CN116376968A - Recombinant vector for rice grain weight gain, recombinant bacterium, construction method and application of recombinant vector - Google Patents

Abstract

The invention provides a recombinant vector for rice grain weight gain, recombinant bacteria, a construction method and application thereof, wherein the recombinant vector for rice grain weight gain comprises GS1 after fixed-point editing; 3 genome, the GS1 after site-directed editing; 3 the genome comprises a gRNA sequence base, wherein the gRNA sequence base is GS1;3 from base 954 to 974 of the genome: AATTCAGGGTTGGTGGTACT. The recombinant vector for rice grain weight gain provided by the invention uses GS1;3, on the basis of genome, the genome is directionally edited by utilizing the genetic engineering technology means, and the obtained transgenic material can obviously increase the grain shape, improve the grain weight and have obvious yield increasing effect on the premise of not influencing the normal nutrition growth of rice, thereby providing a new rice yield increasing means for crop breeding work.

Description

Recombinant vector for rice grain weight gain, recombinant bacterium, construction method and application of recombinant vector

Technical Field

The invention relates to the technical field of gene editing, in particular to a recombinant vector for rice grain weight gain, recombinant bacteria, a construction method and application thereof.

Background

Rice is a major food source of nearly half of the population worldwide, and how to continuously improve rice yield from a biological perspective has been an important item in the field of crop science research. In the past decades, the traditional breeding method plays a great role in improving the rice yield, but with the continuous growth of the world population, the cultivation of rice varieties which are friendly to the environment and save resources is urgently needed, so that the sustainable development of agriculture and grain safety are realized. Modern molecular breeding based on CRISPR/Cas9 gene editing technology is lifting a wave of crop improvement due to the advantages of simplicity, high efficiency, short breeding period and the like. The development of modern molecular breeding is based on the excavation of high-quality important character genes, and the deep research of biological functions and genetic effects of the important character genes.

Important applications of CRISPR/Cas9 gene editing technology in rice genetic improvement mainly comprise: the rice yield, the quality, herbicide resistance, disease and insect resistance and the like. Wherein the three factors influencing the rice yield are the effective spike number of a single plant, the solid grain number of each spike and the grain weight. Grain Weight (TGW) is the most reliable indicator, and is generally expressed in thousand grains (1000-grain weight). The grain weight is mainly determined by grain size and fullness. The grain shape is determined by grain length (grain length), grain width (grain width), and grain thickness (grain thickness). Grain length and grain width become one of the main selection indexes for yield breeding. At present, some reported genes for regulating grain length and grain width of rice include GS3, GS5, GW2, GW5, GW7, GW8 and the like, but the genes are far from enough for crop breeding work, and no safe pillow for grain safety can be realized.

Disclosure of Invention

Based on this, it is necessary to provide a recombinant vector, recombinant bacteria, construction method and application thereof for rice grain weight gain in view of at least one of the problems mentioned above.

In a first aspect, the present application provides a recombinant vector for rice grain weight gain, the base plasmid comprising site-directed editing GS1;3 genome, the site-directed editing GS1;3 the genome comprises a gRNA sequence base, wherein the gRNA sequence base is GS1;3 from base 954 to 973 of the genome: AATTCAGGGTTGGTGGTACT.

In a second aspect, the present application provides a method for constructing a recombinant vector for rice grain weight gain, comprising the steps of:

the design of CRISPR/Cas9 target site, positioning GS1 through gene network tool; 3, target sites of the genome are obtained, so that GS1 for site-directed editing is obtained; 3 genome; GS1 of the fixed-point editing; 3, the base target site of the gRNA sequence of the genome is GS1;3 from base 954 to 973 of the genome: AATTCAGGGTTGGTGGTACT;

constructing a CRISPR/Cas9 vector, taking rice pCRISPR-U3 plasmid DNA as a template, and obtaining U3-GS1 connected into sgRNA by an overlapping PCR method; 3-sgRNA fragments;

extracting the recombinant vector, and extracting the U3-GS1; the 3-sgRNA fragment is connected to a pCXUN-Cas9 carrier, and the connection product is used for transforming escherichia coli DH5 alpha competent cells by a heat shock method to obtain clones; extracting the cloning plasmid to obtain pCXUN-Cas9-GS1;3 vector.

In certain implementations of the second aspect, in the step of constructing the CRISPR/Cas9 vector, the U3-GS1 linked to the sgRNA is obtained by an overlap PCR method; the steps of the 3-sgRNA fragment include:

taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-F and the U3-R to obtain a first PCR product;

taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-R and the U3-F to obtain a second PCR product;

mixing the obtained first PCR product and the second PCR product as templates, and carrying out PCR amplification by using the primers U3-F and U3-R to obtain a third PCR product;

purifying and recycling the third PCR product to obtain the U3-GS1;3-sgRNA fragment.

With reference to the second aspect and the foregoing implementation manner, in certain implementation manners of the second aspect, a gene sequence of the primer is:

GS1；3-gRNA-F：AATTCAGGGTTGGTGGTACTgttttagagctagaaatagcaagtta；

GS1；3-gRNA-R：AGTACCACCAACCCTGAATTgccacggatcatctgcacaac；

capital letters shown in the above sequence are GS1 after fixed-point editing; 3, the vector sequence of the rice pCRISPR-U3 plasmid DNA is shown in lower case.

With reference to the second aspect and the foregoing implementation manner, in certain implementation manners of the second aspect, the gene sequences of the U3-R and the U3-F are:

U3-F：CCCCTTTCGCCAGGGGTACCGTAATTCATCCAGGTCTCCAAG；

U3-R：TACGAATTCGAGCTCGGTACCGCTGTGCCGTACGACGGTACG。

in a third aspect, the present application provides a method for constructing a recombinant bacterium for rice grain weight gain, using a recombinant vector as described in the first aspect of the present application, comprising the steps of: and transforming the recombinant vector into an agrobacterium tumefaciens EHA105 strain by a heat shock method to obtain the recombinant strain for rice grain weight gain.

In certain implementations of the third aspect, the step of transforming the recombinant vector with an agrobacterium tumefaciens EHA105 strain by heat shock comprises:

taking out the agrobacteria competent cells from the preservation environment at the temperature of minus 80 ℃, adding the recombinant vector after thawing, and placing on ice for 30min to obtain bacterial liquid;

placing the centrifuge tube into liquid nitrogen, freezing for 5min, placing into water bath at 37deg.C for 5min, taking out, rapidly inserting into ice for 2min, adding liquid LB culture medium, and shake culturing at 28deg.C for 3 hr;

sucking the bacterial liquid, uniformly coating the bacterial liquid on a solid LB plate containing the kanamycin and the rifampicin, and culturing the bacterial liquid in an incubator at 28 ℃ for 48 hours;

the monoclonal was picked up in liquid LB medium containing kanamycin and rifampicin and cultured in a shaker at 28℃for 24h.

In a fourth aspect, the present application provides the use of a recombinant vector for rice grain weight gain in rice grain weight gain.

The technical scheme provided by the embodiment of the invention has the following beneficial technical effects:

the recombinant vector for rice grain weight gain provided by the invention uses GS1;3, on the basis of genome, the genome is directionally edited by utilizing the genetic engineering technology means, and the obtained transgenic material can obviously increase the grain shape, improve the grain weight and have obvious yield increasing effect on the premise of not influencing the normal nutrition growth of rice, thereby providing a new rice yield increasing means for crop breeding work.

Additional aspects and advantages of the present application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Drawings

FIG. 1 is a schematic flow chart of a method for constructing a recombinant vector for rice grain weight gain according to an embodiment of the invention;

FIG. 2 shows rice GS1 according to an embodiment of the present invention; 3 construction of the gene, GS1;3 is located between the rice 3 rd chromosome genome sequence sites 28826521 and 28822405;

FIG. 3 is a view of directed editing of rice GS1 based on CRISPR/Cas9 technology in accordance with one embodiment of the present invention; 3, gene map;

FIG. 4 is a view of directed editing of rice GS1 by CRISPR/Cas9 technology in accordance with one embodiment of the present invention; 3, comparing the protein sequence obtained by the gene with the protein sequence of a wild non-transformed material ZH11, wherein the protein sequence represents a stop codon;

FIG. 5 shows a wild-type untransformed material ZH11 and a transgenic material gs1 according to an embodiment of the present invention; 3-1, a plant type comparison graph;

FIG. 6 shows a wild-type untransformed material ZH11 and a transgenic material gs1 according to an embodiment of the present invention; 3-1, seed grain shape comparison plot;

FIG. 7 shows a wild-type untransformed material ZH11 and a transgenic material gs1 according to an embodiment of the present invention; 3-1 (data are expressed as mean ± standard deviation (n=10), t-test, < P <0.01, < P < 0.05).

Detailed Description

In order that the invention may be readily understood, a more complete description of the invention will be rendered by reference to the appended drawings. The figures show possible embodiments of the invention. This invention may, however, be embodied in many different forms and is not limited to the embodiments described herein with reference to the accompanying drawings. The embodiments described by reference to the drawings are exemplary for a more thorough understanding of the present disclosure and should not be construed as limiting the present invention. Furthermore, if detailed descriptions of known techniques are unnecessary for the illustrated features of the present invention, such technical details may be omitted.

It will be understood by those skilled in the relevant art that all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs unless defined otherwise. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

As used herein, the singular forms "a", "an", "the" and "the" are intended to include the plural forms as well, unless expressly stated otherwise, as understood by those skilled in the art. It will be further understood that the terms "comprises" and/or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. It should be understood that the term "and/or" as used herein includes all or any element and all combination of one or more of the associated listed items.

The following describes the technical solution of the present invention and how the technical solution solves the technical problems described above with specific examples.

The embodiment of the first aspect of the application provides a recombinant vector for rice grain weight gain, wherein the basic plasmid comprises GS1 edited at fixed point; 3 genome, the site-directed editing GS1;3, the genome comprises a base target site of a gRNA sequence, wherein the base target site of the gRNA sequence is GS1;3 from base 954 to 973 of the genome: AATTCAGGGTTGGTGGTACT.

In the research process aiming at the rice grain weight, a candidate gene GS1 possibly involved in rice grain filling is found; 3, rice GS1; see fig. 2, gs1 for a block diagram of the 3 gene; 3 is located between the rice 3 rd chromosome genome sequence sites 28826521 and 28822405. The genomic DNA sequence of the gene was then obtained on a website RGAP (http:// price. Plan. Msu. Edu/index. Shtml), and the gene editing targeting site of the gene was found using an on-line website gene tool (http:// CRISPR. Hzau. Edu. Cn/CRISPR /) developed by the national emphasis laboratories of crop genetic improvement at agricultural university in China, with the targeting site sequence AATTCAGGGTTGGTGGTACT. A section was then synthesized against GS1;3 editing the required specific guide RNA (gRNA) sequence. In the invention, the rice GS1 is directionally edited based on CRISPR/Cas9 technology; the 3 gene is shown in FIG. 3.

The recombinant vector for rice grain weight gain provided by the invention uses GS1;3, on the basis of genome, the genome is directionally edited by utilizing the genetic engineering technology means, and the obtained transgenic material can obviously increase the grain shape, improve the grain weight and have obvious yield increasing effect on the premise of not influencing the normal nutrition growth of rice, thereby providing a new rice yield increasing means for crop breeding work.

The embodiment of the second aspect of the present application specifically provides a method for constructing a recombinant vector for rice grain weight gain, as shown in fig. 1, comprising the following steps:

s100: the design of CRISPR/Cas9 target site, positioning GS1 through gene network tool; 3, target sites of the genome are obtained, so that GS1 for site-directed editing is obtained; 3 genome; GS1 of the fixed-point editing; 3, the base target site of the gRNA sequence of the genome is GS1;3 from base 954 to base 973 of the genome, specifically: AATTCAGGGTTGGTGGTACT. GS1 for site-directed editing; 3 genome and GS1 before processing by gene network tools; 3, the genome is the same, only the target site of the base of the gRNA sequence needing to be edited at fixed point is searched out by the tool, and the target site of the base of the gRNA sequence is subjected to conversion treatment.

S200: constructing a CRISPR/Cas9 vector, taking rice pCRISPR-U3 plasmid DNA as a template, and obtaining U3-GS1 connected into sgRNA by an overlapping PCR method; 3-sgRNA fragment.

S300: extracting the recombinant vector, and extracting the U3-GS1; the 3-sgRNA fragment is connected to a pCXUN-Cas9 carrier, and the connection product is used for transforming escherichia coli DH5 alpha competent cells by a heat shock method to obtain clones; extracting the cloning plasmid to obtain pCXUN-Cas9-GS1;3 vector.

Optionally, in certain implementations of the second aspect, in the step of constructing the CRISPR/Cas9 vector of S200, the U3-GS1 linked to the sgRNA is obtained by an overlap PCR method; the steps of the 3-sgRNA fragment include:

taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-F and the U3-R to obtain a first PCR product;

taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-R and the U3-F to obtain a second PCR product;

mixing the obtained first PCR product and the second PCR product as templates, and carrying out PCR amplification by using the primers U3-F and U3-R to obtain a third PCR product;

purifying and recycling the third PCR product to obtain the U3-GS1;3-sgRNA fragment.

Optionally, with reference to the embodiment of the second aspect and the foregoing implementation manner, in some implementation manners of the second aspect, a gene sequence of the primer is:

GS1；3-gRNA-F：AATTCAGGGTTGGTGGTACTgttttagagctagaaatagcaagtta；

GS1；3-gRNA-R：AGTACCACCAACCCTGAATTgccacggatcatctgcacaac；

capital letters shown in the above sequence are GS1 after fixed-point editing; 3, the vector sequence of the rice pCRISPR-U3 plasmid DNA is shown in lower case.

With reference to the second aspect and the foregoing implementation manner, in certain implementation manners of the second aspect, the gene sequences of the U3-R and the U3-F are:

U3-F：CCCCTTTCGCCAGGGGTACCGTAATTCATCCAGGTCTCCAAG；

U3-R：TACGAATTCGAGCTCGGTACCGCTGTGCCGTACGACGGTACG。

an embodiment of the third aspect of the present application provides a method for constructing a recombinant bacterium for rice grain weight gain, using a recombinant vector as described in the first aspect of the present application, comprising the steps of: and transforming the recombinant vector into an agrobacterium tumefaciens EHA105 strain by a heat shock method to obtain the recombinant strain for rice grain weight gain.

Optionally, in certain implementations of the third aspect, the step of transforming the recombinant vector with an agrobacterium tumefaciens EHA105 strain by heat shock method includes:

taking out the agrobacteria competent cells from the preservation environment at the temperature of minus 80 ℃, adding the recombinant vector after thawing, and placing on ice for 30min to obtain bacterial liquid;

placing the centrifuge tube into liquid nitrogen, freezing for 5min, placing into water bath at 37deg.C for 5min, taking out, rapidly inserting into ice for 2min, adding liquid LB culture medium, and shake culturing at 28deg.C for 3 hr;

sucking the bacterial liquid, uniformly coating the bacterial liquid on a solid LB plate containing the kanamycin and the rifampicin, and culturing the bacterial liquid in an incubator at 28 ℃ for 48 hours;

the monoclonal was picked up in liquid LB medium containing kanamycin and rifampicin and cultured in a shaker at 28℃for 24h.

The embodiment of the fourth aspect of the application provides an application of the recombinant vector for rice grain weight gain in rice grain weight gain.

The following are specific examples:

1. CRISPR/Cas9-GS1;3 obtaining genetically engineered bacteria of the vector

Step 1: design of CRISPR/Cas9 target site

The invention utilizes the online website (http:// CRISPR. Hzau. Edu. Cn/CRISPR /) developed by the national key laboratory for genetic improvement of crops in China agricultural university to design a target site sequence of a target gene, and synthesizes a section of target gene aiming at GS1;3, a specific guide RNA (gRNA) sequence pair GS1 required for editing; 3, performing fixed-point editing, wherein the base of the gRNA sequence is as follows: AATTCAGGGTTGGTGGTACT (+954 bp to +973bp, base 954 to 973 of the GS1;3 genome, see SEQ NO. 1).

Step 2: construction of CRISPR/Cas9 vectors

1. By designing corresponding gRNA primers (GS 1;3-gRNA-F and GS1; 3-gRNA-R), obtaining U3-GS1 connected into the sgRNA by an overlap PCR method by taking rice pCRISPR-U3 plasmid DNA (provided by national key laboratories for genetic improvement of crops at university of agricultural in China) as a template; 3-sgRNA fragment.

The specific operation is as follows:

(1) taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-F+U3-R to obtain a first PCR product (about 348bp in size);

(2) taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-R+U3-F to obtain a second PCR product (about 463bp in size);

(3) mixing the obtained first PCR product and the second PCR product, and performing PCR amplification by using a primer U3-F+U3-R as a template to obtain a third PCR product 3 (with the size of about 811 bp);

(4) purifying and recycling the PCR product 3 to obtain U3-GS1;3-sgRNA fragment.

As shown in fig. 4, which shows the directed editing of rice GS1 by CRISPR/Cas9 technology; 3, comparing the protein sequence obtained by the gene with the protein sequence of the wild non-transformed material ZH 11.

The specific primer sequences are as follows:

GS1；3-gRNA-F：AATTCAGGGTTGGTGGTACTgttttagagctagaaatagcaagtta

GS1；3-gRNA-R：AGTACCACCAACCCTGAATTgccacggatcatctgcacaac

capital letters shown in the above sequence are editing GS1;3, the vector sequence of the rice pCRISPR-U3 plasmid DNA is shown in lower case.

U3-F：CCCCTTTCGCCAGGGGTACCGTAATTCATCCAGGTCTCCAAG

U3-R：TACGAATTCGAGCTCGGTACCGCTGTGCCGTACGACGGTACG

2. U3-GS1 as described above; the 3-sgRNA fragment was ligated to pCXUN-Cas9 vector (supplied by national emphasis laboratories for genetic improvement of crops at university of agriculture) and the ligation product was transformed into E.coli DH 5. Alpha. Competent cells by heat shock to obtain clones. Extracting cloning plasmid, detecting positive cloning by PCR sequencing, and preserving positive plasmid to obtain pCXUN-Cas9-GS1;3 vector.

Step 3: recombinant bacterium acquisition

Recombinant vector pCXUN-Cas9-GS1;3, transforming the agrobacterium tumefaciens EHA105 strain by a heat shock method to obtain recombinant bacteria. Extracting plasmid of recombinant bacteria, sequencing, and naming positive recombinant bacteria containing the plasmid as CRISPR/Cas9-GS1;3.

the agrobacterium heat shock transformation method comprises the following specific steps:

(1) taking out Agrobacterium competent cells from a refrigerator at-80 ℃, and placing the Agrobacterium competent cells on ice to melt for 5min;

(2) adding 10 μl plasmid (operating on a clean bench), and placing on ice for 30min;

(3) placing the centrifuge tube into liquid nitrogen and freezing for 5min;

(4) placing the centrifuge tube in a water bath at 37 ℃ for 5min;

(5) taking out the centrifuge tube, rapidly inserting into ice for 2min, adding 500 mu L of liquid LB culture medium (sterile), and shake culturing at 28 ℃ and 150rpm for 3h;

(6) mu.L of the bacterial liquid was pipetted and spread evenly on a solid LB plate containing 50. Mu.g/mL of calicheamicin and 50. Mu.g/mL of rifampicin, and incubated in an incubator at 28℃for 48h.

(7) The monoclonal was picked up and cultured in LB liquid medium containing 50. Mu.g/mL of calicheamicin and 50. Mu.g/mL of rifampicin at 28℃for 1 day in a 200rpm shaker.

2. Obtaining transgenic Rice

Step 1 selection of the transformation receptor

Removing the shells of seeds of a mature rice variety Zhonghua 11 (ZH 11), sterilizing the surfaces of the seeds, inoculating the seeds to an induction culture medium, and carrying out dark induction culture at 28 ℃ for 30 days; then selecting embryogenic callus with compact and pale yellow structure for subculture, and performing dark culture at 28 ℃ for about 15 days; neonatal, hard callus was selected for use as the recipient of transformation.

Step 2 genetic transformation of Rice

The specific method comprises the following steps: EHA105/CRISPR/Cas9-GS1;3, infecting rice callus by the strain, and co-culturing for 2 days at 19 ℃; the calli were washed with sterile water for 10 times and transferred to hygromycin-added screening medium for culture, and resistant calli were screened. Transferring the selected resistant callus to a differentiation medium, and differentiating for about 40 days under the illumination condition of 28 ℃ to obtain a resistant transgenic plant; and then rooting and hardening off. And finally, taking out the transgenic seedlings, washing off the residual culture medium on the roots, and transplanting the transgenic seedlings into soil. Thus, T0 generation transgenic rice is obtained.

For more details, reference was made to the Agrobacterium-mediated efficient rice genetic transformation method (Lin YJ, zhang Q.optiming the tissue culture conditions for high efficiency transformation of indica rice plant Cell Reports,2005, 23:540-547), with minor modifications.

3. Identification of the type of mutation at the target site

Step 1 identification of transgenic Positive plants

After the T0 generation transgenic rice is transplanted into a field, after the transgenic rice is turned green, the transgenic rice is singly separated, leaves are taken out to extract DNA, and a PCR method is used for detecting transgenic positive plants by taking the genomic DNA as a template. The amplified fragment is pCXUN-Cas9-GS1;3 vector sequence, the size is about 500 bp.

The primer sequences were as follows:

Cas9-F:GCATGAAGAGGATCGAGGAG

Cas9-R:GATCTCTTGCTCGGACTTGG

the PCR amplification procedure was as follows: 95℃2min,95℃30s,55℃30s,68℃1min,30 cycles, 68℃5min. Identifying CRISPR/Cas9-GS1 by directly detecting PCR products through electrophoresis; 3 transgenic positive plants.

Step 2 identification of transgenic Positive plants

(1) In GS1; about 250bp each was taken before and after the 3 genomic gRNA region, and primers were designed for PCR amplification.

The primer sequences were as follows:

gs1；3-F：CTGAATCATCATCAATTCCT(+796bp～+816bp)

gs1；3-R：ATCAGTGTAATGCACACACA(+1276bp～+1296bp)

the PCR amplification procedure was as follows: 95℃2min,95℃30s,55℃30s,68℃1min,30 cycles, 68℃5min.

(2) Mutation sites and mutation types were detected by direct sequencing of the PCR products.

As shown in fig. 3, GS1 edited by aligning wild-type untransformed material ZH11 and CRISPR/Cas 9; 3 DNA sequence of transgenic material we identified a mutant type of transgenic material designated gs1;3-1 (4 bp base deletion, see SEQ NO. 2). As shown in fig. 4, and GS1 of wild-type material; 3 protein sequence alignment found that normal protein encoded 370 amino acids, whereas gs1;3-1 material GS1;3, encoding 33 amino acids.

4. GS1;3 functional deficiency leads to increase of rice grain shape

Subsequently, wild-type untransformed material ZH11 and transgenic material gs1 were compared; 3-1, and agronomic character indexes such as the growth condition of plants, the grain weight, the size and the like of mature seeds. The results show that gs1 is compared to ZH11 as shown in fig. 5; the 3-1 material is normal in the vegetative growth period (including plant height, plant type, flowering time, spike number of single plant and the like). Through examination of thousand kernel weight, as shown in fig. 6 and 7, gs1 is compared with ZH 11; the thousand grain weight of the 3-1 material is obviously increased, and the grain length of seeds is also obviously increased.

The seed particle weight and particle shape were determined as follows:

thousand grain weight determination: 200 full seeds were randomly selected and weighed, converted to thousand weight, repeated 10 times, and averaged.

Measurement of grain length and grain width: randomly selecting 10 groups of 10 seeds from each single plant, arranging the 10 seeds in each group according to end-to-end connection, measuring the length by using a vernier caliper, and repeatedly taking an average value for 3 times to obtain the grain length; the 10 seeds are closely arranged in a row side by side without overlapping, the width is measured, and the average value is obtained after 3 times of repeated averaging.

Those of skill in the art will appreciate that the various operations, methods, steps in the flow, actions, schemes, and alternatives discussed in the present application may be alternated, altered, combined, or eliminated. Further, other steps, means, or steps in a process having various operations, methods, or procedures discussed in this application may be alternated, altered, rearranged, split, combined, or eliminated. Further, steps, measures, schemes in the prior art with various operations, methods, flows disclosed in the present application may also be alternated, altered, rearranged, decomposed, combined, or deleted.

The terms "first," "second," and the like, are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include one or more such feature. In the description of the present application, unless otherwise indicated, the meaning of "a plurality" is two or more.

In the description of the present specification, a particular feature, structure, material, or characteristic may be combined in any suitable manner in one or more embodiments or examples.

It should be understood that, although the steps in the flowcharts of the figures are shown in order as indicated by the arrows, these steps are not necessarily performed in order as indicated by the arrows. The steps are not strictly limited in order and may be performed in other orders, unless explicitly stated herein. Moreover, at least some of the steps in the flowcharts of the figures may include a plurality of sub-steps or stages that are not necessarily performed at the same time, but may be performed at different times, the order of their execution not necessarily being sequential, but may be performed in turn or alternately with other steps or at least a portion of the other steps or stages.

The foregoing is only a partial embodiment of the present application, and it should be noted that, for a person skilled in the art, several improvements and modifications can be made without departing from the principle of the present application, and these improvements and modifications should also be considered as the protection scope of the present application.

Claims (8)

1. A recombinant vector for rice grain weight gain, which is characterized in that a basic plasmid comprises GS1 edited at fixed points; 3 genome, the site-directed editing GS1;3, the genome comprises a base target site of a gRNA sequence, wherein the base target site of the gRNA sequence is GS1;3 from base 954 to 973 of the genome:

AATTCAGGGTTGGTGGTACT。

2. the construction method of the recombinant vector for rice grain weight gain is characterized by comprising the following steps:

the design of CRISPR/Cas9 target site, positioning GS1 through gene network tool; 3, target sites of the genome are obtained, so that GS1 for site-directed editing is obtained; 3 genome; GS1 of the fixed-point editing; 3, the base target site of the gRNA sequence of the genome is GS1;3 from base 954 to 973 of the genome: AATTCAGGGTTGGTGGTACT;

constructing a CRISPR/Cas9 vector, taking rice pCRISPR-U3 plasmid DNA as a template, and obtaining U3-GS1 connected into sgRNA by an overlapping PCR method; 3-sgRNA fragments;

extracting the recombinant vector, and extracting the U3-GS1; the 3-sgRNA fragment is connected to a pCXUN-Cas9 carrier, and the connection product is used for transforming escherichia coli DH5 alpha competent cells by a heat shock method to obtain clones; extracting the cloning plasmid to obtain pCXUN-Cas9-GS1;3 vector.

3. The method of constructing a recombinant vector for rice grain weight gain according to claim 2, wherein in the step of constructing the CRISPR/Cas9 vector, U3-GS1 linked to sgRNA is obtained by an overlap PCR method; the steps of the 3-sgRNA fragment include:

taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-F and the U3-R to obtain a first PCR product;

taking pCRISPR-U3 plasmid DNA as a template and a primer GS1; performing PCR amplification on the 3-gRNA-R and the U3-F to obtain a second PCR product;

mixing the obtained first PCR product and the second PCR product as templates, and carrying out PCR amplification by using the primers U3-F and U3-R to obtain a third PCR product;

purifying and recycling the third PCR product to obtain the U3-GS1;3-sgRNA fragment.

4. The method for constructing a recombinant vector for rice grain weight gain according to claim 3, wherein the gene sequence of the primer is:

GS1；3-gRNA-F：AATTCAGGGTTGGTGGTACTgttttagagctagaaatagcaagtta；

GS1；3-gRNA-R：AGTACCACCAACCCTGAATTgccacggatcatctgcacaac；

capital letters shown in the above sequence are GS1 after fixed-point editing; 3, the vector sequence of the rice pCRISPR-U3 plasmid DNA is shown in lower case.

5. The method for constructing recombinant vectors for rice grain weight gain according to claim 3, wherein the gene sequences of U3-R and U3-F are:

U3-F：CCCCTTTCGCCAGGGGTACCGTAATTCATCCAGGTCTCCAAG；

U3-R：TACGAATTCGAGCTCGGTACCGCTGTGCCGTACGACGGTACG。

6. a method for constructing recombinant bacteria for rice grain weight gain, which is characterized by adopting the recombinant vector as claimed in claim 1, comprising the following steps: and transforming the recombinant vector into an agrobacterium tumefaciens EHA105 strain by a heat shock method to obtain the recombinant strain for rice grain weight gain.

7. The method for constructing a recombinant strain for rice grain weight gain according to claim 6, wherein the step of transforming the recombinant vector with agrobacterium tumefaciens EHA105 strain by a heat shock method comprises:

taking out the agrobacteria competent cells from the preservation environment at the temperature of minus 80 ℃, adding the recombinant vector after thawing, and placing on ice for 30min to obtain bacterial liquid;

placing the centrifuge tube into liquid nitrogen, freezing for 5min, placing into water bath at 37deg.C for 5min, taking out, rapidly inserting into ice for 2min, adding liquid LB culture medium, and shake culturing at 28deg.C for 3 hr;

sucking the bacterial liquid, uniformly coating the bacterial liquid on a solid LB plate containing the kanamycin and the rifampicin, and culturing the bacterial liquid in an incubator at 28 ℃ for 48 hours;

the monoclonal was picked up in liquid LB medium containing kanamycin and rifampicin and cultured in a shaker at 28℃for 24h.

8. The use of the recombinant vector for rice grain weight gain according to claim 1 in rice grain weight gain.

Images