CN116381221A - Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof - Google Patents

Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof Download PDF

Info

Publication number
CN116381221A
CN116381221A CN202310284426.3A CN202310284426A CN116381221A CN 116381221 A CN116381221 A CN 116381221A CN 202310284426 A CN202310284426 A CN 202310284426A CN 116381221 A CN116381221 A CN 116381221A
Authority
CN
China
Prior art keywords
aza
ucnps
detection
pad
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310284426.3A
Other languages
Chinese (zh)
Inventor
蔡燕雪
王际辉
蔡湘怡
蔡旭维
肖珊
王波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dongguan University of Technology
Original Assignee
Dongguan University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dongguan University of Technology filed Critical Dongguan University of Technology
Priority to CN202310284426.3A priority Critical patent/CN116381221A/en
Publication of CN116381221A publication Critical patent/CN116381221A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54366—Apparatus specially adapted for solid-phase testing
    • G01N33/54386—Analytical elements
    • G01N33/54387—Immunochromatographic test strips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G01N33/533—Production of labelled immunochemicals with fluorescent label
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54346—Nanoparticles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention discloses a preparation method of an up-conversion fluorescence chromatography test strip for detecting azaspiroacid (AZA), belonging to the fields of analytical chemistry, environment and food safety detection. The detection test paper comprises a sample pad, a combination pad, a nitrocellulose membrane, an absorption pad, a backboard, a detection line and a quality control line. According to the method, the up-conversion nano particles are utilized to improve the fluorescence intensity, the background signal is reduced, and meanwhile, the optical signal change of the detection line is realized by utilizing the conformational change of the nucleic acid aptamer, so that the AZA is rapidly and quantitatively detected. The test strip has short detection time, and can obtain experimental results within 15 minutes; the method has the advantages of simple operation, strong specificity and high sensitivity, and has important significance for AZA detection in marine shellfish.

Description

Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof
Technical Field
The invention relates to the technical fields of analytical chemistry, environment and food safety detection, in particular to up-conversion fluorescent chromatographic test paper for rapidly and quantitatively detecting azaspiro acid and a preparation method thereof.
Background
Along with the development of the human industrialization process, the eutrophication of the water body can cause the frequent occurrence of global ocean red tides, and harmful algae and related ocean algae toxins form serious threat to human health. The marine algae toxins are natural organic matters generated by toxic algae in the sea, and shellfish filters the toxic microalgae and then is converted into shellfish toxins through biological accumulation and amplification. These toxins accumulate in shellfish bodies and are eventually released in the bodies after being consumed by humans, causing the humans to develop corresponding food poisoning symptoms, such as vomiting, severe diarrhea, limb paralysis, severe death. Particularly, as people consume the edible shellfish for years, the occurrence of shellfish food poisoning events is more frequent, and the physical health and life safety of consumers are seriously endangered. Research on how to detect marine toxins efficiently has become a current focus of attention. At present, the traditional analysis technology cannot meet the market demand that shellfish foods quickly enter a dining table after fishing in terms of timeliness and portability, and the method brings new requirements for quick detection of shellfish toxins in aspects of detection speed, accuracy, portability and the like.
Azaspirocyclic acids (AZAs) are a class of lipophilic marine toxins with molecular masses of 716-902 Da, with more than 30 analogues produced by biotransformation of phytoplankton by shellfish or as by-products of AZAs contaminated shellfish after storage or cooking, AZA-1, AZA-2 and AZA-3 being the most common 3 AZA toxins. The identification problem of AZAs as a food safety is relatively new and the first human AZAs poisoning event was reported in the Netherlands in 1995. Currently, AZAs toxins have been detected in shellfish or marine organisms from the United states, japan, and China.
The traditional detection method of the AZAs comprises a mouse biological test method, a liquid chromatography-tandem mass spectrometry (liquid chromatography-tandem mass spectrometry, LC-MS/MS) and the like, and the LC-MS/MS has high specificity and sensitivity and is a reference method for analyzing the AZAs. Immunological-based analytical methods such as enzyme-linked immunoassay, immunosensor lateral chromatography, and the like rely on antibodies, and there are high synthesis costs and poor stability resulting in false positive or false negative results. While these methods can effectively provide accurate information for the detection of AZAs, most of the existing detection techniques require lengthy sample preparation and extraction procedures prior to sample analysis. Therefore, novel biological recognition molecules and detection methods with high sensitivity, strong specificity and simple operation are urgently needed in the current AZAs detection work, and are used for meeting the high development demands of rapid detection in the market.
The fluorescence chromatography technology is a sharp tool for instant detection, has the advantages of simple operation, visualization, friendly use for users and the like, and researchers develop various novel nano materials (up-conversion luminescent materials, quantum dots, carbon dots and the like) so as to improve the analysis performance of the traditional chromatography technology. The lanthanide doped up-conversion nano particles (Upconversion nanoparticles, UCNPs) can convert near infrared excitation into strong visible fluorescence emission due to the unique physicochemical properties of large Stokes displacement, high color purity, good chemical stability and the like, and have the advantages of avoiding background fluorescence and improving light stability.
The Aptamer (Aptamer) is a single-stranded DNA (ssDNA) or RNA molecule with a function similar to that of an antibody, is considered as a "chemical antibody" because of its sequence-specific target binding function, has the advantages of conformational change, high stability, specificity, uniform activity and the like, and has been widely focused on food safety detection and rapid detection of toxic and harmful small molecules. The synthesis feasibility of the aptamer makes the aptamer easy to modify and label, and provides excellent flexibility for the development of instant detection. Based on the rapid development of the aptamer analysis technology and the application in the food safety field, a new solution is provided for the detection technology of the small molecular toxin AZAs.
According to the invention, the up-conversion nano particles and the AZA-1 nucleic acid aptamer are used as raw materials, and the chromatographic test strip for rapidly detecting the AZA-1 is prepared, so that the AZA-1 detection method with higher sensitivity, high specificity and simple operation is obtained.
Disclosure of Invention
Aiming at least one defect of the prior art, the invention provides a preparation method and application of AZA-1 rapid detection test paper based on an up-conversion nano-probe formed by up-conversion nano-particles and an AZA-1 nucleic acid aptamer, and the advantages of fluorescent chromatography detection test paper, the nano-biological probe, the nucleic acid aptamer and the like are combined to prepare the AZA-1 detection test paper which is rapid, simple, convenient, high in sensitivity and strong in specificity and is applied to shellfish detection.
The technical scheme adopted by the invention is a preparation method of an up-conversion fluorescence chromatography test strip for detecting azaspiro acid, which comprises the following steps:
(1) Preparation of upconversion nanoparticles
Preparation of NaYF 4 Er, tm nanoparticle, mix 1mmol of chlorinated lanthanoid with 6mL of oleic acid and 15mL of octadeca-1-ene, put into 100mL of three-necked round bottom flask, slowly heat the mixture to 160 ℃, stir and keep for 30 minutes under argon atmosphere, form a uniform solution; cooling to room temperature; 4mmol of NaOH and NH 4 2.5mmol of HF was added dropwise to the methanol solution of F.and the mixture was slowly heated to 120℃under an argon atmosphere until methanol evaporated; the mixture was heated to 300℃and maintained at this temperature for 1.5 hours, cooled to room temperature and NaYF was precipitated with 10mL of acetone 4 Washing Er, tm nano-particles with ethanol, and re-dispersing the obtained UCNPs up-conversion nano-particles in cyclohexane;
(2)UCNPs@mSiO 2 preparation of nanoparticles
Taking 4mL UCNPs synthesized, washing with cyclohexane and centrifuging for 15 minutes; the precipitate was transferred to 40mL of CTAB solution while vigorously stirring for 30min; slowly heating the mixture to 85 ℃ while sonicating the solution and alternately shaking for dispersing UCNPs; adding 2mL of ammonia water into the mixture, and reacting for 15min; 8mL of ethanol and 0.64mL of tetraorthosilicate were addedEthyl ester TEOS is stirred vigorously and reacted at 70 ℃ for 5 hours; centrifuging to collect nano particles, washing the nano particles with ethanol for 3 times to collect products, and finally extracting the nano particles with a methanol-NaCl solution for 3 hours to remove a CTAB model; the ratio of the reaction substances is controlled to ensure that silicon dioxide grows on the surface of UCNPs regularly, thereby obtaining UCNPs@mSiO with different silicon dioxide thickness 2 A nanoparticle;
(3) Preparation of nano biological probe
Preparation of AZA-1 aptamer-UCNPs@mSiO by condensation reaction 2 A biological probe; modified UCNPs@mSiO 2 After centrifugation, 120. Mu.L of EDC at a concentration of 2mg/mL and 60. Mu.L of NHS at a concentration of 2mg/mL were added to activate the surface-modified carboxyl group, and the mixture was allowed to stand for 2 hours, 400. Mu.L of AZA-1 aptamer solution at a concentration of 2nmol/mL was added, and incubated overnight; centrifuging, collecting precipitate, washing with PBS, and collecting prepared AZA-1 up-conversion nano biological probe (A-UCNPs@mSiO) capable of specifically recognizing AZA-1 2 ) Re-suspending in Tris-HCl buffer solution for later use;
(4) The prepared A-UCNPs@mSiO in the step (3) is treated 2 Spraying 500 mu L-1mL of nano particles on glass fiber by a spray pad instrument, and drying at 40 ℃ for 12 hours to obtain the bonding pad
(5) And the end, close to the binding pad, of the nitrocellulose membrane is marked with a complementary strand of the AZA-1 aptamer modified by the incubated biotin and streptavidin, and the end, close to the absorption pad, is marked with the streptavidin to mark a quality control line.
(6) And sequentially overlapping the sample pad, the binding pad, the nitrocellulose membrane and the absorption pad on the PVC backboard to obtain the up-conversion fluorescence chromatography test strip for detecting azaspiro acid.
Preferably, the sample pad and the bonding pad are made of glass fibers, the sample pad has a size of 20mm×30cm, and the bonding pad has a size of 13mm×30cm.
Preferably, the AZA-1 specific aptamer sequence is as follows: 5'
-ATACCAGCTTATTCAATT-CGGTGAGTTAGACAAGCGCTTGCA-AGATAGTAAGTGCAATCT-3′。
Preferably, the 1mmol of chlorinated lanthanoid isYCl of 0.78mmol 3 0.2mmol YbCl 3 And 0.02mmol ErCl 3 。
The beneficial effects of the invention are as follows: (1) According to the method, the up-conversion nano particles are utilized to improve the fluorescence intensity, reduce the background signal, and meanwhile, the optical signal change of the detection line is realized by utilizing the conformational change of the nucleic acid aptamer, so that the AZA is sensitively and rapidly detected;
(2) The test paper detection card has short detection time for detecting AZA-1, and can obtain an experimental result within 15 minutes; the operation is simple, the specificity is strong, the sensitivity is high, and the on-site detection efficiency can be improved;
(3) The fluorescent quantitative instrument can be used for quantitative detection and analysis of AZA-1, and has important significance for AZA detection in marine shellfish.
Drawings
FIG. 1 is a schematic diagram of a test strip according to the present invention.
FIG. 2 shows the different fluorescence signals of AZA-1 according to the invention on NC membranes of 0-120 ng/L.
FIG. 3 is a photograph of an AZA-1 test card according to the present invention.
FIG. 4 shows the concentration of AZA-1H in different concentrations of AZA-1 of the present invention T /H C Values and CV values thereof.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments of the present invention. The components of the embodiments of the present invention generally described and illustrated in the figures herein can be arranged and designed in a wide variety of different configurations.
The technical scheme of the invention is as follows: an up-conversion fluorescence chromatography test paper for rapidly and quantitatively detecting azaspiro acid is adopted, and comprises a sample pad, a combination pad, a nitrocellulose membrane, an absorption pad, a PVC backboard, a detection line and a quality control line; the PVC backboard is sequentially stuck with a sample pad, a bonding pad, a nitrocellulose membrane and an absorption pad; and a detection line (T line) and a quality control line (C line) are sequentially arranged on the nitrocellulose membrane. The preparation process of the bonding pad comprises the following steps:firstly, preparing NaYF by adopting a solvothermal method 4 Er, tm up-conversion nano-particles (UCNPs), then the Stober method is used for modifying silicon dioxide on the surface of the UCNPs@mSiO to obtain the UCNPs@mSiO 2 . Then condensation reaction is used to form the functional AZA-1 aptamer-UCNPs@mSiO 2 A biological probe; wherein the AZA-1 specific aptamer sequence is: 5 'ATACCAGCTTATTATTATCATTCGGTGAGTTAGTTAGACAGCGCTTGCAAGATTAAGTGCAATCT-3'. The complementary strand of the AZA1 aptamer is modified by incubated biotin and streptavidin at one end of the nitrocellulose membrane near the binding pad to mark a T line, and streptavidin at the end near the absorption pad to mark a C line.
The preparation method of the up-conversion fluorescence chromatography test strip for rapidly and quantitatively detecting azaspiro acid comprises the following steps of:
(1) Preparation of upconversion nanoparticles
Preparation of NaYF 4 Er, tm nanoparticle, 1mmol of chlorinated lanthanoid, i.e. YCl 3 (0.78mmol)、YbCl 3 (0.2 mmol) and ErCl 3 (0.02 mmol) was mixed with oleic acid (6 mL) and octadec-1-ene (15 mL) and placed in a 100mL three-necked round bottom flask. The mixture was slowly heated to 160 ℃ and stirred under an argon atmosphere for 30 minutes to form a homogeneous solution. Cooling the mixture to room temperature; naOH (4 mmol) and NH 4 HF (2.5 mmol) was added dropwise to the methanol solution of F.and the mixture was slowly heated to 120℃under an argon atmosphere until methanol evaporated. Finally, the mixture was heated to 300 ℃ and held at this temperature for 1.5 hours. After cooling to room temperature, naYF was precipitated with acetone (10 mL) 4 Er, tm nanoparticles, washed 3 times with ethanol, the obtained up-converted nanoparticles (UCNPs) were redispersed in cyclohexane.
(2)UCNPs@mSiO 2 Preparation of nanoparticles
Synthetic UCNPs (4 mL) were taken, washed with cyclohexane and centrifuged for 15min. The precipitate was transferred to 40mL of CTAB solution while vigorously stirring for 30min. To remove cyclohexane, the mixture was slowly heated to 85 ℃ while sonicating the solution and alternately shaking for dispersing UCNPs. Subsequently, 2mL of ammonia was added to the mixture, and the reaction was carried out for 15min. 8mL of ethanol and 0.64mL of orthosilicic acid were addedTetraethyl Ester (TEOS) and vigorously stirred, and reacted at a temperature of 70 ℃ for 5 hours. The nanoparticles were collected by centrifugation, the product was collected by washing with ethanol 3 times, and finally the CTAB model was removed by extraction with methanol-NaCl solution for 3 h. The up-conversion nano particles (UCNPs@mSiO) with different silicon dioxide thicknesses are obtained by controlling the proportion of the reaction substances to ensure that silicon dioxide grows on the surface of UCNPs regularly 2 )。
(3) Preparation of nano biological probe
Preparation of AZA-1 aptamer-UCNPs@mSiO by condensation reaction 2 A biological probe. Modified UCNPs@mSiO 2 After centrifugation (12000 rpm,20 min), EDC (2 mg/mL, 120. Mu.L) and NHS (2 mg/mL, 60. Mu.L) were added to activate the surface modified carboxyl groups, and the mixture was allowed to stand for 2h, and AZA-1 aptamer solution (2 nmol/mL, 400. Mu.L) was added and incubated overnight. Centrifuging (15000 rpm,15 min), collecting precipitate, washing with PBS, and collecting the prepared A-UCNPs@mSiO 2 Resuspended in Tris-HCl buffer for use.
(4) Assembly of test card
The detection card based on the up-conversion nanoparticle-aptamer technology consists of five parts: sample pad, conjugate pad, nitrocellulose (NC) membrane, absorbent pad and PVC backing plate. Both the sample pad (20 mm. Times.30 cm) and the conjugate pad (13 mm. Times.30 cm) were made of glass fibers. The sample application pad was first blocked with blocking buffer (0.01M PBS (pH 7.4) containing 2% PEG6000,1% BSA and 2% Tween-20) and then dried overnight at 40 ℃. Spraying the nano particles with the required volume onto glass fibers by a spray pad instrument, and drying at 40 ℃ for 12 hours to obtain a bonding pad; sequentially overlapping the sample pad, the bonding pad, the NC film and the absorption pad on the PVC back plate to form a laminated structure (see figure 1), cutting the laminated structure into strips with the width of 4mm by using a slitter, assembling an AZA-1 detection card, and storing the AZA-1 detection card in a drying chamber for later use.
Detection principle and specific steps of AZA-1 rapid detection fluorescent test strip based on up-conversion nanoparticle-nucleic acid aptamer, firstly, nucleic Acid Aptamer (AA) with AZA-1 specificity and UCNPs@mSiO 2 Performing condensation reaction to obtain biological probe A-UCNPs@mSiO 2 . Two additional biotin-modified DNA sequences were designed: one is with AZA-1 nucleic acid aptamer partial complementary pairing, abbreviated as AT; the other is a 16A base sequence, abbreviated as AC. AT and AC are capable of partial complementary pairing with AA sequences on biological probes, respectively. After the labeled biotin on AT and AC is combined with streptavidin, the two DNA sequences can be respectively dispersed on a nitrocellulose membrane of test paper by a film spraying instrument to be used as marks of a detection line (T line) and a control line (C line) of the test paper. A-UCNPs@mSiO when no detection object exists due to the complementary effect of DNA sequences 2 The AA sequences on the sequence can be respectively complementary with AT and AC on the T line and the C line, UCNPs@mSiO 2 Is trapped on the two lines, and the near infrared light irradiates to see two detection signals. When there is a detection object, A-UCNPs@mSiO is generated due to the identification function of the aptamer to the detection object 2 The AA aptamer can be specifically combined with a detection object, the complementary effect of the AA aptamer and an AT sequence on a T line is hindered, but the complementary effect of 16A bases on a C line and 16T bases on the aptamer is not affected, so that the signal of the T line can be shallow or even vanished, and the signal of the C line is not affected. And reading the signal of the detection card by a fluorescence quantitative detector according to the difference of the T line signals before and after the detection object is added, and quantifying the fluorescence intensity, thereby calculating the content of AZA-1 in the sample.
Example 1: determination of AZA-1 Standard solution Using detection card
Firstly, preparing AZA-1 standard solutions with the concentrations of 0,1, 5, 10, 25, 50, 80 and 120ng/mL, detecting each concentration for 10 times by using a self-made detection card, detecting by using a fluorescence quantitative detector, and drawing a standard curve according to data collected by detection. The LoD value is equal to the average value of the blank samples detected using the azo-1 detection card plus 3 times the standard deviation.
As shown in fig. 2, different NC film locations on the test card show different fluorescent signal intensities, with the most intense signal being in the T-line area. The corresponding result can be visually observed in the test card (see fig. 3). Based on H T /H C The relative fluorescence intensity of the detection card decreased with increasing concentration of AZA-1, as shown in FIG. 4. Fig. 4 shows that under optimized parameters, this analysis method can yield reliable results. As a diagnostic shellfishThe standard for toxoids, AZA-1, requires high sensitivity for detection. The LoD value was determined to be 5.8ng/mL based on the calculation. Based on UCNPs@mSiO 2 The method for analyzing the fluorescent probe has excellent analysis performance and meets the LoD requirement of being applied to POCT detection.
Example 2: analysis of AZA-1 detection card Performance
(1) Specificity (specificity)
The specificity of the test card was evaluated by adding to real shellfish samples, AZA-1 samples without interferon as control, to AZA-1 samples at concentrations of 2.70ng/mL and 30.80ng/mL, respectively. Wherein the interferon is: halichondrin (6.00 ng/mL), saxitoxin 12.00 ng/mL) and euglena toxin (25.00 ng/mL).
As shown in Table 1, the specificity of the test card was evaluated using two different concentrations of AZA-1 to obtain reliable results. The results show that the relative deviation (Relative deviation, RD) of the detection cards after addition of halichondrin, saxitoxin and euglena toxin is within + -10%, indicating that the effect of interferon is not obvious, and the specificity of the detection cards to AZA-1 is high, indicating that the specificity of the technology is acceptable.
TABLE 1 Effect of different interferons on AZA-1 specificity
Figure BDA0004139229500000061
Note:RD＝(Value-Standard value)/Standard value
(2) Precision of
AZA-1 samples at three concentration levels (6.25, 20.15 and 50.60 ng/mL) were used to evaluate the precision of the test card. In the same batch, 30 detection cards are taken for detecting AZA-1 with different concentration levels, each concentration is detected by 10, data are recorded, and the precision of the measurement in the batch of the detection cards is evaluated by calculating a variation coefficient (coefficient of variation, CV).
For the precision of the measurement between batches, 3 sheets were randomly selected from each of three different batches of test cards for detecting one concentration of AZA-1, and the other two concentrations were similarly detected, and the data was recorded and CV was calculated.
The results are shown in Table 2, and the CV was calculated to be less than 5% for both the Intra-and Inter-batch measurement precision (Intra-assay precision) at AZA-1 concentrations of 6.25 and 20.15ng/mL, and less than 10% at AZA-1 concentrations of 50.60 ng/mL. The result shows that the immunochromatography technology shows good accuracy and is suitable for quantitative detection of AZA-1 on site.
Table 2 results of precision experiments with the azo-1 assay cards
Figure BDA0004139229500000071
(3) Stability of
In practical applications, stability is a very important parameter for performance analysis. In this work, the stability of the test card was studied by storage and acceleration tests, as follows: and assembling a batch of detection cards according to the optimized parameters, and storing the detection cards in a drying oven at 50 ℃. Test cards stored in a 50℃dry box were taken at days 7, 14 and 21, respectively, for detection of AZA-1 (1.0, 5.0, 10.0, 25.0 and 50.0 ng/mL), data were recorded, and the long term validity period of the test cards was evaluated by an accelerated test.
The results of the experiments are shown in Table 3, and it can be observed that the test card can show good performance on AZA-1 after a period of storage at 50 ℃, which indicates that the test card can still keep higher stability under the condition of higher temperature, and the test card has the performance of long-term normal-temperature storage.
TABLE 3 stability analysis of test cards
Figure BDA0004139229500000072
The foregoing has shown and described the basic principles and main features of the present invention and the advantages of the present invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims (4)

1. A preparation method of an up-conversion fluorescence chromatography test strip for detecting azaspiro acid is characterized by comprising the following steps of: the method comprises the following steps: (1) Preparation of upconversion nanoparticles
Preparation of NaYF 4 Er, tm nanoparticle, mix 1mmol of chlorinated lanthanoid with 6mL of oleic acid and 15mL of octadeca-1-ene, put into 100mL of three-necked round bottom flask, slowly heat the mixture to 160 ℃, stir and keep for 30 minutes under argon atmosphere, form a uniform solution; cooling to room temperature; 4mmol of NaOH and NH 4 2.5mmol of HF was added dropwise to the methanol solution of F.and the mixture was slowly heated to 120℃under an argon atmosphere until methanol evaporated; the mixture was heated to 300℃and maintained at this temperature for 1.5 hours, cooled to room temperature and NaYF was precipitated with 10mL of acetone 4 Washing Er, tm nano-particles with ethanol, and re-dispersing the obtained UCNPs up-conversion nano-particles in cyclohexane;
(2)UCNPs@mSiO 2 preparation of nanoparticles
Taking 4mL UCNPs synthesized, washing with cyclohexane and centrifuging for 15 minutes; the precipitate was transferred to 40mL of CTAB solution while vigorously stirring for 30min; slowly heating the mixture to 85 ℃ while sonicating the solution and alternately shaking for dispersing UCNPs; adding 2mL of ammonia water into the mixture, and reacting for 15min; 8mL of ethanol and 0.64mL of tetraethyl orthosilicate TEOS were added and stirred vigorously, and reacted at 70℃for 5 hours; centrifuging to collect nano particles, washing the nano particles with ethanol for 3 times to collect products, and finally extracting the nano particles with a methanol-NaCl solution for 3 hours to remove a CTAB model; the ratio of the reaction substances is controlled to ensure that silicon dioxide grows on the surface of UCNPs regularly, thereby obtaining UCNPs@mSiO with different silicon dioxide thickness 2 A nanoparticle;
(3) Preparation of nano biological probe
Preparation of AZA-1 nucleic acid by condensation reactionligand-UCNPs@mSiO 2 A biological probe; modified UCNPs@mSiO 2 After centrifugation, 120. Mu.L of EDC at a concentration of 2mg/mL and 60. Mu.L of NHS at a concentration of 2mg/mL were added to activate the surface-modified carboxyl group, and the mixture was allowed to stand for 2 hours, 400. Mu.L of AZA-1 aptamer solution at a concentration of 2nmol/mL was added, and incubated overnight; centrifuging, collecting precipitate, washing with PBS, and collecting prepared AZA-1 up-conversion nano biological probe (A-UCNPs@mSiO) capable of specifically recognizing AZA-1 2 ) Re-suspending in Tris-HCl buffer solution for later use;
(4) The prepared A-UCNPs@mSiO in the step (3) is treated 2 Spraying 500 mu L-1mL of nano particles on glass fiber by a spray pad instrument, and drying at 40 ℃ for 12 hours to obtain the bonding pad
(5) And the end, close to the binding pad, of the nitrocellulose membrane is marked with a complementary strand of the AZA-1 aptamer modified by the incubated biotin and streptavidin, and the end, close to the absorption pad, is marked with the streptavidin to mark a quality control line.
(6) And sequentially overlapping the sample pad, the binding pad, the nitrocellulose membrane and the absorption pad on the PVC backboard to obtain the up-conversion fluorescence chromatography test strip for detecting azaspiro acid.
2. The method for preparing the up-conversion fluorescence chromatography test strip for detecting azaspiro acid according to claim 1, wherein the method is characterized in that: the sample pad and the bonding pad are both made of glass fibers, the size of the sample pad is 20mm multiplied by 30cm, and the size of the bonding pad is 13mm multiplied by 30cm.
3. The method for preparing the up-conversion fluorescence chromatography test strip for detecting azaspiro acid according to claim 1, wherein the method is characterized in that: the AZA-1 specific aptamer sequence is as follows: 5'
-ATACCAGCTTATTCAATT-CGGTGAGTTAGACAAGCGCTTGCA-AGATAGTAAGTGCAATCT-3′。
4. The method for preparing the up-conversion fluorescence chromatography test strip for detecting azaspiro acid according to claim 1, wherein the method is characterized in that: said 1mmol of lanthanoid chlorideYCl with element of 0.78mmol 3 0.2mmol YbCl 3 And 0.02mmol ErCl 3 。
CN202310284426.3A 2023-03-21 2023-03-21 Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof Pending CN116381221A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310284426.3A CN116381221A (en) 2023-03-21 2023-03-21 Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310284426.3A CN116381221A (en) 2023-03-21 2023-03-21 Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof

Publications (1)

Publication Number Publication Date
CN116381221A true CN116381221A (en) 2023-07-04

Family

ID=86960808

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310284426.3A Pending CN116381221A (en) 2023-03-21 2023-03-21 Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof

Country Status (1)

Country Link
CN (1) CN116381221A (en)

Similar Documents

Publication Publication Date Title
Bhardwaj et al. Fluorescent nanobiosensors for the targeted detection of foodborne bacteria
Majdinasab et al. Aptamer-based assays and aptasensors for detection of pathogenic bacteria in food samples
Wu et al. Magnetic nanobead-based immunoassay for the simultaneous detection of aflatoxin B1 and ochratoxin A using upconversion nanoparticles as multicolor labels
CN103940792B (en) A kind of method simultaneously detecting three kinds of food-borne pathogens based on polychrome up-conversion fluorescent marking
Nakamura et al. Fluorometric sensing of biogenic amines with aggregation‐induced emission‐active tetraphenylethenes
Chai et al. A novel electrochemiluminescence strategy for ultrasensitive DNA assay using luminol functionalized gold nanoparticles multi-labeling and amplification of gold nanoparticles and biotin–streptavidin system
CN101321686A (en) Multiple component nanoparticles for multiplexed signaling and optical encoding
CN105372213B (en) A method of based on luminescence resonance energy transfer detection ochratoxin A between up-conversion luminescence nanomaterial and gold nanorods
Wang et al. Sensitive detection of Salmonella with fluorescent bioconjugated nanoparticles probe
CN102023147A (en) Method for detecting ochratoxin A by magnetic separation of aptamer-functionalized magnetic nano material and marking of up-conversion fluorescent nano material
CN110308289B (en) Aminoglycoside antibiotic multi-residue simultaneous rapid fluorescence detection reagent and application thereof
CN102978295B (en) Pathogenic microorganism nucleic acid amplification-free detection and typing method
Hu et al. Optical biosensing of bacteria and bacterial communities
Qi et al. Multivalent glycosylated Cu: CdS quantum dots as a platform for rapid bacterial discrimination and detection
Zheng et al. Rapid and selective detection of Bacillus cereus in food using cDNA-based up-conversion fluorescence spectrum copy and aptamer modified magnetic separation
CN109402128B (en) Aflatoxin B1The aptamer of (a), and aflatoxin B containing the aptamer1Detection kit and detection method
CN110411990B (en) Method for detecting hydrogen peroxide and related target object based on nano probe
Wang et al. Multiple functionalities of functional nucleic acids for developing high-performance lateral flow assays
Zhuang et al. Immunofluorescent-aggregation assay based on anti-Salmonella typhimurium IgG-AuNCs, for rapid detection of Salmonella typhimurium
Jiang et al. A dual-labeled fluorescence quenching lateral flow assay based on one-pot enzyme-free isothermal cascade amplification for the rapid and sensitive detection of pathogens
CN110553991B (en) Biological/chemical detection reagent and detection method based on hollow gold nanoparticle-DNA compound
JP4434015B2 (en) Chemiluminescence enhancer
CN116381221A (en) Up-conversion fluorescence chromatography test paper for detecting azaspiro acid and preparation method thereof
CN116765387A (en) Preparation method of DNA nanoflower in-situ synthesis gold nanocluster and manganese metal organic framework fluorescent aptamer sensor
US20200132675A1 (en) Multiplexed instrument-free bar-chart spinchip integrated with nanoparticle-mediated aptasensors for visual quantitative detection of multiple pathogens

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination