ATP and aptamer specific binding in the system results in reduced fluorescence. Therefore, the addition amount of the aptamer has a great influence on the fluorescence value of PC and the sensitivity of ATP detection. We therefore optimized for different concentrations of the aptamer. (see FIGS. 6A, 6B) interestingly, the PC group fluorescence values did not increase all the way with increasing aptamer concentration, but exhibited a bell-shaped curve. To the left of the peak, when the aptamer concentration is lower, as the aptamer concentration increases, the same time-released fluorescence value increases, indicating that activated Cas12a increases as the aptamer concentration increases. However, when the aptamer concentration was too high, the fluorescence signal was instead decreased over the same time, indicating that the number of activated Cas12a was decreased. This is the first report of this phenomenon on Cas12a, which was not reported in the literature. It is hypothesized that it may be desirable to form a triple complex of Cas12a-crRNA-DNA when Cas12a functions, whereas when the aptamer concentration is too high, the probability of effective collision of the three is reduced due to steric hindrance effect, thus reducing the number of Cas12a that are effectively activated. Cas12a is predominantly characterized by trans-cleavage activity in this reaction, F-QProbe being the substrate cleaved. The aptamer cannot be strictly called a reaction substrate. As it is considered to be an "activation substrate" that activates Cas12a, this bell-shaped curve illustrates that an excessively high "activation substrate" concentration results in a decrease in enzyme activity, much like the previously reported phenomenon of substrate inhibition.
Furthermore, to investigate whether this phenomenon only occurs when the aptamer (ssDNA) activates Cas12a, we were validated with different concentrations of ssDNA with PAM sequence (see fig. 6C) and dsDNA with PAM sequence (see fig. 6D), respectively. This was found to be observed in both ssDNA and dsDNA. It is worth mentioning that when the highest fluorescence value occurs, the ratio of Cas12a to crRNA to DNA activator approaches 1:1:1, but some differences exist according to different sequences, such as the highest fluorescence value of ssDNA (without PAM sequence) (ATP aptamer) occurs at a concentration of 12.5nM; the maximum fluorescence value of ssDNA (with PAM sequence) occurs at a concentration of 1nM; the maximum fluorescence value of dsDNA (with PAM sequence) appears at a concentration of 5nM. Thus, for each different in vitro method of detection of RNA binding to DNA (ssDNA and dsDNA), a working curve is first drawn to find the optimal concentration.
This substrate inhibition phenomenon can also be verified from one side. When the concentration of ssDNA (with PAM sequence) (ATP aptamer) (here, the PAM-carrying ssDNA sequence is SEQ ID NO.4 (5 '-3'): AGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGA) was increased to 25nM, ATP target molecules were added as inhibitors at different concentrations, and the fluorescence value of the whole system was increased by 0.01mM ATP compared with that of the PC group (see FIG. 1). That is because the concentration of potent ssDNA activators drops from 25nM after ATP at this concentration binds a portion of the aptamer, thereby approaching the optimal concentration more.
Concentration optimization of F-Q probe:
we also evaluated the effect of probe concentration on the overall reaction system. As the probe concentration increases, the fluorescence increases, the enzymatic reaction increases, and the law accords with the kinetics of the enzymatic reaction and the Mies equation, when cas12a nuclease is the primary reaction (see FIG. 7A). It can be seen that at 40min, the 800nM concentration of probe has not been completely consumed, the fluorescence value has no tendency to go to plateau, all probes by 90min have been hydrolysed by cas12a nuclease by trans-cleavage activity, the fluorescence value has not increased any more (see FIG. 7B), and the fluorescence intensity is proportional to the probe concentration. Thus, a suitable concentration is selected. Since the fluorescence value is reduced in a system in the presence of ATP, in order to ensure a certain degree of discrimination from the NC group in a limited time, 200nM F-Q probe was finally selected for subsequent experiments.
Example 3 sensitivity and specificity experiments
Based on the above-described optimization conditions, we evaluated the sensitivity of the method for detecting ATP target molecules. We will use the case of an aptamer as ssDNA activator as a positive control. After addition of different concentrations of ATP, the aptamer acting as an activator is reduced due to the specific binding of ATP to the aptamer (see FIG. 8A). Quantitative analysis can be accomplished by monitoring the inhibition rate 13min after the start of the reaction. We plotted the IR% of ATP as the y-axis and the logarithm of ATP concentration as the x-axis, and fit a linear response with r2= 0.9496 and dynamic range (dynamic range) of 0.1mM-5mM (see fig. 8B). According to the formula detection Limit (LOD) =3×sd/slope, the LOD can reach 2.66 μm. This sensitivity and dynamic range is superior to and the aptamer-based chromogenic sensor, but does not reach the inorganic material-based detection method. The curve fitted with [ inhibitor ] vs. response shows lc50=0.60.
The specificity of this method was tested with 1mM of the various nucleosides (see FIG. 8C). It can be seen that ATP can significantly reduce the fluorescence value of the reaction, with the other 4 nucleosides having little effect on the PC group. The method is proved to have extremely high specificity. The data in fig. 8 are from three independent measurements of a) and C), and nine independent measurements of B). Error bars represent standard deviation.
Although the embodiments of the present invention have been described above with reference to the accompanying drawings, the present invention is not limited to the above-described specific embodiments and application fields, and the above-described specific embodiments are merely illustrative, and not restrictive. Those skilled in the art, having the benefit of this disclosure, may effect numerous forms of the invention without departing from the scope of the invention as claimed.

Claims (18)

1. A method for quantitatively detecting the concentration of a target molecule X, comprising:
adding a reporter molecule A to a reaction system comprising the target molecule X and waiting for a first given time, wherein a specific binding activity exists between the reporter molecule A and the target molecule X;
adding a competitor molecule B to the reaction system, wherein the competitor molecule B has specific binding activity with the reporter molecule A and has no binding activity with the target molecule X, and when the target molecule X is not present, the competitor molecule B emits fluorescence intensity with given intensity when binding with the reporter molecule A, namely L 0 ；
Uniformly mixing the reaction system added with the competitive molecule B and detecting the fluorescence intensity L of the reaction system after waiting for a second given time;
within a given concentration range, the concentration of the target molecule X may be equal to L 0 -the L values establish a linear relationship;
the linear relation established above is used as a standard curve, and the actual measured fluorescence intensity change value L can be used 0 -L derives the concentration of the target molecule X.
2. The method of claim 1, wherein the target molecule X is a molecule capable of screening for a nucleic acid aptamer.
3. The method of claim 2, wherein the reporter a is ssDNA (single-stranded DNA, single strand DNA) comprising at least two parts: a nucleic acid aptamer ssDNA capable of binding specifically to the target molecule X, and a fluorescence-quenching probe ssDNA carrying a fluorescent group and a quenching group and an immobilization sequence.
4. A method according to claim 3, wherein the competitor molecule B is a Cas12a/crRNA complex, wherein the crRNA is capable of specifically binding to the nucleic acid aptamer ssDNA in reporter a.
5. The method of claim 4, wherein the target molecule is ATP, the sequence of the nucleic acid aptamer ssDNA is SEQ ID No.1, and the sequence of the crRNA is SEQ ID No.2;
SEQ ID NO.1(5’-3’):
ACCTGGGGGAGTATTGCGGAGGAAGGT
SEQ ID NO.2(5’-3’):
UAAUUUCUACUAAGUGUAGAUUCCUCCGCAAUACUCCCCCA。
6. the method of claim 4, wherein the ratio of Cas12a/crRNA complex to the aptamer ssDNA at the time of use is 3:1 to 1.05:1.
7. The method of claim 4, wherein the concentration of the fluorescence-quenching probe ssDNA is excessive relative to the concentration of the nucleic acid aptamer ssDNA or Cas12a/crRNA complex.
8. The method of claim 1, wherein a fluorescence analyzer is used for the fluorescence intensity determination.
9. The method of claim 4, wherein the given concentration range is 25 μm to 0.5mM.
10. The method of claim 4, wherein the first given time is 15 minutes or more.
11. The method of claim 4, wherein the second given time is 10 minutes or more.
12. A kit for determining the concentration of a target molecule X comprising at least a reporter molecule a and a competitor molecule B, wherein the reporter molecule a is capable of specifically binding to the target molecule X and the competitor molecule B is capable of specifically binding to the reporter molecule a and does not bind to the target molecule X in any way; when the target molecule X is not present, the competing molecule B emits a fluorescent intensity L of a given intensity when bound to the reporter molecule A 0 。
13. The kit of claim 12, wherein the target molecule X is a molecule capable of screening for a nucleic acid aptamer.
14. The kit of claim 13, wherein the reporter a is ssDNA comprising at least two parts: a nucleic acid aptamer ssDNA capable of binding specifically to the target molecule X, and a fluorescence-quenching probe ssDNA carrying a fluorescent group and a quenching group and an immobilization sequence.
15. The kit of claim 14, wherein the competitor molecule B is a Crispr-Cas12a/crRNA complex, wherein the crRNA is capable of specifically binding to the aptamer ssDNA in reporter a.
16. The kit of claim 15, wherein the target molecule is ATP, the sequence of the nucleic acid aptamer ssDNA is SEQ ID No.1, and the sequence of the crRNA is SEQ ID No.2.
17. The kit of claim 15, wherein the ratio of Cas12a/crRNA complex to aptamer ssDNA at use is 3:1 to 1.05:1.
18. The kit of claim 15, wherein the concentration of the fluorescent-quenched probe ssDNA at the time of use is excessive relative to the concentration of the nucleic acid aptamer ssDNA or Cas12a/crRNA complex.
CN202211411451.5A 2019-12-11 2020-12-10 Method and kit for detecting concentration of target molecules in mixed system Pending CN116400066A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN2019112681177 2019-12-11
CN201911268117 2019-12-11
CN202011434928.2A CN112986551B (en) 2019-12-11 2020-12-10 Method and kit for detecting concentration of target molecules in mixed system

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN202011434928.2A Division CN112986551B (en) 2019-12-11 2020-12-10 Method and kit for detecting concentration of target molecules in mixed system

Publications (1)

Publication Number Publication Date
CN116400066A true CN116400066A (en) 2023-07-07

Family

ID=76344914

Family Applications (2)

Application Number Title Priority Date Filing Date
CN202211411451.5A Pending CN116400066A (en) 2019-12-11 2020-12-10 Method and kit for detecting concentration of target molecules in mixed system
CN202011434928.2A Active CN112986551B (en) 2019-12-11 2020-12-10 Method and kit for detecting concentration of target molecules in mixed system

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN202011434928.2A Active CN112986551B (en) 2019-12-11 2020-12-10 Method and kit for detecting concentration of target molecules in mixed system

Country Status (1)

Country Link
CN (2) CN116400066A (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112899346A (en) * 2021-01-05 2021-06-04 南京普济生物有限公司 Nucleotide for reducing PCR (polymerase chain reaction) nonspecific amplification and design method and application thereof
CN113552106B (en) * 2021-07-23 2022-12-30 济南大学 Universal fluorescent sensor for detecting ATP, glutathione and Fpg glycosylase
WO2024055110A1 (en) * 2022-09-15 2024-03-21 Societe De Commercialisation Des Produits De La Recherche Appliquee Socpra Sciences Et Genie, S.E.C. Sensor, kit, and method for biomarker detection in saliva

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102520152A (en) * 2011-12-06 2012-06-27 扬州大学 Multi-component direct-competitive immunoassay method for labeling haptens by using quantum dots of micromolecule organic matters
CN106932577B (en) * 2017-05-17 2019-03-15 中国科学院生态环境研究中心 A kind of kit and its detection method with aptamer detection ATP
CN112501254A (en) * 2017-07-14 2021-03-16 上海吐露港生物科技有限公司 Application of Cas protein, and detection method and kit of target nucleic acid molecule
EP3765616B1 (en) * 2018-03-14 2023-07-19 Arbor Biotechnologies, Inc. Novel crispr dna and rna targeting enzymes and systems
CN109652508A (en) * 2018-12-04 2019-04-19 浙江天杭生物科技股份有限公司 A kind of easy quickly detection nuclei aoid methods
CN110541022B (en) * 2019-08-09 2022-11-04 福建医科大学孟超肝胆医院(福州市传染病医院) Mycobacterium tuberculosis complex detection kit based on CRISPR-Cas12a system

Also Published As

Publication number Publication date
CN112986551A (en) 2021-06-18
CN112986551B (en) 2022-09-27

Similar Documents

Publication Publication Date Title
CN116400066A (en) Method and kit for detecting concentration of target molecules in mixed system
Wei et al. An exonuclease I-based label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection with a wide concentration range
Niu et al. Aptamer assisted CRISPR-Cas12a strategy for small molecule diagnostics
US8247197B2 (en) Method of detecting target molecule by using aptamer
Cao et al. Naked-eye sensitive detection of nuclease activity using positively-charged gold nanoparticles as colorimetric probes
CN101208437A (en) Biosensors for detecting macromolecules and other analytes
US10208333B2 (en) Sequence conversion and signal amplifier DNA having locked nucleic acids and detection methods using same
CA2936157C (en) Covered sequence conversion dna and detection methods
US10041111B2 (en) Method for detecting and quantifying biomaterials by using activity of nucleic acid polymerase regulated by target material
US20220213540A1 (en) Novel probe set for isothermal one-pot reaction, and uses thereof
JPWO2007032359A1 (en) Target molecule detection method using aptamer-probe complex
JP6126381B2 (en) Target nucleic acid detection method and kit
Cheng et al. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification
US20110294125A1 (en) Colorimetric biosensor with allosteric dnazyme activation and rolling circle signal amplification
EP3237641A1 (en) Detection method based on signal amplifier dna cascade reactions with target extension
Park et al. A graphene oxide-based platform for the assay of RNA synthesis by RNA polymerase using a fluorescent peptide nucleic acid probe
Joo et al. Highly selective FRET-aided single-molecule counting of microRNAs labeled by splinted ligation
EP1668158B1 (en) Rna detection and quantitation
Zhang et al. Detection of DNA methyltransferase activity using allosteric molecular beacons
Wang et al. A sensitive immobilization-free electrochemical assay for T4PNK activity based on exonuclease III-assisted recycling
US20190161754A1 (en) Fluorescent biosensor for 2&#39;, 3&#39;-cgamp
KR20230063086A (en) Isothermal single reaction probe set for detection of severe acute respiratory syndrome coronavirus 2 and/or mutation thereof using a cleaved T7 promoter and use thereof
US20240117414A1 (en) Sequence conversion and signal amplifier dna having abasic nucleic acids, and detection methods using same
CN112608913B (en) Gene expression regulation and control system based on C2C2 and application thereof
US20060275854A1 (en) Method for monitoring reactions in real time

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination