CN116348497B

CN116348497B - Antibodies against AXL and uses thereof

Info

Publication number: CN116348497B
Application number: CN202380000021.0A
Authority: CN
Inventors: 孝作祥; 彭佳萍; 周东文; 周炜
Original assignee: Zhejiang Shimai Pharmaceutical Co ltd
Current assignee: Zhejiang Shimai Pharmaceutical Co ltd
Priority date: 2023-01-05
Filing date: 2023-01-05
Publication date: 2023-11-17
Anticipated expiration: 2043-01-05
Also published as: CN116348497A

Abstract

Disclosed herein are monoclonal antibodies to AXL, bispecific antibodies to AXL and CD3, nucleic acids comprising said antibodies, vectors comprising said nucleic acids, and host cells comprising said nucleic acids or said vectors. Pharmaceutical compositions and antibody-drug conjugates comprising the antibodies, and methods of treatment using the antibodies are also disclosed.

Description

Antibodies against AXL and uses thereof

Technical Field

The present invention relates to antibodies directed against AXL, and the use of such antibodies, in particular their use in the treatment of cancer.

Background

AXL is a member of the TAM (Tyro 3-AXL-Mer) Receptor Tyrosine Kinase (RTK) sharing the vitamin K dependent ligand GAS6 (growth arrest-specific 6). The AXL gene is cloned from human Chronic Myelogenous Leukemia (CML) cells, in which it encodes a 140KDa protein with transforming capacity. The protein structure of AXL contains two immunoglobulin-like domains (Ig) and two fibronectin III domains in the extracellular region, a single transmembrane domain and an intracellular protein-tyrosine kinase domain. In contrast to most receptor tyrosine kinases, germline inactivation of TAM receptors does not lead to embryonic lethality. Aged Tyro3-AXL-Mertk triple knockout mice can develop a variety of degenerative diseases associated with the inability of phagocytes to clear apoptotic cells and cell membranes in the adult reproductive system, retinal system, and immune system. Analysis of germ line Gas6 and AXL deficient mice indicated that Gas6/AXL signaling plays an important role in platelet aggregation and vascular integrity in the liver. Platelet aggregation ability from mice lacking Gas6 or any of the TAM receptors (including Axl) is impaired. Although Gas6, AXL, tyro3 or Mertk deficient mice do not bleed under physiological conditions, these mice do not form life threatening thrombi. GAS6/TAM signaling on platelets activates PI3K/AKT signaling to stimulate tyrosine phosphorylation of β3 integrin and to amplify outside-in signaling via αiibβ3 to promote platelet activation and aggregation. Furthermore, GAS6 and AXL are both expressed by endothelial cells that regulate vascular permeability in the liver.

Most AXL signaling occurs in a GAS 6-mediated ligand-dependent manner. Activating mutations within the AXL kinase domain are rare in cancer (cancer genomic profile, TCGA). In cancer, AXL signaling can be activated by GAS6 in an autocrine or paracrine manner. Clinically, GAS6 expression in tumor specimens is a poor prognostic factor for urothelial cancer, ovarian cancer, lung adenocarcinoma, gastric cancer and glioblastoma. The focus of the last decade of research has been to elucidate the functional role of GAS6/AXL signaling in the tumor microenvironment and to determine the molecular mechanisms by which GAS6/AXL signaling promotes tumor progression.

Axl receptor overexpression has been detected in a wide range of solid tumors and myeloid leukemias (Linger et al, adv Cancer Res.100:35,2008; linger et al, expert Opin Ther targets.14:1073,2010). Axl expression is associated with malignancy progression and is an independent predictor of poor overall survival for a variety of malignant patients including: pancreatic cancer (Song et al, cancer.117:734,2011), prostate cancer (Paccez et al, oncogene.32:698,2013), lung cancer (Ishikawa et al, ann Surg Oncol.2012; zhang et al, nat Genet.44:852,2012), breast cancer (Gjerdrum, proc natl Acad Sci USA107:1124,2010), colon cancer (Yuen et al, PLoS One, 8:54211, 2013) and Acute Myeloid Leukemia (AML) (Ben-Batala et al, blood 122:2443, 2013).

Clinical and preclinical studies indicate that AXL has important roles in tumor progression, metastasis and drug resistance. These findings present an interesting possibility that therapeutic targeting of AXL could be an effective anticancer strategy. AXL is an attractive therapeutic target because most AXL signaling occurs in a ligand-dependent manner mediated by GAS 6. In cancer, GAS6/AXL signaling can be activated in an autocrine or paracrine fashion by tumor cells as well as cells within the tumor microenvironment (including macrophages and endothelial cells derived from biologically relevant GAS6 production). This allows the development of several classes of AXL inhibitors, including inhibitors that neutralize GAS6, target AXL receptors, or inhibit AXL tyrosine kinase activity.

Summary of The Invention

The present disclosure provides novel antibodies targeting AXL or antigen binding fragments thereof, which may be in the form of monoclonal antibodies or bispecific antibodies, such as bispecific T cell adaptors (bites). The antibodies disclosed herein are capable of binding to human AXL with high affinity, mediating killing of effector cells against target cells expressing AXL (e.g., various cancer cells), and thus exhibit strong anti-tumor activity.

In one aspect, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds AXL comprising a light chain variable region (VL) and a heavy chain variable region (VH), wherein

(i) VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:52-54, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:57-59, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(ii) VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:62-64, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO: HCDR 1-3 of the amino acid sequence designated 67-69; or alternatively

(iii) VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:2-4, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:7-9, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(iv) VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:12-14, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:17-19, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(v) VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:22-24, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:27-29, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(vi) VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:32-34, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:37-39, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(vii) VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:42-44, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:47-49, and HCDR 1-3 of the amino acid sequence shown in seq id no.

In some embodiments of the antibodies or antigen binding fragments thereof disclosed herein,

(i) VL comprises a sequence identical to SEQ ID NO:51 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and VH comprises an amino acid sequence that is identical to SEQ ID NO:56 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or alternatively

(ii) VL comprises a sequence identical to SEQ ID NO:61 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:66 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iii) VL comprises a sequence identical to SEQ ID NO:71 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:72 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iv) VL comprises a sequence identical to SEQ ID NO:73 has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and VH comprises an amino acid sequence that is identical to SEQ ID NO:74 having an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity;

(v) VL comprises a sequence identical to SEQ ID NO:1, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:6 having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or alternatively

(vi) VL comprises a sequence identical to SEQ ID NO:11, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:16 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or alternatively

(vii) VL comprises a sequence identical to SEQ ID NO:21, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:26, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(viii) VL comprises a sequence identical to SEQ ID NO:31, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:36, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(ix) VL comprises a sequence identical to SEQ ID NO:41, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:46 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, (i) VL comprises the amino acid sequence set forth in SEQ ID NO:51 and VH comprises the amino acid sequence shown as SEQ ID NO:56, an amino acid sequence shown in seq id no; or (ii) VL comprises the amino acid sequence as set forth in SEQ ID NO:61 and VH comprises the amino acid sequence shown as SEQ ID NO:66, an amino acid sequence shown in seq id no; or (iii) VL comprises the amino acid sequence as set forth in SEQ ID NO:71 and VH comprises the amino acid sequence shown as SEQ ID NO:72, an amino acid sequence shown in seq id no; or (iv) VL comprises the amino acid sequence as set forth in SEQ ID NO:73 and VH comprises the amino acid sequence shown as SEQ ID NO:74, an amino acid sequence shown in seq id no; or (v) VL comprises the amino acid sequence as set forth in SEQ ID NO:1 and VH comprises the amino acid sequence shown as SEQ ID NO:6, an amino acid sequence shown in figure 6; or (vi) VL comprises the amino acid sequence as set forth in SEQ ID NO:11 and VH comprises the amino acid sequence shown as SEQ ID NO:16, and a polypeptide comprising the amino acid sequence shown in seq id no; or (vii) VL comprises the amino acid sequence as set forth in SEQ ID NO:21 and VH comprises the amino acid sequence shown as SEQ ID NO:26, and a polypeptide comprising the amino acid sequence shown in seq id no; or (viii) VL comprises the amino acid sequence as set forth in SEQ ID NO:31 and VH comprises the amino acid sequence set forth in SEQ ID NO:36, and a nucleotide sequence shown in seq id no; or (ix) VL comprises the amino acid sequence as set forth in SEQ ID NO:41 and VH comprises the amino acid sequence shown as SEQ ID NO: 46.

In some embodiments, the antibody is an isotype selected from IgG, igA, igM, igE and IgD. In some embodiments, the antibody is of a subtype selected from the group consisting of IgG1, igG2, igG3, and IgG 4.

In some embodiments, the antigen binding fragment is selected from the group consisting of Fab, fab ', F (ab') ₂ Fv, scFv and ds-scFv.

In some embodiments, the antibody is a monoclonal antibody. In some embodiments, an antibody comprises (i) a light chain comprising a sequence identical to SEQ ID NO:55, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:60 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(ii) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:65, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:70, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iii) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:5, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:10, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iv) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:15, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:20, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(v) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:25, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:30, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(vi) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:35, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:40 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(vii) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:45, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:50 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In other embodiments, the antibody is a bispecific antibody or a multispecific antibody. In some embodiments, the antibody is a bispecific antibody further comprising a second antigen binding region that binds to a second antigen. In some embodiments, the second antigen is a tumor-associated antigen or an immune cell antigen. In some embodiments, the second antigen is a T cell antigen. In some embodiments, the T cell antigen is selected from the group consisting of T Cell Receptor (TCR), CD3, CD4, CD8, CD16, CD25, CD28, CD38, CD44, CD62L, CD69, ICOS, 41-BB (CD 137), and NKG2D, or any combination thereof.

In some embodiments, the second antigen is CD3, and the second antigen-binding region comprises a VL and a VH, wherein the VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:76-78, and said VH comprises LCDR 1-3 having an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR 1-3 of the amino acid sequence shown in the specification.

In some embodiments, the second antigen binding region comprises a VL comprising a sequence identical to SEQ ID NO:75, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ id no:80 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity. In some embodiments, the second antigen binding region comprises a VL comprising the amino acid sequence set forth in SEQ ID NO:75, and said VH comprises an amino acid sequence as set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In some embodiments, the VL of the second antigen binding region is optionally linked to the C-terminus of the VL of the antibody that specifically binds AXL via a first linker, and the VH of the second antigen binding region is optionally linked to the C-terminus of the VH of the antibody that specifically binds AXL via a second linker, wherein the first linker and the second linker are the same or different.

In some embodiments, each of the first and second linkers independently comprises a sequence selected from the group consisting of SEQ id nos: 87 and SEQ ID NO: 88. In some embodiments, the first linker comprises the amino acid sequence as set forth in SEQ ID NO:87, and the second linker comprises the amino acid sequence set forth in SEQ ID NO:88, and a sequence of amino acids shown in seq id no.

In some embodiments, the bispecific antibody comprises (i) a light chain comprising a sequence identical to SEQ ID NO:79, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ id no:84 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or (ii) a light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:85, said heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ id no:86, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the bispecific antibody is a bispecific T cell adapter (BiTE).

In another aspect, the present disclosure provides a bispecific antibody, or antigen-binding fragment thereof, comprising a first antigen-binding region comprising VL and VH that binds AXL and a second antigen-binding region comprising VL and VH that binds CD3,

wherein:

(i) The VL of the first antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:52-54, and the VH of the first antigen binding region comprises an LCDR 1-3 having the amino acid sequence of SEQ id no:57-59, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(ii) The VL of the first antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:62-64, and the VH of the first antigen binding region comprises an LCDR 1-3 having the amino acid sequence as set forth in SEQ id no:67-69, HCDR 1-3 of an amino acid sequence shown; or alternatively

(iii) The VL of the first antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:2-4, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ id no:7-9, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(iv) The VL of the first antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:12-14, and the VH of the first antigen binding region comprises an LCDR 1-3 having an amino acid sequence as set forth in SEQ id no:17-19, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(v) The VL of the first antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:22-24, and the VH of the first antigen binding region comprises an LCDR 1-3 having an amino acid sequence as set forth in SEQ id no:27-29, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(vi) The VL of the first antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:32-34, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ id no:37-39, HCDR 1-3 of an amino acid sequence shown in seq id no; or alternatively

(vii) The VL of the first antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:42-44, and the VH of the first antigen binding region comprises an LCDR 1-3 having an amino acid sequence as set forth in SEQ ID NO:47-49, HCDR 1-3 of an amino acid sequence shown in seq id no;

and wherein

The VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ id no:81-83, and HCDR 1-3 of the amino acid sequence shown in seq id no.

In some embodiments of the bispecific antibodies or antigen-binding fragments thereof disclosed herein, (i) the VL of the first antigen-binding region comprises a sequence identical to SEQ ID NO:51 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and the VH of the first antigen binding region comprises an amino acid sequence that is identical to SEQ ID NO:56 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or (ii) the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:61 has an amino acid sequence having a percent sequence identity of at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, and the VH of the first antigen binding region comprises an amino acid sequence that is identical to SEQ ID NO:66 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or (iii) the VL of the first antigen binding region comprises a sequence having a sequence identical to SEQ ID NO:71 has an amino acid sequence having a percent sequence identity of at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100%, and the VH of the first antigen binding region comprises an amino acid sequence that is identical to SEQ ID NO:72 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or (iv) the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:73, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:74 having an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or (v) the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:1, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:6 having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or (vi) the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:11, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:16 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or (vii) the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:21, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:26, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; and (viii) the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:31, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:36, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or (ix) the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:41, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:46 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ ID NO:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, 100% sequence identity.

In some embodiments, (i) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:51, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:56, an amino acid sequence shown in seq id no; or (ii) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:61, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:66, an amino acid sequence shown in seq id no; or (iii) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:71, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:72, an amino acid sequence shown in seq id no; or (iv) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:73, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:74, an amino acid sequence shown in seq id no; or (v) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:1, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:6, an amino acid sequence shown in figure 6; or (vi) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:11, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:16, and a polypeptide comprising the amino acid sequence shown in seq id no; or (vii) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:21, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:26, and a polypeptide comprising the amino acid sequence shown in seq id no; or (viii) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:31, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:36, and a nucleotide sequence shown in seq id no; or (ix) the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:41, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:46, and a nucleotide sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75, and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In some embodiments, the VL of the second antigen binding region is optionally linked to the C-terminus of the VL of the first antigen binding region via a first linker, and the VH of the second antigen binding region is optionally linked to the C-terminus of the VH of the first antigen binding region via a second linker, wherein the first linker and the second linker are the same or different.

In some embodiments, the bispecific antibody comprises (i) a light chain comprising a sequence identical to SEQ ID NO:79, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ id no:84 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or (ii) a light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:85, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:86 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In yet another aspect, the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof disclosed herein or a bispecific antibody or antigen-binding fragment thereof disclosed herein.

In another aspect, the present disclosure provides a vector comprising a nucleic acid disclosed herein.

In another aspect, the present disclosure provides a host cell comprising a nucleic acid disclosed herein or a vector disclosed herein.

In another aspect, the present disclosure provides a pharmaceutical composition comprising (i) an antibody or antigen-binding fragment thereof disclosed herein, or a bispecific antibody or antigen-binding fragment thereof disclosed herein, and (ii) a pharmaceutically acceptable carrier or excipient.

In some embodiments of the pharmaceutical compositions disclosed herein, the pharmaceutical composition further comprises a second therapeutic agent. In some embodiments, the second therapeutic agent may be selected from antibodies, chemotherapeutic agents, and small molecule drugs. In some embodiments, the second therapeutic agent may be selected from the group consisting of a Bruton's Tyrosine Kinase (BTK) inhibitor, PI3K inhibitor, HDAC inhibitor, ERK inhibitor, MAPK inhibitor, PD-1/PD-L1 inhibitor, LAG3 inhibitor, CTLA-4 inhibitor, TIGIT inhibitor, TIM3 inhibitor, VEGF inhibitor, and glucocorticoid.

In yet another aspect, the present disclosure provides a conjugate comprising an antibody or antigen-binding fragment thereof disclosed herein or a bispecific antibody or antigen-binding fragment thereof disclosed herein, and a chemical moiety conjugated thereto.

In some embodiments of the conjugates disclosed herein, the chemical moiety may be selected from the group consisting of a therapeutic agent, a detectable moiety, and an immunostimulatory molecule.

In another aspect, the present disclosure provides a method of treating cancer in a subject comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein.

In some embodiments of the methods disclosed herein, the cancer is an AXL positive cancer. In some embodiments, the cancer is selected from leukemia, lymphoma, myeloma, fibrosarcoma, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, colon cancer, colorectal cancer, melanoma, and liver cancer.

In some embodiments, the method further comprises administering a second therapeutic agent to the subject. In some embodiments, the second therapeutic agent is selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs. In some embodiments, the second therapeutic agent is selected from the group consisting of a Bruton's Tyrosine Kinase (BTK) inhibitor, PI3K inhibitor, HDAC inhibitor, ERK inhibitor, MAPK inhibitor, PD-1/PD-L1 inhibitor, LAG3 inhibitor, CTLA-4 inhibitor, TIGIT inhibitor, TIM3 inhibitor, VEGF inhibitor, and glucocorticoid.

In another aspect, the present disclosure provides the use of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein in the manufacture of a medicament for treating cancer in a subject.

In another aspect, the present disclosure provides an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein for use in treating cancer in a subject.

In some embodiments of the uses disclosed herein, the cancer is an AXL positive cancer. In some embodiments, the cancer is selected from leukemia, lymphoma, myeloma, fibrosarcoma, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, colon cancer, colorectal cancer, melanoma, and liver cancer. In some embodiments, an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein is combined with a second therapeutic agent. In some embodiments, the second therapeutic agent is selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs. In some embodiments, the second therapeutic agent is selected from the group consisting of a Bruton's Tyrosine Kinase (BTK) inhibitor, PI3K inhibitor, HDAC inhibitor, ERK inhibitor, MAPK inhibitor, PD-1/PD-L1 inhibitor, LAG3 inhibitor, CTLA-4 inhibitor, TIGIT inhibitor, TIM3 inhibitor, VEGF inhibitor, and glucocorticoid.

Drawings

An appreciation of the features and advantages of the present invention can be obtained by reference to the following detailed description that makes use of exemplary embodiments of the principles of the invention, and the accompanying drawings, in which:

FIG. 1A shows the binding of an anti-AXL chimeric mAb of the invention to recombinant human AXL as measured by ELISA.

FIG. 1B shows the binding of the anti-AXL chimeric mAbs of the invention to recombinant human AXL as measured by ELISA.

FIG. 2A shows the ability of an anti-AXL chimeric mAb of the invention to block interactions between AXL and GAS 6.

FIG. 2B shows the ability of the anti-AXL chimeric mAbs of the invention to block interactions between AXL and GAS 6.

FIG. 3 shows the binding of the anti-AXL chimeric mAbs of the invention to various tumor cell lines as measured by flow cytometry.

FIG. 4 shows the binding of the anti-AXL chimeric mAbs of the invention to HT1080 cell lines as measured by flow cytometry.

FIG. 5A shows ADCC killing of target cells HT1080 by AXL-mab-Ch-B1L and AXL-mab-Ch-C5 in the presence of Jurkat-CD16a-NFAT cells as effector cells.

FIG. 5B shows ADCC killing by AXL-mab-Ch-B1L and AXL-mab-Ch-C5 in the absence of target cell HT 1080.

FIG. 6A shows the binding of AXL-B1L-Hu1-LLG HBiTE to human recombinant AXL protein as measured by ELISA.

FIG. 6B shows the binding of AXL-B1L-Hu1-LLG HBiTE to human recombinant CD3 protein as measured by ELISA.

FIG. 7A shows the binding of AXL-C5-Hu1-LLG-1.2HBiTE to human recombinant AXL protein as measured by ELISA.

FIG. 7B shows the binding of AXL-C5-Hu1-LLG-1.2HBiTE to human recombinant CD3 protein as measured by ELISA.

FIG. 8A shows the binding of AXL-B1L-Hu1-LLG HBiTE to double-target human recombinant AXL and CD3 proteins as measured by bridging ELISA.

FIG. 8B shows the binding of AXL-C5-Hu1-LLG-1.2HBiTE to double-target human recombinant AXL and CD3 proteins as measured by bridging ELISA.

FIG. 9 shows the binding of AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE to HT1080 cell lines as measured by flow cytometry.

FIG. 10 shows an in vitro T cell activation assay for AXL-B1L-Hu1-LLG HBiTE.

FIG. 11 shows killing of HT1080 cells by AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE in the presence of human PBMC.

FIG. 12A shows the inhibition of tumor growth in B-NDG mice by 300 μg/kg of AXL-C5-Hu1-LLG-1.2 HBiTE. PBS was administered to the control group.

FIG. 12B shows the inhibition of tumor growth in B-NDG mice by 300 μg/kg of AXL-B1L-Hu1-LLG HBiTE. PBS was administered to the control group.

Detailed Description

The above features and advantages of the present invention and additional features and advantages thereof will be more clearly understood from the following detailed description of embodiments taken in conjunction with the accompanying drawings.

The embodiments described herein with reference to the drawings are illustrative, exemplary, and are intended for a general understanding of the present invention. The embodiments should not be construed as limiting the scope of the invention. The same or similar elements and elements having the same or similar functions are denoted by the same reference numerals throughout the specification.

Unless otherwise indicated or defined, all terms used have the ordinary meaning in the art as would be apparent to one of ordinary skill. For example, reference is made to standard manuals, such as Leuenberger, H.G.W, nagel, B.and Klbl, H.eds., "Amultilingual glossary of biotechnological terms (IUPAC Recommendations)", helvetica Chimica Acta (1995), CH-4010Basel, switzerland; sambrook et al, "Molecular Cloning: ALaboratory Manual" (2 nd Ed.), vols.1-3,Cold Spring Harbor Laboratory Press (1989); ausubel et al eds., "Current protocols in molecular biology", green Publishing and Wiley InterScience, new York (1987); roitt et al, "Immunology (6 th Ed.), mosby/Elsevier, edinburgh (2001); and Janeway et al, "immunology" (6 th Ed.), garland Science Publishing/Churchill Livingstone, new York (2005), and the general background art cited above.

As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an antibody" includes a plurality of antibodies and, in some embodiments, reference to "an antibody" includes a plurality of antibodies, and so forth.

Unless otherwise indicated or defined, the terms "comprises," "comprising," and variations thereof such as "comprises" and "comprising" are to be understood to imply the inclusion of a stated element or step or group of elements or steps but not the exclusion of any other element or step or group of elements or steps.

As used herein, the term "antibody" refers to an immunoglobulin molecule that has the ability to specifically bind to a particular antigen. Antibodies typically comprise a variable region and a constant region in each of the heavy and light chains. The variable regions of the heavy and light chains of antibodies contain binding domains that interact with the antigen. The constant region of an antibody may mediate the binding of an immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and components of the complement system such as C1q (the first component of the classical pathway of complement activation). Thus, most antibodies have a heavy chain variable region (VH) and a light chain variable region (VL) that together form the part of the antibody that binds to an antigen.

The "light chain variable region" (VL) or "heavy chain variable region" (VH) consists of "framework" regions separated by three "complementarity determining regions" or "CDRs". The framework regions are used to align CDRs that specifically bind to an epitope. CDRs include amino acid residues in antibodies that are primarily responsible for antigen binding. The VL domain and VH domain both comprise the following Framework (FR) and CDR regions from amino-to carboxy-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. CDR1, CDR2, and CDR3 of the VL domain are also referred to herein as LCDR1, LCDR2, and LCDR3, respectively; CDR1, CDR2, and CDR3 of the VH domain are also referred to herein as HCDR1, HCDR2, and HCDR3, respectively.

The amino acid arrangement of each VL domain and VH domain is consistent with any conventional definition of CDRs. Conventional definitions include the Kabat definition (Kabat, sequences of Proteins of Immunological Interest (National Institutes of Health, bethesda, MD,1987 and 1991)), the Chothia definition (Chothia and Lesk, J. Mol. Biol.196:901-917,1987; chothia et al, nature342:878-883, 1989); chothia Kabat CDR, wherein CDR-H1 is a complex of Chothia CDR and Kabat CDR; abM definition used by Oxford Molecular antibody modeling software; CONTACT definition by Martin et al (world wide web bioinfo. Org. Uk/abs). Kabat provides a widely used numbering convention (Kabat numbering system) in which corresponding residues between different heavy chains or between different light chains are given the same number. The present disclosure may use CDRs defined according to any of these numbering systems, but preferred embodiments use Kabat-defined CDRs.

As used herein, the term "antibody" is to be understood in its broadest sense and includes monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, antibody fragments, and multispecific antibodies (e.g., bispecific antibodies) that contain at least two antigen-binding regions. Antibodies may contain additional modifications such as non-naturally occurring amino acids, mutations in the Fc region, and mutations in glycosylation sites. Antibodies also include post-translationally modified antibodies, fusion proteins comprising an epitope of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site, so long as the antibodies exhibit the desired biological activity.

As used herein, the term "antigen-binding fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind an antigen (e.g., AXL protein). It has been shown that the antigen binding function of an antibody can be performed by fragments of full length antibodies.

Examples of antigen binding fragments encompassed by the term "antigen binding portion" of an antibody include: (i) A Fab fragment, a monovalent fragment consisting of VL, VH, CL and CH1 domains; (ii) F (ab') ₂ A fragment comprising a bivalent fragment of two Fab fragments linked by a disulfide bond at the hinge region; (iii) Fab' fragments, which are essentially Fab with a partial hinge region; (iv) Fd fragment consisting of VH and CH1 domains; (v) Fd' fragments having VH and CH1 domains and one or more cysteine residues at the C-terminus of the CH1 domain; (vi) Fv fragment consisting of VL and VH domains of the antibody single arm; (vii) a dAb fragment consisting of a VH domain; (viii) individual Complementarity Determining Regions (CDRs); (ix) Nanobodies, heavy chain variable regions containing a single variable domain and two constant domains. Furthermore, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they can be joined, using recombinant methods, by a synthetic linker, enabling them to form a single protein chain, in which the VL and VH regions pair to form monovalent molecules, known as single chain Fv (scFv). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. In addition, the term also includes "linear antibodies" comprising a pair of tandem Fd fragments (VH-CH 1-VH-CH 1) that are complementary to a light chain polypeptide And any modified form of the foregoing fragments that retain antigen binding activity together form an antigen binding region.

These antigen binding fragments can be obtained using conventional techniques known to those skilled in the art and the fragments screened for utility in the same manner as whole antibodies.

As used herein, the term "binding" or "specific binding" refers to a non-random binding reaction between two molecules, such as an antibody and its target antigen. The binding specificity of an antibody may be determined based on affinity and/or avidity. Affinity is expressed by the equilibrium constant (KD) for antigen-to-antibody dissociation, a measure of the strength of binding between an epitope and the antigen binding site of an antibody: the smaller the value of KD, the stronger the binding strength between the epitope and the antibody. Alternatively, affinity can also be expressed as an affinity constant (KA), which is 1/KD.

Avidity is a measure of the strength of binding between an antibody and the associated antigen. Avidity relates to the affinity between an epitope and the antigen binding site of an antibody and the number of relevant binding sites present on the antibody. Typically, an antibody will bind an antigen with the following dissociation constants (KD): 10 ^-5 M to 10 ^-12 M or less, and preferably 10 ^-7 M to 10 ^-12 M or less, and more preferably 10 ^-8 M to 10 ^-12 M, and/or bind antigen with the following binding affinities: at least 10 ⁷ M ^-1 Preferably at least 10 ⁸ M ^-1 More preferably at least 10 ⁹ M ^-1 Such as at least 10 ¹² M ^-1 . Generally considered to be any greater than 10 ^-4 K of M _D Values represent non-specific binding. Specific binding of an antibody to an antigen or antigenic determinant can be determined in any known suitable manner, including, for example, scatchard analysis and/or competitive binding assays, such as Radioimmunoassays (RIA), enzyme Immunoassays (EIA) and sandwich competition assays, as well as different variants thereof known in the art.

The term "epitope" refers to the site on an antigen to which an antibody binds. Epitopes can be formed by contiguous amino acids or by tertiary folded juxtaposition of non-contiguous amino acids of one or more proteins. Epitopes formed by consecutive amino acids (also referred to as linear epitopes) are typically retained in exposure to denaturing solvents, whereas epitopes formed by tertiary folding (also referred to as conformational epitopes) are typically lost in treatment with denaturing solvents. Epitopes typically comprise at least 3, more typically at least 5 or 8-10 amino acids in a unique spatial conformation. The epitope defines the smallest binding site of an antibody and is therefore a specific target for the antibody or antigen binding fragment thereof.

As used herein, the term "sequence identity" refers to the degree to which two sequences (amino acids) have identical residues at identical positions after alignment. For example, "amino acid sequence and SEQ ID NO: y is X% identical "means that the amino acid sequence is identical to SEQ ID NO: y and is set forth as X% of the residues in the amino acid sequence being identical to SEQ ID NO: residues of the sequences disclosed in Y are identical.

Such calculations are typically performed using a computer program. Exemplary procedures for comparing and aligning pairs of sequences include ALIGN (Myers and Miller, 1988), FASTA (Pearson and Lipman,1988; pearson, 1990), gapped BLAST (Altschul et al, 1997), BLASTP, BLASTN, or GCG (Devereux et al, 1984).

Furthermore, in determining the degree of sequence identity between two amino acid sequences, the skilled artisan may consider so-called "conservative" amino acid substitutions, which may generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue having a similar chemical structure, which have little or no effect on the function, activity, or other biological properties of the polypeptide. Such conservative amino acid substitutions are well known in the art.

Such conservative substitutions are preferably substitutions in which one amino acid in the following groups (a) to (e) is substituted by another amino acid residue in the same group: (a) small aliphatic, non-polar or weakly polar residues: ala, ser, thr, pro and Gly; (b) Polar, negatively charged residues and (uncharged) amides: asp, asn, glu and Gln; (c) polar, positively charged residues: his, arg and Lys; (d) large aliphatic, nonpolar residues: met, leu, he, val and Cys; and (e) an aromatic residue: phe, tyr and Trp.

Particularly preferred conservative substitutions are as follows: ala to Gly or to Ser; arg to Lys; asn to Gln or to His; asp to Glu; cys to Ser; gln to Asn; glu to Asp; gly to Ala or to Pro; his to Asn or to Gln; lie to Leu or to Val; leu to Ile or to Val; lys to Arg, to gin, or to Glu; met to Leu, to Tyr or to Ile; phe to Met, to Leu, or to Tyr; ser to Thr; thr to Ser; trp to Tyr; tyr to Trp; and/or Phe to Val, to Ile or to Leu.

As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population of antibodies. That is, each antibody that makes up the population is identical except for a small number of mutations that may occur naturally. Monoclonal antibodies are highly specific and directed against a single antigen. The term "monoclonal antibody" herein is not limited to antibodies produced by hybridoma technology, nor should it be construed as requiring antibodies produced by any particular method.

The term "bispecific antibody" is in the context of the present invention to be understood as an antibody having two different antigen binding regions defined by different antibody sequences. This is understood to be binding to different targets, but also includes binding to different epitopes of one target.

As used herein, the term "tumor-associated antigen" refers to an antigen that is differentially expressed in cancer cells as compared to normal cells, and thus can be used to target cancer cells.

As used herein, the term "CD3" refers to a human CD3 protein complex having 5 peptide chains, a gamma chain, a delta chain, an epsilon chain, a zeta chain, and a eta chain, and associating with T cell receptors alpha and beta chains to form a TCR-CD3 complex. The term includes any CD3 variant, subtype and species homolog that may be expressed naturally by cells including T cells or by cells transfected with a gene or cDNA encoding the above chain.

As used herein, the term "dual-specific T cell adapter" or "BiTE" refers to a polypeptide chain molecule having two antigen binding domains, one of which binds to a T cell antigen and the second of which binds to an antigen presented on the surface of a target cell (see PCT publication WO 05/061547; baeuerle et al, 2008,Drugs of the Future 33:137-147; barbou et al, 2008,Science 321:974-977, which is incorporated herein by reference in its entirety). Thus, the BiTE of the present disclosure has an antigen-binding region that binds AXL and a second antigen-binding region that is directed against a T cell antigen.

As used herein, the term "vector" means a nucleic acid molecule capable of transporting another nucleic acid to which it is linked.

As used herein, the term "host cell" refers to a cell into which an expression vector has been introduced.

The term "pharmaceutically acceptable" means that the carrier or excipient is compatible with the other ingredients of the composition and not deleterious to the recipient thereof in large amounts, and/or that such carrier or excipient is approved or available for inclusion in a pharmaceutical composition for parenteral administration to a human.

As used herein, the terms "treatment," "therapy," "treatment," and the like refer to administration of an agent or performing a procedure for the purpose of achieving an effect. These effects may be prophylactic in terms of completely or partially preventing a disease or symptom thereof, and/or may be therapeutic in terms of achieving a partial or complete cure of the disease and/or disease symptom. As used herein, "treating" may include treating a disease or disorder (e.g., cancer) in a mammal, particularly a human, and includes: (a) Preventing the occurrence of a disease or disease symptom in a subject who may be susceptible to the disease (e.g., including a disease that may be associated with or caused by a primary disease) but has not yet been diagnosed with the disease; (b) inhibiting the disease, i.e., arresting its development; and (c) alleviating the disease, i.e., causing regression of the disease. Treatment may refer to any indication of success in the treatment or amelioration or prevention of cancer, including any objective or subjective parameter, such as reduction of symptoms; relief; eliminating or making the disease condition more tolerable to the patient; slowing the rate of deterioration or decay; or to attenuate the final node of the deterioration. Treatment or amelioration of symptoms is based on one or more objective or subjective parameters; including the results of the physician's examination. Thus, the term "treatment" includes administration of an antibody or composition or conjugate disclosed herein to prevent or delay, alleviate, or prevent or inhibit the development of symptoms or disorders associated with a disease (e.g., cancer). The term "therapeutic effect" refers to the reduction, elimination or prevention of a disease, disease symptom or disease side effect in a subject.

As used herein, the term "effective amount" refers to an amount sufficient to effect treatment of a disease when administered to a subject to treat the disease.

As used herein, the term "subject" refers to any mammalian subject for whom diagnosis, treatment or management is desired. "mammal" for therapeutic purposes refers to any animal classified as a mammal, including humans, domestic animals, and laboratory, zoo, sports, or pet animals, such as dogs, horses, cats, cattle, sheep, goats, pigs, mice, rats, rabbits, guinea pigs, monkeys, etc.

In one aspect, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds AXL comprising a light chain variable region (VL) and a heavy chain variable region (VH), wherein VL comprises amino acid sequences having the amino acid sequences set forth in SEQ id nos: 52-54, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ id no:57-59, and HCDR1-3 of the amino acid sequence shown in seq id no.

In some embodiments, the VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:62-64, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:67-69, and HCDR1-3 of the amino acid sequence shown.

In some embodiments, the VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:2-4, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:7-9, and HCDR1-3 of the amino acid sequence shown in seq id no.

In some embodiments, the VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:12-14, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:17-19, and HCDR1-3 of the amino acid sequence shown in seq id no.

In some embodiments, the VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:22-24, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:27-29, and HCDR1-3 of the amino acid sequence shown in seq id no.

In some embodiments, the VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:32-34, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:37-39, and HCDR1-3 of the amino acid sequence shown in seq id no.

In some embodiments, the VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:42-44, and VH comprises LCDR 1-3 having the amino acid sequence as set forth in SEQ ID NO:47-49, and HCDR1-3 of the amino acid sequence shown in seq id no.

In some embodiments, CDR sequences are defined according to the Kabat numbering system.

When CDR sequences are defined according to the Kabat numbering system, the VL of the antibodies disclosed herein comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:52 (KASQGVATAVA), SEQ ID NO:53 (wassth) and SEQ ID NO:54 (QQYSSYPRT) LCDR1, LCDR2 and LCDR3 of an amino acid sequence of (QQYSSYPRT), and the VH of the antibody disclosed herein comprises a sequence having an amino acid sequence as set forth in SEQ ID NO:57 (DAWMD), SEQ ID NO:58 (EIRSKVNNHAAYYAESVKG) and SEQ ID NO:59 (FYNY) HCDR1, HCDR2 and HCDR3 of the amino acid sequences shown in (F YNY).

In other embodiments, the VL of the antibodies disclosed herein comprises a VL having the amino acid sequence as set forth in SEQ ID NO:62 (KTSQNVATALA), SEQ ID NO:63 (WSSTRHT) and SEQ ID NO:64 (HQYSSYPRT) LCDR1, LCDR2 and LCDR3 of an amino acid sequence of (HQYSSYPRT), and the VH of the antibody disclosed herein comprises a sequence having an amino acid sequence as set forth in SEQ ID NO:67 (DAWMD), SEQ ID NO:68 (EIRSKPNNYATFYAESVKG) and SEQ ID NO:69 (FYDY) HCDR1, HCDR2 and HCDR3 of the amino acid sequences shown in (F YDY).

In other embodiments, the VL of the antibodies disclosed herein comprises a VL having the amino acid sequence as set forth in SEQ ID NO:2 (RASSSVGYMH), SEQ ID NO:3 (ats) and SEQ ID NO:4 (QQWSSTPPT), and VH of the antibodies disclosed herein comprises LCDR1, LCDR2, and LCDR3 having the amino acid sequence of SEQ ID NO:7 (SGYYWN), SEQ ID NO:8 (YINFDGTNKYTPSLKN) and SEQ ID NO:9 (ELLRQFAY) HCDR1, HCDR2 and HCDR3 of the amino acid sequence of formula (i).

In other embodiments, the VL of the antibodies disclosed herein comprises a VL having the amino acid sequence as set forth in SEQ ID NO:12 (RASQYIGTSIH), SEQ ID NO:13 (YASESIS) and SEQ ID NO:14 (QQSNSWPST) LCDR1, LCDR2 and LCDR3 of an amino acid sequence of (QQSNSWPST), and the VH of the antibody disclosed herein comprises a sequence having an amino acid sequence as set forth in SEQ ID NO:17 (EYTMH), SEQ ID NO:18 (GISPNNGGTSYNQKFKG) and SEQ ID NO:19 (WGYYGSRRNWYFDV) HCDR1, HCDR2 and HCDR3 of the amino acid sequences shown in (5).

In other embodiments, the VL of the antibodies disclosed herein comprises a VL having the amino acid sequence as set forth in SEQ ID NO:22 (RASSSVSYMH), SEQ ID NO:23 (ats) and SEQ ID NO:24 (QQWISNPPT) LCDR1, LCDR2 and LCDR3 of an amino acid sequence of (QQWISNPPT), and the VH of the antibody disclosed herein comprises a sequence having an amino acid sequence as set forth in SEQ ID NO:27 (SGYYWN), SEQ ID NO:28 (YISYDGSNKYNPSLKN) and SEQ ID NO:29 (ELLRQFFY) HCDR1, HCDR2 and HCDR3 of the amino acid sequences shown.

In other embodiments, the VL of the antibodies disclosed herein comprises a VL having the amino acid sequence as set forth in SEQ ID NO:32 (RSSQSLVHSNGNTYLH), SEQ ID NO:33 (KVSNRFS) and SEQ ID NO:34 (SQSTHVPLT) LCDR1, LCDR2 and LCDR3 of an amino acid sequence of (SQSTHVPLT), and the VH of the antibody disclosed herein comprises a sequence having an amino acid sequence as set forth in SEQ ID NO:37 (SYYMS), SEQ ID NO:38 (AINTNGGNTYYPDTVKG) and SEQ ID NO:39 (AIAIYYYGSNYPAWFAY) HCDR1, HCDR2 and HCDR3 of the amino acid sequences shown in (5).

In other embodiments, the VL of the antibodies disclosed herein comprises a VL having the amino acid sequence as set forth in SEQ ID NO:42 (RANSSVGFMH), SEQ ID NO:43 (ats) and SEQ ID NO:44 (QQWSSNPPT) LCDR1, LCDR2 and LCDR3 of an amino acid sequence of (QQWSSNPPT), and the VH of the antibody disclosed herein comprises a sequence having an amino acid sequence as set forth in SEQ ID NO:47 (sgyffn), SEQ ID NO:48 (YVNFDGNNRYNPSLKN) and SEQ ID NO:49 (EELRQFAY) HCDR1, HCDR2 and HCDR3 of the amino acid sequences shown in (A).

In some embodiments of the antibodies or antigen-binding fragments thereof disclosed herein, the VL comprises an amino acid sequence that hybridizes to SEQ ID NO:51 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and VH comprises an amino acid sequence that is identical to SEQ ID NO:56 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:61 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:66 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:71 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:72 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:73 has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and VH comprises an amino acid sequence that is identical to SEQ ID NO:74 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:1, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:6 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:11, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:16 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:21, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:26 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:31, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:36 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, VL comprises a sequence identical to SEQ ID NO:41, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:46 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the VH comprises an amino acid sequence as set forth in SEQ ID NO: 1. 11, 21, 31, 41, 51, 61, 71 and 73, provided that the functional variant retains the ability to bind AXL. In some embodiments, the VH comprises an amino acid sequence as set forth in SEQ ID NO: 6. 16, 26, 36, 46, 56, 66, 72 and 74, provided that the functional variant retains the ability to bind AXL.

The functional variant comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity to the amino acid sequence of the parent polypeptide.

In the context of functional variants, the number of amino acids inserted, deleted and/or substituted preferably does not exceed 40%, more preferably does not exceed 35%, more preferably is 1% to 33%, and more preferably is 5% to 30%, more preferably is 10% to 25%, more preferably is 15% to 20% of the total number of amino acids in the parent amino acid sequence. For example, the number of inserted, deleted and/or substituted amino acids may be 1 to 20, preferably 1 to 10, more preferably 1 to 7, still more preferably 1 to 5, most preferably 1 to 2. In preferred embodiments, the number of amino acids inserted, deleted and/or substituted is 1, 2, 3, 4, 5, 6 or 7.

In some embodiments, insertions, deletions, and/or substitutions may be made in the Framework (FR) region, e.g., in FR1, FR2, FR3, and/or FR 4.

In some embodiments, the substitution of one or more amino acids may be conservative substitutions of one or more amino acids. Such conservative substitutions are preferably substitutions in which one amino acid in the following groups (a) to (e) is substituted by another amino acid residue in the same group: (a) small aliphatic, non-polar or weakly polar residues: ala, ser, thr, pro and Gly; (b) Polar, negatively charged residues and (uncharged) amides: asp, asn, glu and Gln; (c) polar, positively charged residues: his, arg and Lys; (d) large aliphatic, nonpolar residues: met, leu, he, val and Cys; and (e) an aromatic residue: phe, tyr and Trp.

In a preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:51 and VH comprises the amino acid sequence shown as SEQ ID NO:56, and a sequence of amino acids shown in seq id no.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:61 and VH comprises the amino acid sequence shown as SEQ ID NO: 66.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:71 and VH comprises the amino acid sequence shown as SEQ ID NO:72, and a sequence of amino acids shown in seq id no.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:73 and VH comprises the amino acid sequence shown as SEQ ID NO: 74.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:1 and VH comprises the amino acid sequence shown as SEQ ID NO:6, and a polypeptide having the amino acid sequence shown in FIG. 6.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:11 and VH comprises the amino acid sequence shown as SEQ ID NO:16, and a polypeptide having the amino acid sequence shown in seq id no.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:21 and VH comprises the amino acid sequence shown as SEQ ID NO:26, and a polypeptide comprising the amino acid sequence shown in seq id no.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:31 and VH comprises the amino acid sequence set forth in SEQ ID NO:36, and a nucleotide sequence shown in seq id no.

In another preferred embodiment, VL comprises the amino acid sequence set forth in SEQ ID NO:41 and VH comprises the amino acid sequence shown as SEQ ID NO: 46.

Immunoglobulin molecules can be divided into five classes (isotypes) based on the amino acid sequence of the antibody heavy chain constant region: igA, igD, igE, igG and IgM, and can be further divided into different subtypes such as IgG1, igG2, igG3, igG4, igA1, igA2, etc. Based on the amino acid sequence of the light chain, the light chain of an antibody can be divided into lambda (λ) chains and kappa (κ) chains. The antibodies disclosed herein may be of any of the classes or subtypes described above.

In some embodiments, the antibody is an isotype selected from IgG, igA, igM, igE and IgD. In some embodiments, the antibody is of a subtype selected from the group consisting of IgG1, igG2, igG3, and IgG 4. In a preferred embodiment, the antibody is an IgG1 antibody.

The antibodies disclosed herein may be whole antibodies or antigen-binding fragments thereof. The antigen binding fragment may be any fragment of an antibody that retains the ability to specifically bind to AXL. Examples of antigen binding fragments include, but are not limited to: fab fragments; f (ab') 2 fragments; fab' fragments; fd fragment; fd' fragment; fv fragments; an scFv fragment; a dAb fragment; individual Complementarity Determining Regions (CDRs); a nanobody; a linear antibody consisting of a pair of Fd fragments in tandem (VH-CH 1-VH-CH 1) and modified versions of any of the foregoing fragments that retain antigen binding activity.

In some embodiments, the antigen binding fragment is selected from the group consisting of Fab, fab ', F (ab') ₂ Fv, scFv and ds-scFv. In a preferred embodiment, the antigen binding fragment is a Fab. In another preferred embodiment, the antigen binding fragment is an Fv. In another preferred embodiment, the antigen binding fragment is an scFv.

In some embodiments, the antibody is a monoclonal antibody.

In some embodiments, the antibody comprises a light chain comprising a sequence identical to SEQ ID NO:55, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:60 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the antibody comprises a light chain comprising a sequence identical to SEQ ID NO:65, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:70 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the antibody comprises a light chain comprising a sequence identical to SEQ ID NO:5, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:10 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the antibody comprises a light chain comprising a sequence identical to SEQ ID NO:15, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:20 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the antibody comprises a light chain comprising a sequence identical to SEQ ID NO:25, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:30 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the antibody comprises a light chain comprising a sequence identical to SEQ ID NO:35, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:40 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the antibody comprises a light chain comprising a sequence identical to SEQ ID NO:45, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:50 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the light chain comprises the amino acid sequence as set forth in SEQ ID NO: 5. 15, 25, 35, 45, 55 or 65, provided that the functional variant retains the ability to bind AXL. In some embodiments, the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO: 10. 20, 30, 40, 50, 60 or 70, provided that the functional variant retains the ability to bind AXL.

In some embodiments, the number of amino acids inserted, deleted and/or substituted preferably does not exceed 40%, more preferably does not exceed 35%, more preferably is 1% to 33%, and more preferably is 5% to 30%, more preferably is 10% to 25%, more preferably is 15% to 20% of the total number of amino acids in the parent amino acid sequence. For example, the number of inserted, deleted and/or substituted amino acids may be 1 to 50, preferably 1 to 20, more preferably 1 to 10, still more preferably 1 to 5. In preferred embodiments, the number of amino acids inserted, deleted and/or substituted is 1, 2, 3, 4, 5, 6 or 7.

In some embodiments, insertions, deletions, and/or substitutions may be in the Framework (FR) regions, such as FR1, FR2, FR3, and/or FR4; and/or constant regions, such as CL, CH1, CH2, and/or CH 3.

In some embodiments, the substitution of one or more amino acids may be conservative substitutions of one or more amino acids. Examples of conservative substitutions are described above.

In a preferred embodiment, the antibody comprises a light chain comprising the amino acid sequence as set forth in SEQ id no:55, and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO: 60.

In another preferred embodiment, the antibody comprises a light chain comprising the amino acid sequence as set forth in SEQ ID NO:65, and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO: 70.

In another preferred embodiment, the antibody comprises a light chain comprising the amino acid sequence as set forth in SEQ ID NO:5, and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:10, and a polypeptide having the amino acid sequence shown in FIG. 10.

In another preferred embodiment, the antibody comprises a light chain comprising the amino acid sequence as set forth in SEQ ID NO:15, and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:20, and a polypeptide having the amino acid sequence shown in seq id no.

In another preferred embodiment, the antibody comprises a light chain comprising the amino acid sequence as set forth in SEQ ID NO:25, and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:30, and a nucleotide sequence shown in seq id no.

In another preferred embodiment, the antibody comprises a light chain comprising the amino acid sequence as set forth in SEQ ID NO:35, and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:40, and a polypeptide having the amino acid sequence shown in seq id no.

In another preferred embodiment, the antibody comprises a light chain comprising the amino acid sequence as set forth in SEQ ID NO:45, and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:50, and a nucleotide sequence shown in seq id no.

In other embodiments, the antibody is a bispecific antibody or a multispecific antibody. In some embodiments, the antibody is a bispecific antibody further comprising a second antigen binding region that binds to a second antigen. In some embodiments, the second antigen is a tumor-associated antigen or an immune cell antigen.

A number of tumor-associated antigens have been identified in the art as being associated with a particular cancer. In some embodiments, the tumor-associated antigen is an antigen that can potentially elicit a distinct tumor-specific immune response. Some of these antigens are encoded by, but not necessarily expressed by, normal cells. These antigens can be characterized as antigens that are normally silenced (i.e., not expressed) in normal cells, antigens that are expressed only at certain stages of differentiation, and antigens that are expressed over time, such as embryonic and fetal antigens. Other cancer cell antigens are encoded by mutated cellular genes such as oncogenes (e.g., activated Ras oncogenes), suppressor genes (e.g., mutated P53), and fusion proteins resulting from internal deletions or chromosomal translocations. Other cancer antigens may be encoded by viral genes such as those carried by RNA and DNA oncolytic viruses. Many other tumor-associated antigens and antibodies thereto are known and/or commercially available and may also be prepared by those skilled in the art.

Examples of tumor-associated antigens include, but are not limited to, 5T4, alpha fetoprotein, CA-125, carcinoembryonic antigen, CD19, CD20, CD22, CD23, CD30, CD33, CD40, CD56, CD79, CD78, CD123, CD138, C-Met, CSPG4, igM, C-lectin-like molecule 1 (CLL-1), EGFR, EGFRvIII, epithelial tumor antigen, ERBB2, FLT3, folate binding protein, GD2, GD3, HIV-1 envelope glycoprotein gp41, HIV-1 envelope glycoprotein gpl20, melanoma-associated antigen, MUC-1, mutated p53, mutated ras, ROR1, GPC3, VEGFR2, and combinations thereof.

In some embodiments, the second antigen is a T cell antigen. In some embodiments, the T cell antigen is selected from the group consisting of T Cell Receptor (TCR), CD3, CD4, CD8, CD16, CD25, CD28, CD38, CD44, CD62L, CD69, ICOS, 41-BB (CD 137), and NKG2D, or any combination thereof. In some embodiments, the T cell antigen is CD3 and the second antigen binding region binds to any of the gamma, delta, epsilon, zeta and eta chains of CD 3.

In some embodiments, the second antigen is CD3, and the second antigen-binding region comprises VL and VH, wherein VL comprises a sequence having the amino acid sequence set forth in SEQ ID NO:76-78, and VH comprises LCDR1-3 having the amino acid sequence of SEQ ID NO:81-83, and HCDR 1-3 of the amino acid sequence shown in the specification.

In some embodiments, CDR sequences are defined according to the Kabat numbering system. When using Kabat-defined CDR sequences, the VL of the second antigen binding region disclosed herein comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76 (RSSTGAVTTSNYAN), SEQ ID NO:77 (ANKRAP) and SEQ ID NO:78 (ALWYSNLWV) LCDR1, LCDR2 and LCDR3 of the amino acid sequence of (ALWYSNLWV), and VH of the second antigen-binding region disclosed herein comprises a sequence having an amino acid sequence as set forth in SEQ ID NO:81 (tyamin), SEQ ID NO:82 (RIRSKYNNYATYYADSVKG) and SEQ ID NO:83 (HGNFGSSYVSYFAY) HCDR1, HCDR2 and HCDR3 of the amino acid sequences shown in (5).

In some embodiments, the second antigen binding region comprises a VL and a VH, wherein VL comprises a sequence identical to SEQ ID NO:75, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL comprises a sequence as set forth in SEQ ID NO:75, provided that the functional variant retains the ability to bind CD 3. In some embodiments, the VH comprises an amino acid sequence as set forth in SEQ ID NO:80, provided that the functional variant retains the ability to bind CD 3.

For example, SEQ ID NO:75 comprises or consists of a functional variant that hybridizes to SEQ ID NO:75 has an amino acid sequence of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity. For example, SEQ ID NO:80 comprises or consists of a functional variant of SEQ id no:80 has an amino acid sequence of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity.

In some embodiments, the number of amino acids inserted, deleted and/or substituted preferably does not exceed 40%, more preferably does not exceed 35%, more preferably is 1% to 33%, and more preferably is 5% to 30%, more preferably is 10% to 25%, more preferably is 15% to 20% of the total number of amino acids in the parent amino acid sequence. For example, the number of inserted, deleted and/or substituted amino acids may be 1 to 20, preferably 1 to 10, more preferably 1 to 7, still more preferably 1 to 5, most preferably 1 to 2. In preferred embodiments, the number of amino acids inserted, deleted and/or substituted is 1, 2, 3, 4, 5, 6 or 7.

In a preferred embodiment, the second antigen binding region comprises a VL and a VH, wherein VL comprises the amino acid sequence set forth in SEQ ID NO:75, and VH comprises an amino acid sequence as set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In some embodiments, the bispecific antibody comprises a light chain comprising a heavy chain and a light chain comprising a heavy chain having the amino acid sequence of SEQ ID NO:79, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ id no:84 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the bispecific antibody comprises a light chain comprising a heavy chain and a light chain comprising a heavy chain having the amino acid sequence of SEQ ID NO:85, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ id no:86 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

In some embodiments, the light chain comprises the amino acid sequence as set forth in SEQ ID NO:79 or 85, provided that the functional variant retains the ability to bind AXL and CD 3. In some embodiments, the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO:84 or 86, provided that the functional variant retains the ability to bind AXL and CD 3.

In a preferred embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO:79 and the heavy chain comprises the amino acid sequence shown as SEQ ID NO: 84.

In another preferred embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO:85 and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:86, and a polypeptide having the amino acid sequence shown in seq id no.

In some embodiments, the bispecific antibody is a bispecific T cell adapter (BiTE). In some embodiments, the bispecific antibody is in the form of HBiTE, as described in PCT application No. PCT/US2018/016524 (which is incorporated herein by reference in its entirety). In HBiTE, the light chain comprises, from N-terminus to C-terminus, an anti-target VL domain, an anti-CD 3 VL-CL, and a monomeric human IgG1 Fc (e.g., mfc 7.2); the heavy chain comprises, from N-terminus to C-terminus, an anti-target VH domain, an anti-CD 3 VH-CH1, and a monomeric human IgG1 Fc (e.g., mfc 7.2). Monomer fc7.2 contains two amino acid mutations (T366L and Y407H) that inhibit Fc homodimerization.

In another aspect, the present disclosure provides a bispecific antibody, or antigen-binding fragment thereof, comprising a first antigen-binding region comprising VL and VH that binds AXL and a second antigen-binding region comprising VL and VH that binds CD 3.

In some embodiments, the VL of the first antigen binding region comprises a sequence having the amino acid sequence set forth in SEQ ID NO:52-54, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:57-59, HCDR 1-3 of an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR 1-3 of the amino acid sequence shown in the specification.

In some embodiments, the VL of the first antigen binding region comprises a sequence having the amino acid sequence set forth in SEQ ID NO:62-64, and the VH of the first antigen binding region comprises an LCDR 1-3 having the amino acid sequence of SEQ ID NO: HCDR1-3 of the amino acid sequence designated 67-69; and the VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR1-3 of the amino acid sequence shown in the specification.

In some embodiments, the VL of the first antigen binding region comprises a sequence having the amino acid sequence set forth in SEQ ID NO:2-4, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:7-9, HCDR1-3 of an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR1-3 of the amino acid sequence shown in the specification.

In some embodiments, the VL of the first antigen binding region comprises a sequence having the amino acid sequence set forth in SEQ ID NO:12-14, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:17-19, HCDR1-3 of an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR1-3 of the amino acid sequence shown in the specification.

In some embodiments, the VL of the first antigen binding region comprises a sequence having the amino acid sequence set forth in SEQ ID NO:22-24, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:27-29, HCDR 1-3 of an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR 1-3 of the amino acid sequence shown in the specification.

In some embodiments, the VL of the first antigen binding region comprises a sequence having the amino acid sequence set forth in SEQ ID NO:32-34, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:37-39, HCDR 1-3 of an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR 1-3 of the amino acid sequence shown in the specification.

In some embodiments, the VL of the first antigen binding region comprises a sequence having the amino acid sequence set forth in SEQ ID NO:42-44, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:47-49, HCDR 1-3 of an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises a sequence having the amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:81-83, and HCDR 1-3 of the amino acid sequence shown in the specification.

In some embodiments of the bispecific antibodies or antigen-binding fragments thereof disclosed herein, the VL of the first antigen-binding region comprises a sequence identical to SEQ ID NO:51 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and the VH of the first antigen binding region comprises an amino acid sequence that is identical to SEQ ID NO:56 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ ID NO:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:61, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:66 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ id no:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:71, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:72 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ id no:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:73, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:74 having an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ id no:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:1, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:6 having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ ID NO:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:11, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:16 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ id no:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:21, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:26, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ id no:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:31, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:36, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ id no:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:41, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:46 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; and VL of the second antigen binding region comprises a sequence identical to SEQ id no:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

In some embodiments, the VL of the first antigen-binding region, the VH of the first antigen-binding region, the VL of the second antigen-binding region, and the VH of the second antigen-binding region comprise a functional variant formed by insertion, deletion, and/or substitution of one or more amino acids as described above, provided that the functional variant retains the ability to bind AXL and/or CD 3.

In a preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:51 and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:56, an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:61 and the VH of the first antigen binding region comprises the amino acid sequence shown as SEQ ID NO:66, an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:71 and the VH of the first antigen binding region comprises the amino acid sequence shown as SEQ ID NO:72, an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:73 and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:74, an amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:1 and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:6, an amino acid sequence shown in figure 6; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:11 and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:16, and a polypeptide comprising the amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:21 and the VH of the first antigen binding region comprises the amino acid sequence shown as SEQ ID NO:26, and a polypeptide comprising the amino acid sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:31 and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:36, and a nucleotide sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In another preferred embodiment, the VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:41 and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:46, and a nucleotide sequence shown in seq id no; and the VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75 and the VH of the second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

In some embodiments, the bispecific antibody comprises a single polypeptide chain comprising a first antigen binding region and a second antigen binding region, and optionally an Fc region.

The Fc region may be of any isotype including, but not limited to, igG1, igG2, igG3, and IgG4, and may contain one or more mutations or modifications. In one embodiment, the Fc region is of or derived from an IgG1 isotype, optionally with one or more mutations or modifications. In one embodiment, the Fc region is a human IgG1 Fc.

In one embodiment, the Fc region is functionally deficient. For example, the Fc region may be of the IgGl isotype, or of a non-IgGl isotype, e.g., igG2, igG3, or IgG4, that has been mutated such that the ability to mediate effector functions such as ADCC is reduced or even eliminated. Such mutations have been described, for example, in Dall' Acqua WF et al, J Immunol.177 (2): 1129-1138 (2006) and Hezareh M, J Virol; 75 (24) 12161-12168 (2001).

In one embodiment, the Fc region comprises a mutation that removes an Asn-linked glycosylated receptor site or a mutation that is otherwise manipulated to alter the glycosylation characteristics. For example, in the IgG1 Fc region, the Asn-linked glycosylation site can be removed using the N297Q mutation. Thus, in a specific embodiment, the Fc region comprises an IgG1 sequence having the N297Q mutation.

In a further embodiment, the Fc region is glycoengineered to reduce fucose and thus enhance ADCC, for example by adding compounds to the medium during antibody production, as described in US2009317869 or as described in van Berkel et al (2010) Biotechnol. Bioeng.105:350, or by knocking out cells using FUT8, for example as described in Yamane-Ohnuki et al (2004) Biotechnol. Bioeng 87:614. Alternatively, it is possible to use ADCC was optimized by the method described by et al (1999) Nature Biotech 17:176. In another embodiment, the Fc region is engineered to enhance complement activation, for example as described in Natsume et al (2009) Cancer Sci.100:2411.

In some embodiments, the Fc region comprises modifications or mutations that can inhibit Fc homodimerization. In some embodiments, the Fc region comprises a variant of a human IgG1 Fc wild-type sequence. The variant may comprise amino acid substitutions at positions (Kabat numbering) of human IgG 1T 366 and Y407. Preferably, T366 is substituted with L (leucine). Preferably, Y407 is substituted with I (isoleucine), F (phenylalanine), L (leucine), M (methionine), H (histidine), K (lysine), S (serine), Q (glutamine), T (threonine), W (tryptophan), a (alanine), G (glycine), or N (asparagine). More preferably, Y407 is substituted with H. In one embodiment, T366 is substituted with L and Y407 is substituted with H.

In some embodiments, the Fc region may be a monomeric human IgG1 Fc (e.g., mfc 7.2), as described in PCT application No. PCT/US2018/016524, which is incorporated herein by reference in its entirety.

In some embodiments, the bispecific antibody comprises a first polypeptide chain comprising a VL of a first antigen binding region and a VL of a second antigen binding region, and optionally an Fc region; and the second polypeptide chain comprises the VH of the first antigen-binding region and the VH of the second antigen-binding region, and optionally the Fc region. The Fc region may be those described above.

In some embodiments, the first polypeptide chain further comprises a light chain constant region (CL). In some embodiments, the first polypeptide chain comprises a monomeric human IgG1 Fc (e.g., mfc 7.2) as described above. In some embodiments, the first polypeptide chain comprises, from N-terminus to C-terminus: VL of the first antigen binding region, VL, CL and mfc7.2 of the second antigen binding region.

In some embodiments, the second polypeptide chain further comprises a heavy chain constant region (CH), such as CH1. In some embodiments, the first polypeptide chain comprises a monomeric human IgG1 Fc (e.g., mfc 7.2) as described above. In some embodiments, the second polypeptide chain comprises, from N-terminus to C-terminus: VH of the first antigen binding region, VH, CH1 and mfc7.2 of the second antigen binding region.

SEQ ID NO: 79. functional variants of 84, 85 and 86 may be those described above.

In a preferred embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO:79 and the heavy chain comprises the amino acid sequence shown as SEQ ID NO: 84. In another preferred embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO:85 and the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:86, and a polypeptide having the amino acid sequence shown in seq id no.

In some embodiments, the bispecific antibody is a bispecific T cell adapter (BiTE), preferably HBiTE as described above.

Any carrier may be suitable for use in the present disclosure. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a retroviral vector, a DNA vector, a murine leukemia virus vector, an SFG vector, a plasmid, an RNA vector, an adenovirus vector, a baculovirus vector, an Epstein Barr virus vector, a papovavirus vector, a vaccinia virus vector, a herpes simplex virus vector, an adeno-associated virus (AAV) vector, a lentiviral vector, or any combination thereof. Suitable exemplary vectors include, for example, pBY, pGAR, pBABE-Puro, pBABE-neo-largeTcDNA, pBABE-hygro-hTERT, pMKO.1GFP, MSCV-IRES-GFP, pMSCV PIG (Puro IRES GFP empty plasmid), pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE, MSCV IRES luciferase, pMIG, MDH1-PGK-GFP_2.0, ttRMPVIR, pMSCV-IRES-mCherry FP, pRetrox GFP T2A Cre, pRXTN, pLncEXP, and pLXIN-Luc.

The recombinant expression vector may be any suitable recombinant expression vector. Suitable vectors include vectors designed for proliferation and amplification or for expression or both, such as plasmids and viruses. For example, the vector may be selected from the pUC series (Fermentas Life Sciences, glen Burnie, md.), the pBluescript sequence (Stratagene, laJolla, calif.), the pET sequence (Novagen, madison, wis.), the pGEX series (Pharmacia Biotech, uppsala, sweden) and the pEX series (Clontech, palo Alto, calif.). Phage vectors such as λGT10, λGT11, λ ZapII (Stratagene), λEMBL4, and λNM1149 can also be used. Examples of plant expression vectors that can be used in the context of the present disclosure include pBI01, pBI101.2, pBI101.3, pBI121, and pBIN19 (Clontech). Examples of animal expression vectors that can be used in the context of the present disclosure include pcDNA, pEUK-Cl, pMAM and pMAMneo (Clontech).

Recombinant expression vectors can be used, for example, as described in Sambrook et al, molecular Cloning: A Laboratory Manual,3rd ed., cold Spring Harbor Press, cold Spring Harbor, N.Y.2001; and Ausubel et al Current Protocols in Molecular Biology, greene Publishing Associates and John Wiley & Sons, NY, 1994. Circular or linear expression vector constructs can be prepared to contain replication systems functional in prokaryotic or eukaryotic host cells. Replication systems may be derived from, for example, COLEL, 2 μ plasmid, λ, SV40, bovine papilloma virus, etc.

Any cell can be used as a host cell for the nucleic acids or vectors of the present disclosure. In some embodiments, the cell may be a prokaryotic cell, a fungal cell, a yeast cell, or a higher eukaryotic cell such as a mammalian cell. Suitable prokaryotic cells include, but are not limited to, eubacteria, such as gram-negative or gram-positive organisms, e.g., enterobacteriaceae (Enterobacterhaceae), such as Escherichia, e.g., E.coli; enterobacter (Enterobacter); erwinia (Erwinia); klebsiella (Klebsiella); proteus (Proteus); salmonella (Salmonella), such as Salmonella typhimurium (Salmonella typhimurium); serratia (Serratia) such as Serratia marcescens (Serratia marcescans) and Shigella (Shigella); bacillus (bacillus) such as bacillus subtilis and bacillus licheniformis; pseudomonas (Pseudomonas), such as Pseudomonas aeruginosa (P.aeromonas); and Streptomyces (Streptomyces). In some embodiments, the cell is a human cell. In some embodiments, the cell is an immune cell. In some embodiments, host cells include, for example, CHO cells, such as CHOs cells and CHO-K1 cells, or HEK293 cells, such as HEK293A, HEK293T and HEK293FS.

In some embodiments, the carrier or excipient used with the compositions disclosed herein includes, but is not limited to, maleic acid, tartaric acid, lactic acid, citric acid, acetic acid, sodium bicarbonate, sodium phosphate, histidine, glycine, sodium chloride, potassium chloride, calcium chloride, zinc chloride, water, dextrose, N-methylpyrrolidone, dimethyl sulfoxide, N-dimethylacetamide, ethanol, propylene glycol, polyethylene glycol, diethylene glycol monoethyl ether, and the surfactant polyoxyethylene-sorbitan monooleate.

In some embodiments, the therapeutic agent is a chemotherapeutic agent. Chemotherapeutic agents may include, for example, cytotoxic agents, antimetabolites (e.g., folic acid antagonists, purine analogs, pyrimidine analogs, etc.), topoisomerase inhibitors (e.g., camptothecin derivatives, anthraquinones, anthracyclines, epipodophyllotoxins, quinoline alkaloids, etc.), antimicrotubule agents (e.g., taxanes, vinca alkaloids), protein synthesis inhibitors (e.g., cephalotaxine, camptothecin derivatives, quinoline alkaloids), alkylating agents (e.g., alkyl sulfonates, aziridines, nitrogen mustards, nitrosoureas, platinum derivatives, triazenes, etc.), alkaloids, terpenoids, and kinase inhibitors.

In some embodiments, the therapeutic agent includes, but is not limited to, an immunomodulatory agent, a radioactive compound, an enzyme (e.g., perforin), a chemotherapeutic agent (e.g., cisplatin), or a toxin. In some embodiments, the therapeutic agent may be, for example, maytansine, geldanamycin, a tubulin inhibitor such as a tubulin binding agent (e.g., an auristatin) or a minor groove binding agent such as calicheamicin.

Other suitable therapeutic agents include, for example, small molecule cytotoxic agents, i.e., compounds having a molecular weight less than 700 daltons that have the ability to kill mammalian cells. These compounds may also contain toxic metals capable of having cytotoxic effects. In addition, it is understood that these small molecule cytotoxic agents also include prodrugs, i.e., compounds that decompose or transform under physiological conditions to release the cytotoxic agent. Examples of such agents include cisplatin, maytansine derivatives, lazithromycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, sorfimer sodium photosensitizing element II, temozolomide, topotecan, trimethoprim, orestatin E vincristine, and doxorubicin; peptide cytotoxins, i.e., proteins or fragments thereof that have the ability to kill mammalian cells, such as ricin, diphtheria toxin, pseudomonas bacterial exotoxin A, DNA enzyme, and rnase; radionuclides, i.e., unstable isotopes of elements that decay with the simultaneous emission of one or more a or β particles or gamma rays, such as iodine-131, rhenium-186, indium-111, yttrium-90, bismuth-210, bismuth-213, actinium-225, and astatine-213; chelating agents, which can be used to facilitate the binding of these radionuclides to molecules or their multimers.

In some embodiments, the detectable moiety may be selected from biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, or a fluorescent, phosphorescent, or chemiluminescent molecule. Detectable moieties for diagnostic purposes include, for example, fluorescent labels, radiolabels, enzymes, nucleic acid probes, and contrast agents.

In some embodiments, the immunostimulatory molecule is an immune effector molecule that stimulates an immune response. For example, the immunostimulatory molecules may be cytokines such as IL-2 and IFN-gamma, chemokines such as IL-8, platelet factor 4, melanoma growth stimulatory proteins, complement activators; viral/bacterial protein domains, or viral/bacterial peptides.

In some embodiments of the methods disclosed herein, the cancer is an AXL positive cancer. In some embodiments, the cancer is a solid tumor or hematological malignancy.

Examples of cancers include: leukemias, such as, but not limited to, acute leukemia, acute lymphoblastic leukemia, acute myelogenous leukemia (e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia, and myelodysplastic syndrome), chronic leukemias, such as, but not limited to, chronic myelogenous (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as, but not limited to, hodgkin's disease, non-hodgkin's disease; multiple myeloma such as, but not limited to, stasis-type multiple myeloma, non-secretory myeloma, bone-setting myeloma, plasma cell leukemia, isolated plasma cell tumor and extramedullary plasma cell tumor; macroglobulinemia of Fahrenheit; monoclonal gammaglobinopathy of unknown significance; benign monoclonal gammaglobinopathy; heavy chain disease; osteosarcoma and connective tissue sarcomas such as, but not limited to, osteosarcoma (bone sarcomas), osteosarcoma (osteosacoma), chondrosarcoma, ewing's sarcoma, malignant giant cell tumor, osteofibrosarcoma, chordoma, periosteal sarcoma, soft tissue sarcoma, vascular sarcoma (vascular endothelial tumor), fibrosarcoma, kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, metastatic carcinoma, schwannoma, rhabdomyosarcoma, synovial sarcoma; brain tumors such as, but not limited to, glioma, glioblastoma, astrocytoma, brain stem glioma, ependymoma, oligodendroglioma, nonglioma, acoustic neuroma, craniopharyngeal tube tumor, medulloblastoma, meningioma, pineal tumor, primary brain lymphoma; breast cancer, including but not limited to adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullary breast cancer, mucinous breast cancer, tubular breast cancer, papillary breast cancer, primary carcinoma, paget's disease, and inflammatory breast cancer; adrenal cancer such as, but not limited to, pheochromocytoma and adrenal cortical cancer; thyroid cancer such as, but not limited to, papillary or follicular thyroid cancer, medullary thyroid epithelial cancer, medullary thyroid cancer, and anaplastic thyroid cancer; GIST-gastrointestinal stromal tumor; pancreatic cancers such as, but not limited to, insulinomas, gastrinomas, glucagon tumors, schwannomas, somatostatin secreting tumors and carcinoids or insulinomas; pituitary cancers such as, but not limited to, cushing's disease, prolactin secreting tumors, acromegaly, and diabetes insipidus; eye cancers such as, but not limited to, eye melanomas such as iris melanoma, choroidal melanoma, and ciliary body melanoma, and retinoblastomas; vaginal cancers, such as squamous cell carcinoma, adenocarcinoma, and melanoma; vulvar cancer, such as squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and paget's disease; cervical cancer such as, but not limited to, squamous cell carcinoma and adenocarcinoma; uterine cancers such as, but not limited to, endometrial cancer and uterine sarcoma; ovarian cancers such as, but not limited to, ovarian epithelial cancers, borderline tumors, germ cell tumors, and stromal tumors; esophageal cancers such as, but not limited to, squamous cell carcinoma, adenocarcinoma, adenoid cystic carcinoma, myxoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, warty carcinoma, and oat cell (small cell) carcinoma; gastric cancers, such as, but not limited to, adenocarcinoma, mycosis (polypoid), ulcerative, superficial diffuse, diffuse, malignant lymphoma, liposarcoma, fibrosarcoma, and carcinomatous sarcoma; colon cancer; rectal cancer; liver cancer such as, but not limited to, hepatocellular carcinoma and hepatoblastoma, gallbladder cancer such as adenocarcinoma; bile duct cancers, such as, but not limited to papillary, nodular and diffuse bile duct cancers; lung cancer, such as non-small cell lung cancer (NSCLC), squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma, large cell carcinoma, and Small Cell Lung Cancer (SCLC); testicular cancer, such as but not limited to germ cell tumor, seminoma, anaplastic, classical (typical), seminoma, non-seminoma, embryonal carcinoma, teratoma carcinoma, choriocarcinoma (yolk sac tumor), prostate cancer, such as but not limited to adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma; genital cancers, such as penile cancer; oral cancers, such as, but not limited to squamous cell carcinoma; basal cancers; salivary gland cancers, such as, but not limited to, adenocarcinoma, mucoepidermoid carcinoma, and adenoid cystic carcinoma; pharyngeal cancers, such as, but not limited to, squamous cell carcinoma and wart; skin cancers such as, but not limited to, basal cell carcinoma, squamous cell carcinoma and melanoma, superficial diffuse melanoma, nodular melanoma, lentigo malignant melanoma, acro-lentigo melanoma; renal cancers such as, but not limited to, renal cell carcinoma, clear cell renal cell carcinoma, adenocarcinoma, adrenal gland tumor, fibrosarcoma, transitional cell carcinoma (renal pelvis and/or ureter); wilms tumor; bladder cancer, such as, but not limited to transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, and carcinomatosis. In addition, cancers include myxosarcoma, osteogenic sarcoma, endothelial sarcoma, lymphatic endothelial sarcoma, mesothelioma, synovioma, angioblastoma, epithelial cancer, cystic adenocarcinoma, bronchial carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma and papillary adenocarcinoma. Preferably, the cancer is selected from breast cancer, melanoma, prostate cancer, ovarian cancer, colorectal cancer, lung cancer or glioma.

In some embodiments, the cancer is selected from leukemia, lymphoma, myeloma, fibrosarcoma, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, colon cancer, colorectal cancer, melanoma, and liver cancer (e.g., hepatocellular carcinoma).

In some embodiments, the dosage administered to a subject may vary with the embodiment, the drug used, the method of administration, and the site and subject to be treated. However, the dosage should be sufficient to provide a therapeutic response. A clinician may determine an effective amount to administer to a human or other subject to treat a medical condition. The precise amount required for therapeutic effectiveness may depend on a number of factors, such as the activity of the antibody and the route of administration.

The dosage of the antibodies, compositions or conjugates described herein may be administered to the mammal once or in a series of sub-doses over a suitable period of time, for example, daily, every half-week, weekly, every two weeks, every half-month, every two months, every half-year or once a year, as desired. Dosage units comprising an effective amount of the antibody, composition or conjugate may be administered in a single daily dose, or the total daily dose may be administered in two, three, four or more divided doses administered daily, as desired.

The appropriate mode of administration may be selected by the physician. The route of administration may be parenteral, for example by injection, nasal, pulmonary or transdermal. Systemic or local administration may be by intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection. In some embodiments, the antibody, composition or conjugate is selected for parenteral delivery, for inhalation or for delivery through the digestive tract, e.g., oral. The administration dosage and method may vary according to the weight, age, condition, etc. of the subject, and may be appropriately selected.

In some embodiments, the method further comprises administering a second therapeutic agent to the subject. In certain embodiments, the antibodies, compositions, or conjugates disclosed herein are administered prior to, substantially simultaneously with, or after the administration of the second therapeutic agent.

In some embodiments, the second therapeutic agent is selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs. In some embodiments, the second therapeutic agent is selected from the group consisting of a Bruton's Tyrosine Kinase (BTK) inhibitor, PI3K inhibitor, HDAC inhibitor, ERK inhibitor, MAPK inhibitor, PD-1/PD-L1 inhibitor, LAG3 inhibitor, CTLA-4 inhibitor, TIGIT inhibitor, TIM3 inhibitor, VEGF inhibitor, and glucocorticoid.

In some embodiments, the second therapeutic agent is a chemotherapeutic agent. Chemotherapeutic agents may include, for example, cytotoxic agents, antimetabolites (e.g., folic acid antagonists, purine analogs, pyrimidine analogs, etc.), topoisomerase inhibitors (e.g., camptothecin derivatives, anthraquinones, anthracyclines, epipodophyllotoxins, quinoline alkaloids, etc.), antimicrotubule agents (e.g., taxanes, vinca alkaloids), protein synthesis inhibitors (e.g., cephalotaxine, camptothecin derivatives, quinoline alkaloids), alkylating agents (e.g., alkyl sulfonates, aziridines, nitrogen mustards, nitrosoureas, platinum derivatives, triazenes, etc.), alkaloids, terpenoids, and kinase inhibitors.

In another aspect, the present disclosure provides a method of detecting AXL-positive cancer in a subject comprising (i) contacting a sample obtained from the subject with an antibody or antigen-binding fragment thereof disclosed herein, or a bispecific antibody or antigen-binding fragment thereof disclosed herein, or a conjugate disclosed herein; and (ii) detecting binding of the antibody or antigen binding fragment thereof to AXL in the sample.

In some embodiments, the antibody or antigen binding fragment thereof is linked to a detectable moiety. The detectable moiety may be selected from biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, or a fluorescent, phosphorescent, or chemiluminescent molecule. Detectable moieties for diagnostic purposes include, for example, fluorescent labels, radiolabels, enzymes, nucleic acid probes, and contrast agents.

In some embodiments, the cancer is an AXL positive cancer. Preferably, the cancer is selected from leukemia, lymphoma, myeloma, fibrosarcoma, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, colon cancer, colorectal cancer, melanoma, and liver cancer (e.g., hepatocellular carcinoma).

In yet another aspect, the present disclosure provides a pharmaceutical package or kit comprising one or more containers in which one or more components of the pharmaceutical compositions described herein, such as antibodies or antigen binding fragments disclosed herein, are contained. Optionally, associated with such containers may be a notification in the form prescribed by a government agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notification reflects approval by the manufacture, use or sale agency for human administration.

In particular embodiments, the kit comprises a first container comprising an antibody or antigen binding fragment disclosed herein. In particular embodiments, the kit comprises a first container that is a vial containing the antibody or antigen binding fragment as a lyophilized sterile powder under vacuum, and the kit further comprises a second container that contains a pharmaceutically acceptable fluid.

In particular embodiments, provided herein are injection devices comprising the antibodies or antigen binding fragments disclosed herein. In particular embodiments, the injection device comprises an antibody in a sterile solution. In a specific embodiment, the injection device is a syringe.

In yet another aspect, the present disclosure provides a kit for detecting the presence of AXL antigen in a sample comprising an antibody or antigen binding fragment thereof disclosed herein, a bispecific antibody or antigen binding fragment thereof disclosed herein, or a conjugate disclosed herein. Preferably, the antibody or antigen binding fragment thereof is linked to a detectable moiety. The detectable moiety may be selected from biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, or a fluorescent, phosphorescent, or chemiluminescent molecule. Detectable moieties for diagnostic purposes include, for example, fluorescent labels, radiolabels, enzymes, nucleic acid probes, and contrast agents.

In another aspect, the present disclosure provides the use of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein in the manufacture of a medicament for treating cancer in a subject. In some embodiments, the cancer is an AXL positive cancer.

In another aspect, the present disclosure provides an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein for use in treating cancer in a subject. In some embodiments, the cancer is an AXL positive cancer.

In another aspect, the present disclosure provides the use of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, or a conjugate disclosed herein in the manufacture of a kit for detecting AXL-positive cancer in a subject.

In yet another aspect, the present disclosure provides an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, or a conjugate disclosed herein for use in detecting AXL-positive cancer in a subject.

In some embodiments of the uses disclosed herein, the cancer is selected from leukemia, lymphoma, myeloma, fibrosarcoma, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, colon cancer, colorectal cancer, melanoma, and liver cancer (hepatocellular carcinoma). In some embodiments, an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein is combined with a second therapeutic agent. In some embodiments, the second therapeutic agent is selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs. In some embodiments, the second therapeutic agent is selected from the group consisting of a Bruton's Tyrosine Kinase (BTK) inhibitor, PI3K inhibitor, HDAC inhibitor, ERK inhibitor, MAPK inhibitor, PD-1/PD-L1 inhibitor, LAG3 inhibitor, CTLA-4 inhibitor, TIGIT inhibitor, TIM3 inhibitor, VEGF inhibitor, and glucocorticoid.

Examples

The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the invention in any way. This example, together with the methods described herein, is a current representation of a preferred embodiment, is exemplary, and is not intended to limit the scope of the invention. Variations and other uses thereof will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.

Cell lines including HT1080, 786-O, achn, A549, H226, LS174T, H460, N87 and SP2/0 tumor cell lines were purchased from National Collection of Authenticated Cell Cultures. HCT116, HT29 and SKOV3 cell lines were purchased from ATCC. The Ba/F3 cell line was purchased from KYinno Biotechnology co., ltd.

The human AXL protein and cynomolgus AXL protein were purchased from ACROBiosystems. The mouse AXL protein was purchased from Sino Biological. T cell activation bioassay (NFAT) proliferation models were purchased from Promega. Jurkat-CD16a-NFAT cells and Stable-Lite luciferase assay systems were purchased from Vazyme.

Anti-human IgG (gamma chain specific) -R-PE antibodies, anti-human IgG (Fc specific) -peroxidase antibodies and PEG1500 were purchased from Sigma. Balb/c mice were purchased from GemParmatech (Nanjing, china) and B-NDG mice were purchased from Biocytogen (Beijing, china). All animal experiments were performed according to guidelines of the animal committee of the national academy of sciences.

Example 1 screening of anti-AXL antibodies by hybridoma technology

Studies have shown that AXL is suitable as a tumor antigen for both diagnostic tumor markers and targeted therapies. In order to develop therapeutics against AXL-expressing tumors, high affinity anti-AXL monoclonal antibodies are highly desirable.

Antibodies to AXL were obtained by immunizing Balb/c mice (6-8 weeks old) with human AXL protein (ACROBiosystems) as immunoconjugate. One week after the third immunization, the antibody titer in serum was determined by ELISA. Mice with highest serum antibody titers were sacrificed and spleen cells were fused with mouse myeloma cells SP2/0 at a ratio of 8:1. After 10 days of incubation, hybridoma cell culture supernatants were assayed for binding activity to human AXL protein by ELISA. ELISA was performed using standard protocols. Briefly, 1 μg/mL of human AXL protein (ACRO) was coated on Corning EIA/RIA high binding 96-well plates (Corning inc.) 100 μl per well overnight at 4 ℃. mu.L of hybridoma cell culture supernatant was added and incubated at 37℃for 1 hour. Plates were washed 3 times with 0.05% PBST. Bound antibody was detected by goat anti-mouse IgG-Fc fragment cross-adsorbed antibody HRP conjugate (Bethyl). The assay was developed using TMB substrate (Solarbio) at room temperature and measured at 450nm using an enzyme-labeled instrument. By using a similar protocol, the binding activity of hybridoma cell supernatants to cynomolgus AXL protein (ACRO) and mouse AXL protein (Sino biological) was examined, respectively.

After evaluating the binding capacity of hybridoma cell culture supernatants to human, cynomolgus monkey and mouse AXL proteins, 7 monoclonal antibodies with species cross-reactivity to human and cynomolgus monkeys but no species cross-reactivity to mice (data not shown) were selected for simultaneous construction of the intact form of monoclonal antibodies (with human-murine chimeric and humanized forms) and the humanized bispecific T cell adapter (BiTE), considering that the antibodies produced by the hybridoma technique were murine in origin, which may elicit an immune response to subsequently produced anti-drug antibodies (ADA).

EXAMPLE 2 construction and preliminary characterization of anti-AXL monoclonal antibodies

Cloning of AXL monoclonal antibodies

To generate constructs of AXL-mab-Ch-A2 mouse-human chimeric monoclonal antibodies, the following primers were used:

AXL-A2-VH-FP:

AXL-A2-VH-RP:

AXL-A2-VL-FP:

AXL-A2-VL-RP:

to generate constructs for the AXL-mab-Ch-A3 monoclonal antibody, the following primers were used:

AXL-A3-Hu-VH-FP1：

AXL-A3-Hu-VH-FP2：

AXL-A3-Hu-VH-FP3：

AXL-A3-Hu-VH-FP4：

/>

AXL-A3-Hu-VH-FP5：

AXL-A3-Hu-VH-RP1：

AXL-A3-Hu-VH-RP2：

AXL-A3-Hu-VH-RP3：

AXL-A3-Hu-VH-RP4：

AXL-A3-Hu-VH-RP5：

AXL-A3-Hu-VL-FP1：

AXL-A3-Hu-VL-FP2：

AXL-A3-Hu-VL-FP3：

AXL-A3-Hu-VL-FP4：

AXL-A3-Hu-VL-RP1：

AXL-A3-Hu-VL-RP2：

AXL-A3-Hu-VL-RP3：

AXL-A3-Hu-VL-RP4：

to generate constructs of AXL-mab-Ch-B1 mouse-human chimeric monoclonal antibodies, the following primers were used:

AXL-B1-VH-FP:

AXL-B1-VH-RP:

AXL-B1-VL-FP:

AXL-A2-VL-RP:

to generate constructs for the AXL-mab-Ch-B1L monoclonal antibody, the following primers were used:

B1L-MO-VH-F1:

B1L-MO-VH-F2:

B1L-MO-VH-F3:

B1L-MO-VH-F4:

B1L-MO-VH-F5:

B1L-MO-VH-R1:

B1L-MO-VH-R2:

B1L-MO-VH-R3:

B1L-MO-VH-R4:

CH1-vector-FP:GCTAGCACCAAGGGCCCATC(SEQ ID NO：124)

B1L-MO-VL-F1:

B1L-MO-VL-F2:

B1L-MO-VL-F3:

B1L-MO-VL-F4:

B1L-MO-VL-R1:

B1L-MO-VL-R2:

B1L-MO-VL-R3:

B1L-MO-VL-R4:

CL-vector-FP CGTACGGTGGCTGCACCATC (SEQ ID NO: 133)

To generate constructs for the AXL-mab-Ch-B2 monoclonal antibody, the following primers were used:

AXL-B2-VH-Hu-FP1：

AXL-B2-VH-Hu-FP2：

AXL-B2-VH-Hu-FP3：

AXL-B2-VH-Hu-FP4：

AXL-B2-VH-Hu-FP5：

AXL-B2-VH-Hu-RP1：

AXL-B2-VH-Hu-RP2：

AXL-B2-VH-Hu-RP3：

AXL-B2-VH-Hu-RP4：

AXL-B2-VH-Hu-RP5：

AXL-B2-VL-Hu-FP1：

AXL-B2-VL-Hu-FP2：

AXL-B2-VL-Hu-FP3：

AXL-B2-VL-Hu-FP4：

AXL-B2-VL-Hu-RP1：

AXL-B2-VL-Hu-RP2：

AXL-B2-VL-Hu-RP3：

AXL-B2-VL-Hu-RP4：

To generate constructs for the AXL-mab-Ch-B4 monoclonal antibody, the following primers were used:

AXL-B4-VH-Hu-FP1：

AXL-B4-VH-Hu-FP2：

AXL-B4-VH-Hu-FP3：

AXL-B4-VH-Hu-FP4：

AXL-B4-VH-Hu-FP5：

AXL-B4-VH-Hu-RP1：

AXL-B4-VH-Hu-RP2：

AXL-B4-VH-Hu-RP3：

AXL-B4-VH-Hu-RP4：

AXL-B4-VL-Hu-FP1：

AXL-B4-VL-Hu-FP2：

AXL-B4-VL-Hu-FP3：

AXL-B4-VL-Hu-FP4：

AXL-B4-VL-Hu-RP1：

AXL-B4-VL-Hu-RP2：

AXL-B4-VL-Hu-RP3：

AXL-B4-VL-Hu-RP4：

to generate constructs for the AXL-mab-Ch-C5 monoclonal antibody, the following primers were used:

AXL-HB-C5-VH-FP1：

AXL-HB-C5-VH-FP2：

AXL-HB-C5-VH-FP3：

AXL-HB-C5-VH-FP4：

AXL-HB-C5-VH-FP5：

AXL-HB-C5-VH-RP1：

AXL-HB-C5-VH-RP2：

AXL-HB-C5-VH-RP3：

AXL-HB-C5-VH-RP4：

AXL-HB-C5-VL-FP1：

AXL-HB-C5-VL-FP2：

AXL-HB-C5-VL-FP3：

AXL-HB-C5-VL-FP4：

AXL-HB-C5-VL-RP1：

AXL-HB-C5-VL-RP2：

AXL-HB-C5-VL-RP3：

AXL-HB-C5-VL-RP4：

to generate AXL-mab-Ch-A2, AXL-mab-Ch-A3, AXL-mab-Ch-B1, AXL-mab-Ch-B2, AXL-mab-Ch-B4, AXL-mab-Ch-C5 and AXL-mab-Ch-B1L, light and heavy chain gene fragments were obtained by using gene synthesis and overlap PCR and the target gene fragments were cloned into pBY vector using homologous recombination. These vectors are used for monoclonal antibody expression.

Protein expression, purification and preliminary characterization

Monoclonal antibodies were expressed in 293FS or CHO-S cells. The plasmid and transfection agent PEI were mixed in a 1:3 ratio and then added dropwise to 293FS or CHO-S cell cultures. Cells continue to grow for 5-7 days after transfection. Cell cultures were harvested by centrifugation at 8000rpm for 20 minutes. The culture supernatant containing the target protein was loaded onto Protein A Sepharose Fast Flow column chromatography (GE Healthcare). Purification was performed according to the manufacturer's instructions.

anti-AXL chimeric mAbs, AXL-mAb-Ch-A2, AXL-mAb-Ch-A3, AXL-mAb-Ch-B1, AXL-mAb-Ch-B2, AXL-mAb-Ch-B4, AXL-mAb-Ch-C5 and AXL-mAb-Ch-B1L were well expressed in transiently transfected CHO-S cells and secreted into culture supernatant. On non-reducing SDS-PAGE, these chimeric mAbs showed an apparent molecular weight (aMW) of about 150 kDa. On reducing SDS-PAGE, the heavy and light chains had apparent molecular weights of about 55kDa and 30kDa, respectively (data not shown).

CDR sequences of anti-AXL chimeric mabs according to the Kabat numbering system are shown in table 1. The amino acid sequences of the light chain variable region (VL) and heavy chain variable region (VH) of the anti-AXL chimeric mabs are shown in table 2. The complete light and heavy chain sequences of the anti-AXL chimeric mabs are shown in table 3.

TABLE 1 CDR sequences of anti-AXL chimeric mAbs

/>

TABLE 2 VL and VH sequences of anti-AXL chimeric mAbs

/>

TABLE 3 heavy and light chain sequences of anti-AXL chimeric mAbs

/>

EXAMPLE 3 binding of anti-AXL monoclonal antibodies to AXL

ELISA was performed according to standard protocols to measure the binding affinity of anti-AXL mAb to recombinant human AXL. Briefly, recombinant human AXL (AcroBiosystems) was coated on Corning EIA/RIA high binding 96-well plates (Corning inc.) 100ng per well, overnight at 4 ℃ and blocked with PBS (ph 7.4) containing 3% skim milk. Five-fold serial dilutions of antibody were added and incubated for 2h at room temperature. Plates were washed with PBS containing 0.05% Tween 20. The bound antibodies were detected by anti-human IgG (Fc specific) -peroxidase antibodies (Merck) produced in goats. The assay was developed using TMB substrate (Solarbio) at room temperature and using an enzyme-labeled instrument at 450nmMonitoring is performed. Half maximal binding (EC) was calculated by fitting the data to Langmuir adsorption isotherms ₅₀ ). The results are shown in FIGS. 1A-1B.

The results indicate that AXL-mAb-Ch-A2, AXL-mAb-Ch-A3, AXL-mAb-Ch-B1, AXL-mAb-Ch-B2, AXL-mAb-Ch-B4 and AXL-mAb-Ch-C5 chimeric mabs can bind to human recombinant AXL, with EC50 of 44pM, 123.2pM, 31.1pM, 34.8pM, 16.6pM and 18pM, respectively.

Example 4 blocking of anti-AXL monoclonal antibody-mediated binding of AXL to GAS6

The AXL-GAS6 blocking assay is carried out by ELISA. The specific procedure was the same as described in example 3, except that 1.6ng of GAS6 protein (Acrobiosystems) was added as a ligand for AXL per well, and the bound ligand was detected by an anti-His tag antibody (HRP) (Sino Biological). The results are shown in FIGS. 2A-2B.

The results of the AXL-GAS6 blocking assay indicated that AXL-mAb-Ch-A2, AXL-mAb-Ch-A3, AXL-mAb-Ch-B1, AXL-mAb-Ch-B2, AXL-mAb-Ch-B4 and AXL-mAb-Ch-C5 chimeric mAbs could block the interaction between AXL and GAS6 with IC50 of 2.31nM, 5.09nM, 2.83nM, 2.07nM, 0.79nM and 2.31nM, respectively.

Example 5 binding of anti-AXL monoclonal antibodies to cancer cell lines

To measure the binding of AXL-mAb-Ch-A2, AXL-mAb-Ch-A3, AXL-mAb-Ch-B1, AXL-mAb-Ch-B2 and AXL-mAb-Ch-B4 chimeric mabs to cell surface associated AXL, flow cytometry was performed on a variety of cancer cell lines including 786-O, achn, a549, H226, SKOV3, HCT116 and HT 1080. LS174T cell line not expressing AXL was used as negative control. Each cell line (5 x10 ⁵ ) Incubated with monoclonal antibody (10. Mu.g/ml) for 60 min on ice. Cells were washed once with PBS containing 0.1% bovine serum albumin (PBSA) and resuspended in 200ml PBSA. Mu.l of anti-human IgG (gamma chain specific) -R-PE antibody (Merck) was then added and incubated for 60 minutes. Cells were washed once with PBSA and then used for flow cytometry analysis. The results are shown in fig. 3.

To measure the binding of AXL-mab-Ch-B1L and AXL-mab-Ch-C5 to cell surface associated AXL, cells HT1080 expressing AXL were subjected to flow cytometryAnd (5) performing surgery. Will be about 5 x 10 ⁵ Individual cells were incubated with antibody (five times serial dilutions starting at 50 μg/ml) for 1h on ice. Cells were washed twice with PBS containing 0.1% bovine serum albumin (PBSA) and resuspended in 100. Mu.l of PBSA. Mu.l of anti-human IgG (Fc specific) -FITC conjugate (Sigma) was then added and incubated for 30 min. Cells were washed twice with PBSA and then used for flow cytometry analysis. Half maximal binding (EC) was calculated by fitting the data to Langmuir adsorption isotherms ₅₀ ). The results are shown in fig. 4.

FIG. 3 shows that AXL-mAb-Ch-A2, AXL-mAb-Ch-A3, AXL-mAb-Ch-B1, AXL-mAb-Ch-B2 and AXL-mAb-Ch-B4 chimeric mAbs can bind to a variety of AXL-expressing cancer cell lines.

The results in FIG. 4 show that the AXL-mAb-Ch-B1L and the AXL-mAb-Ch-C5 chimeric mAbs bind HT1080 cells with EC50 of 0.247nM and 0.151nM, respectively.

Example 6 ADCC killing against human cancer cell lines mediated by anti-AXL monoclonal antibodies

To evaluate the ADCC effect of the anti-AXL mab of the present invention, HT1080 cells were used as target cells and Jurkat-CD16a-NFAT cells were used as effector cells. ADCC effect was mediated using the Stable-Lite luciferase assay system (Vazyme) according to the manufacturer's instructions. Briefly, 1X 10 was used ⁴ Individual HT1080 tumor cells and 2X 10 ⁵ ADCC assays were performed on individual Jurkat-CD16a-NFAT effector cells. For the negative control group, only Jurkat-CD16a-NFAT effector cells were added. The results are shown in FIGS. 5A-5B.

The results indicate that the AXL-mAb-Ch-B1L and the AXL-mAb-Ch-C5 chimeric mAbs can induce a visible ADCC effect at high concentrations. The antibody groups of AXL-mab-Ch-B1L and AXL-mab-Ch-C5 were able to detect luminescence in a dose-dependent manner beyond 400ng/mL (FIG. 5A), whereas luminescence was not detectable in the negative control group (FIG. 5B). The results indicate that ADCC effects are triggered by specific binding of AXL-mab-Ch-B1L and AXL-mab-Ch-C5 to the tumor cells HT1080 and immune cells expressing AXL. This assay demonstrates that the AXL-mAb-Ch-B1L and the AXL-mAb-Ch-C5 chimeric mAbs have a strong ability to induce ADCC against AXL-expressing tumor cells.

EXAMPLE 7 construction and preliminary characterization of anti-AXL bispecific antibodies

Bispecific T cell adaptors (bites) are a form of bispecific antibodies that direct cytotoxic T cells to kill cancer cells by binding both tumor antigen and T cell antigen (e.g., CD3 molecules on the surface of T cells). HBiTE described in PCT application No. PCT/US2018/016524 (incorporated herein by reference in its entirety) is one particular form of BiTE, in which the light chain comprises from N-terminus to C-terminus an anti-target VL domain, an anti-CD 3 VL-CL, and a monomeric human IgG1 Fc (e.g., mfc 7.2), and the heavy chain comprises from N-terminus to C-terminus an anti-target VH domain, an anti-CD 3 VH-CH1, and a monomeric human IgG1 Fc (e.g., mfc 7.2). Monomer fc7.2 contains two amino acid mutations (T366L and Y407H) that reduce Fc homodimerization. To generate axl×cd3 HBiTE, the VL and VH domains of the anti-AXL antibody are fused via a linker to the N-terminus of the VL and VH domains of the anti-CD 3 Fab, respectively. The anti-CD 3 Fab was further fused to the N-terminus of mfc 7.2. The light and heavy chains were constructed into vectors pBY for mammalian cell expression. The anti-AXL bispecific antibodies AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE were successfully constructed.

For expression and purification, bispecific antibodies were expressed in 293FS or CHO-S cells. The plasmid and transfection agent PEI were mixed in a 1:3 ratio and then added dropwise to 293FS or CHO-S cell cultures. Cells continue to grow for 5-7 days after transfection. Cell cultures were harvested by centrifugation at 8000rpm for 20 minutes. The culture supernatant containing the target protein was loaded onto Protein A Sepharose Fast Flow column chromatography (GE Healthcare) and purified according to the manufacturer's instructions.

AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE were well expressed in transiently transfected CHO-S cells and secreted into culture supernatant. On non-reducing SDS-PAGE, AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HbiTE showed an apparent molecular weight (aMW) of about 120 kDa. On reduced SDS-PAGE, the heavy and light chains were close to each other, with an apparent molecular weight of about 62kDa (data not shown).

CDR sequences of bispecific antibodies according to the Kabat numbering system are shown in table 4. The amino acid sequences of the light chain variable region (VL) and heavy chain variable region (VH) of the bispecific antibodies are shown in table 5. The complete light and heavy chain sequences of the bispecific antibodies are shown in table 6.

TABLE 4 CDR sequences of bispecific antibodies

TABLE 5 VL and VH sequences of bispecific antibodies

TABLE 6 heavy and light chain sequences of bispecific antibodies

/>

Example 8 binding of anti-AXL bispecific antibodies to AXL and CD3

To measure the binding affinity of the bispecific antibodies AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE for recombinant human AXL and human CD3 proteins, ELISA was performed as described in example 3, wherein the coating protein was human AXL or human CD3. The results are shown in FIGS. 6A-7B.

To measure the binding activity of the bispecific antibodies AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE to the dual targets, bridging ELISA was performed by using AXL-his proteins (AcroBiosystems) and CD3-Fc proteins (AcroBiosystems) as solid phage antigen and free antigen, respectively. The bound ligand was detected by anti-His tag antibody (HRP) (Sino Biological). The results are shown in FIGS. 8A-8B.

The results indicated that AXL-B1L-Hu1-LLG HBiTE bound human recombinant AXL with an EC50 of 0.254nM (fig. 6A) and human CD3 with an EC50 of 7.99nM (fig. 6B), AXL-C5-Hu1-LLG-1.2HBiTE bound human recombinant AXL with an EC50 of 0.247nM (fig. 7A) and human CD3 with an EC50 of 3.01nM (fig. 7B).

The results of the double-target bridging ELISA showed that AXL-B1L-Hu1-LLG HbiTE bound to double-target human recombinant AXL and CD3 with an EC50 of 9.75nM (FIG. 8A), and that AXL-C5-Hu1-LLG-1.2HbiTE bound to double-target human recombinant AXL and CD3 with an EC50 of 5.43nM (FIG. 8B).

Example 9 binding of anti-AXL bispecific antibodies to cancer cell lines

To measure the binding capacity of an anti-AXL bispecific antibody to cell surface associated AXL, flow cytometry was performed using the AXL positive cell line HT1080. Will be about 5 x 10 ⁵ Individual cells were incubated with antibody (five times serial dilutions starting at 20 μg/ml) for 1h on ice. Cells were washed twice with PBS containing 0.1% bovine serum albumin (PBSA) and resuspended in 100. Mu.l of PBSA. Mu.l of anti-human IgG (Fc specific) -FITC conjugate (Sigma) was then added and incubated for 30 min. Cells were washed twice with PBSA and then used for flow cytometry analysis. The results are shown in fig. 9.

The results show that AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE bind HT1080 with EC50 of 0.663nM and 1.485nM, respectively.

Example 10 in vitro T cell activation assay

T cell activation is initiated by recruitment of the T cell antigen receptor (TCR)/CD 3 complex and the co-stimulatory receptor CD 28. Co-recruitment of these receptors at the cell surface results in intracellular signaling events and activation of nuclear transcription factors such as the activating T-cell Nuclear Factor (NFAT). Specifically, recruitment of the TCR/CD3 complex results in phosphorylation and activation of PLC- γ, intracellular calcium flux, and transcriptional activation of the NFAT pathway. Thus, NFAT production can be used as a functional readout of T cell activation.

T cell activation assays were performed using the Promega T cell activation bioassay (NFAT) proliferation model (Cat. No.: J1601) according to the manufacturer's instructions. Briefly, AXL-expressing HT1080 tumor cells (5×10 ³ Individual cells/100 μl/well, suspended in RPMI 1640 complete medium) were inoculatedInto 96-well plates. At the same time, anti-CD 3 bispecific antibody and 1.4X10 were added in 50. Mu.L of RPMI 1640 complete medium ⁵ Individual TCR/CD3 effector cells (NFAT). Then, 50. Mu.L of a 5-fold serial dilution of antibody solution (from 2. Mu.g/mL) was added to each well accordingly (the highest final concentration was 1. Mu.g/mL). After 6 hours, bio-Glo was added ^TM And (3) a reagent. The assay was developed for 5-10 minutes at room temperature and monitored with a plate reading photometer.

The results of the T cell activation assay showed that AXL-B1L-Hu1-LLG HBiTE can activate TCR/CD3 effector cells with an EC50 of 0.289nM (FIG. 10), indicating that AXL-B1L-Hu1-LLG HBiTE has the ability to activate T cells in vitro in the presence of target cells.

Example 11 anti-AXL bispecific antibody mediated killing against human cancer cell lines

Bispecific T cell adaptors can bind both tumor antigen and T cell antigen (e.g., CD3 molecules on the surface of T cells), causing aggregation and activation of T cells, ultimately leading to killing of tumor cells. To evaluate the killing efficiency of the bispecific antibodies AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE, CCK8 assays were performed using the AXL-expressing tumor cell line HT1080 as target cell.

mu.L of the cell suspension (5X 10) ³ HT1080 cells/well, suspended in RPMI 1640 complete medium) were plated in duplicate into 96-well plates. At the same time, 1.4X10 s in 50. Mu.L of RPMI 1640 complete medium was added ⁵ PBMCs (effector cells: target cells ratio = 5:1). Then, 50. Mu.L of a 5-fold serial dilution of antibody solution (from 2. Mu.g/mL) was added to each well accordingly (the highest final concentration was 1. Mu.g/mL). After 48h, each well was supplemented with 100. Mu.L of 20% CCK-8 in RPMI 1640 complete medium (final concentration of 10% CCK-8) and at CO ₂ Incubate in incubator for 60 min. Cell killing activity was measured using an enzyme-labeled instrument according to the manufacturer's instructions. The results are shown in fig. 11.

The results show that AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HbiTE have strong killing efficiency against HT1080 cells, and can kill approximately 80% of tumor cells in the presence of PBMC. The EC50 of AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HbiTE against HT1080 cell killing were 4.309ng/ml and 1.821ng/ml, respectively. These results demonstrate that AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE have potent killing ability against AXL-expressing tumor cell line HT1080, confirming that these hbites have essentially in vitro antitumor efficacy worth further development.

Example 12 anti-AXL bispecific antibody mediated inhibition of tumor growth in mice

In vivo anti-tumor studies were performed in a humanized B-NDG mouse model to assess the efficacy of AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2 HBiTE. Briefly, 1.8X10 ⁶ Personal PBMC and 1.8X10 ⁶ Mixtures of individual HT1080 tumor cells were injected subcutaneously (s.c.) into the right armpit of B-NDG mice (5-7 weeks old, male) to create tumorigenic models. At the same time, AXL-B1L-Hu1-LLG HBiTE or AXL-C5-Hu1-LLG-1.2HbiTE (300. Mu.g/kg) or vector control was intraperitoneally injected into the corresponding mice three times per week. After treatment, tumor size was measured continuously for 2 weeks. After 2 weeks of treatment, mice were sacrificed and tumor weights were measured.

Tumor growth inhibition was calculated using the following formula:

(average body weight of control group-average body weight of antibody-treated group)/average body weight of control group.

The results showed that AXL-B1L-Hu1-LLG HBiTE showed effective inhibition of tumor growth at a dose of 300. Mu.g/kg (FIG. 12B). The 300 μg/kg dose group showed tumor growth inhibition of over 95%. AXL-C5-Hu1-LLG-1.2HBiTE also showed a tumor growth inhibition of more than 95% at a dose of 300. Mu.g/kg (FIG. 12A). In vivo studies have shown that anti-AXL bispecific antibodies AXL-B1L-Hu1-LLG HBiTE and AXL-C5-Hu1-LLG-1.2HBiTE can specifically and effectively inhibit growth of AXL-expressing tumor cells.

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments described herein may be employed. The following claims are intended to define the scope of the invention and methods and structures within the scope of these claims and their equivalents are covered thereby.

Claims

1. An antibody or antigen-binding fragment thereof that specifically binds AXL, said antibody or antigen-binding fragment thereof comprising a light chain variable region (VL) and a heavy chain variable region (VH), wherein

(i) The VL comprises amino acid sequences shown in SEQ ID NO:52-54, and said VH comprises amino acid sequences set forth in SEQ ID NOs: HCDR 1-3 as shown in 57-59; or alternatively

(ii) The VL comprises amino acid sequences shown in SEQ ID NO:62-64, and said VH comprises amino acid sequences set forth in SEQ ID NOs: 67-69, HCDR 1-3.

2. An antibody or antigen-binding fragment thereof according to claim 1, wherein

(i) The VL comprises a sequence identical to SEQ ID NO:51 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:56 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or alternatively

(ii) The VL comprises a sequence identical to SEQ ID NO:61, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:66 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iii) The VL comprises a sequence identical to SEQ ID NO:71 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:72 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iv) The VL comprises a sequence identical to SEQ ID NO:73, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:74 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

3. An antibody or antigen-binding fragment thereof according to claim 2, wherein

(i) The VL comprises the amino acid sequence set forth in SEQ ID NO:51 and said VH comprises the amino acid sequence set forth in SEQ ID NO:56, an amino acid sequence shown in seq id no; or alternatively

(ii) The VL comprises the amino acid sequence set forth in SEQ ID NO:61 and said VH comprises an amino acid sequence as set forth in SEQ ID NO:66, an amino acid sequence shown in seq id no; or alternatively

(iii) The VL comprises the amino acid sequence set forth in SEQ ID NO:71 and said VH comprises an amino acid sequence as set forth in SEQ ID NO:72, an amino acid sequence shown in seq id no; or alternatively

(iv) The VL comprises the amino acid sequence set forth in SEQ ID NO:73 and said VH comprises the amino acid sequence set forth in SEQ ID NO: 74.

4. An antibody or antigen binding fragment thereof according to any one of claims 1-3, wherein the antibody is an isotype selected from IgG, igA, igM, igE and IgD.

5. An antibody or antigen binding fragment thereof according to any one of claims 1-3, wherein the antibody is of a subtype selected from IgG1, igG2, igG3 and IgG 4.

6. The antibody or antigen-binding fragment thereof according to any one of claims 1-5, wherein the antigen-binding fragment is selected from the group consisting of Fab, fab ', F (ab') ₂ Fv, scFv and ds-scFv.

7. The antibody or antigen-binding fragment thereof according to any one of claims 1-6, wherein the antibody is a monoclonal antibody.

8. The antibody or antigen-binding fragment thereof according to claim 7, wherein the antibody comprises

(i) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:55, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:60 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(ii) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:65, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:70 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

9. The antibody or antigen-binding fragment thereof according to any one of claims 1-6, wherein the antibody is a bispecific antibody or a multispecific antibody.

10. The antibody or antigen-binding fragment thereof according to claim 9, wherein the antibody is a bispecific antibody further comprising a second antigen-binding region that binds a second antigen.

11. The antibody or antigen-binding fragment thereof according to claim 10, wherein the second antigen is a tumor-associated antigen or an immune cell antigen.

12. The antibody or antigen-binding fragment thereof according to claim 11, wherein the second antigen is a T cell antigen.

13. The antibody or antigen binding fragment thereof according to claim 12, wherein the T cell antigen is selected from the group consisting of T Cell Receptor (TCR), CD3, CD4, CD8, CD16, CD25, CD28, CD38, CD44, CD62L, CD69, ICOS, 4-1BB (CD 137), and NKG2D, or any combination thereof.

14. The antibody or antigen-binding fragment thereof according to claim 10, wherein the second antigen is CD3 and the second antigen-binding region comprises a VL and a VH, wherein the VL comprises an amino acid sequence set forth in SEQ ID NO:76-78, and said VH comprises amino acid sequences set forth in SEQ ID NOs: 81-83, HCDR 1-3.

15. The antibody or antigen-binding fragment thereof according to claim 14, wherein the second antigen-binding region comprises a VL comprising an amino acid sequence identical to SEQ ID NO:75, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

16. An antibody or antigen-binding fragment thereof according to claim 15, wherein the second antigen-binding region comprises a VL comprising the amino acid sequence set forth in SEQ ID NO:75, and said VH comprises an amino acid sequence as set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

17. The antibody or antigen-binding fragment thereof of any one of claims 14-16, wherein the VL of the second antigen-binding region is optionally linked to the C-terminus of the VL of the antibody that specifically binds AXL via a first linker, and the VH of the second antigen-binding region is optionally linked to the C-terminus of the VH of the antibody that specifically binds AXL via a second linker, wherein the first linker and the second linker are the same or different.

18. The antibody or antigen-binding fragment thereof according to claim 17, wherein the first linker comprises the amino acid sequence set forth in SEQ ID NO:87, and said second linker comprises the amino acid sequence set forth in SEQ ID NO:88, and a sequence of amino acids shown in seq id no.

19. The antibody or antigen-binding fragment thereof according to any one of claims 14-18, wherein the bispecific antibody comprises

(i) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:79, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:84 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(ii) A light chain and a heavy chain, said light chain comprising a sequence identical to SEQ ID NO:85, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:86 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity.

20. The antibody or antigen binding fragment thereof according to any one of claims 10-19, wherein the bispecific antibody is a bispecific T cell adapter (BiTE).

21. A bispecific antibody or antigen-binding fragment thereof comprising a first antigen-binding region comprising VL and VH that binds AXL and a second antigen-binding region comprising VL and VH that binds CD3,

wherein:

(i) The VL of the first antigen binding region comprises amino acid sequences as set forth in SEQ ID NOs: 52-54, and the VH of the first antigen binding region comprises an amino acid sequence set forth in SEQ ID NO: HCDR 1-3 as shown in 57-59; or alternatively

(ii) The VL of the first antigen binding region comprises amino acid sequences as set forth in SEQ ID NOs: 62-64, and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO: HCDR 1-3 as shown at 67-69;

and wherein

The VL of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:76-78, and the VH of said second antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:81-83, HCDR 1-3.

22. The bispecific antibody or antigen-binding fragment thereof according to claim 21, wherein

(i) The VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:51 has an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and the VH of the first antigen binding region comprises an amino acid sequence that is identical to SEQ ID NO:56 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or alternatively

(ii) The VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:61 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity, and the VH of the first antigen binding region comprises an amino acid sequence that is identical to SEQ ID NO:66 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iii) The VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:71, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:72 has an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity; or alternatively

(iv) The VL of the first antigen binding region comprises a sequence identical to SEQ ID NO:73, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:74 having an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity; or alternatively

And wherein

The VL of the second antigen binding region comprises a sequence identical to SEQ ID NO:75, and the VH of the second antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:80 has an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity.

23. The bispecific antibody or antigen-binding fragment thereof according to claim 22, wherein

(i) The VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:51, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:56, an amino acid sequence shown in seq id no; or alternatively

(ii) The VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:61, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:66, an amino acid sequence shown in seq id no; or alternatively

(iii) The VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:71 and the VH of the first antigen binding region comprises the amino acid sequence set forth in SEQ ID NO:72, an amino acid sequence shown in seq id no; or alternatively

(iv) The VL of the first antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:73, and the VH of the first antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:74, an amino acid sequence shown in seq id no;

and wherein

The VL of the second antigen binding region comprises the amino acid sequence as set forth in SEQ ID NO:75, and the VH of the second antigen binding region comprises an amino acid sequence as set forth in SEQ ID NO:80, and an amino acid sequence shown in seq id no.

24. A bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-23, wherein the VL of the second antigen-binding region is optionally linked to the C-terminus of the VL of the first antigen-binding region via a first linker, and the VH of the second antigen-binding region is optionally linked to the C-terminus of the VH of the first antigen-binding region via a second linker, wherein the first linker and the second linker are the same or different.

25. The bispecific antibody or antigen-binding fragment thereof according to claim 24, wherein the first linker comprises the amino acid sequence as set forth in SEQ ID NO:87, and said second linker comprises the amino acid sequence set forth in SEQ ID NO:88, and a sequence of amino acids shown in seq id no.

26. The bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-25, wherein the bispecific antibody comprises

27. The bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-26, wherein the bispecific antibody is a bispecific T cell adapter (BiTE).

28. A nucleic acid comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof according to any one of claims 1-20 or a bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-27.

29. A vector comprising a nucleic acid according to claim 28.

30. A host cell comprising a nucleic acid according to claim 28 or a vector according to claim 29.

31. A pharmaceutical composition comprising (i) an antibody or antigen-binding fragment thereof according to any one of claims 1-20, or a bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-27; and (ii) a pharmaceutically acceptable carrier or excipient.

32. The pharmaceutical composition according to claim 31, further comprising a second therapeutic agent.

33. The pharmaceutical composition according to claim 32, wherein the second therapeutic agent is selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs.

34. The pharmaceutical composition according to claim 32 or 33, wherein the second therapeutic agent is selected from the group consisting of a Bruton's Tyrosine Kinase (BTK) inhibitor, PI3K inhibitor, HDAC inhibitor, ERK inhibitor, MAPK inhibitor, PD-1 inhibitor, PD-L1 inhibitor, LAG3 inhibitor, CTLA-4 inhibitor, TIGIT inhibitor, TIM3 inhibitor, VEGF inhibitor, and glucocorticoid.

35. A conjugate comprising an antibody or antigen-binding fragment thereof according to any one of claims 1-20, or a bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-27, and a chemical moiety conjugated thereto.

36. The conjugate according to claim 35, wherein the chemical moiety is selected from the group consisting of a therapeutic agent, a detectable moiety, and an immunostimulatory molecule.

37. Use of an effective amount of an antibody or antigen-binding fragment thereof according to any one of claims 1-20, a bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-27, a pharmaceutical composition according to any one of claims 31-34, or a conjugate according to claim 35 or 36 in the manufacture of a medicament for treating cancer in a subject, wherein the cancer is an AXL positive cancer.

38. The use according to claim 37, wherein the cancer is selected from leukemia, lymphoma, myeloma, fibrosarcoma, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, colon cancer, colorectal cancer, melanoma and liver cancer.

39. The use according to claim 37 or 38, wherein the medicament is administered in combination with a second therapeutic agent.

40. The use according to claim 39, wherein the second therapeutic agent is selected from the group consisting of antibodies, chemotherapeutic agents, and small molecule drugs.

41. The use according to claim 39 or 40, wherein the second therapeutic agent is selected from the group consisting of a Bruton's Tyrosine Kinase (BTK) inhibitor, PI3K inhibitor, HDAC inhibitor, ERK inhibitor, MAPK inhibitor, PD-1 inhibitor, PD-L1 inhibitor, LAG3 inhibitor, CTLA-4 inhibitor, TIGIT inhibitor, TIM3 inhibitor, VEGF inhibitor, and glucocorticoid.