CN116334153A - Reductive amination enzyme and preparation method and application thereof - Google Patents

Abstract

The invention provides a reductive amination enzyme, a preparation method and application thereof. In particular, the invention relates to a reductive amination enzyme, functional identification thereof and in-vitro directed evolution. The reductive amination enzymes of the invention are the reductive amination enzymes AcRedAm from aspergillus californicus (Aspergillus calidoustus) and mutants thereof (including mutants of the reductive amination enzymes with significantly improved enantioselectivity towards the product rasagiline). The invention also provides an in vitro reductive amination method comprising the steps of: (i) Subjecting the (S1) ketone substrate or aldehyde substrate to a reductive amination reaction with the (S2) amine substrate in the presence of the reductive amination enzyme AcRedAm. The enzyme and the mutant can be used for synthesizing different products such as the enantiomerically pure rasagiline by an in vitro enzyme method.

Description

Reductive amination enzyme and preparation method and application thereof

Technical Field

The invention belongs to the fields of molecular biology and biocatalysis, and particularly relates to reductive amination enzyme, a preparation method and application thereof. The invention provides a novel reductive amination enzyme and a mutant thereof, and application thereof in synthesizing rasagiline and other compounds.

Background

Chiral amines are an important component of many natural products, active drugs, and other high value chemicals. In recent years, chiral amine drugs account for about 40% of new drugs approved by the FDA, and their market value is nearly up to $140 billion in 2020. Although many chemical strategies for preparing chiral amines are established, these strategies are limited by such factors as low reaction efficiency, low selectivity, and unfavorable environmental developments. In contrast, enzymes from renewable resources can provide excellent stereoselectivity and regioselectivity, and perform catalytic reactions under mild aqueous conditions. In addition, enzyme-mediated biocatalysis can also be performed without the use of toxic reagents and without the need for extensive protection and deprotection reaction steps, and thus the development of novel enzymes for use as catalysts in the development of green chemistry is a research hotspot in the field of current biosynthesis catalysis.

Over the last 20 years, a number of enzymatic pathways for the synthesis of chiral amines have been developed, wherein Transaminases (TAs), amine dehydrogenases (amahs) and Imine Reductases (IREDs) catalyzing the reductive amination of prochiral ketones to amines have all attracted considerable interest to scientists. However, related studies have shown that both TAs and amahs are currently limited to primary amine synthesis, requiring subsequent alkylation of chemical steps to synthesize chiral secondary and tertiary amines. While IRED can catalyze the reduction of NAD (P) H-dependent prochiral imines to chiral amines, it is preferred to reduce cyclic imine substrates with relatively low conversion to prochiral ketamines.

Notably, turner et al reported in detail in 2017 for the first time an NADPH-dependent enzyme, aspredAm, from Aspergillus oryzae (Aspergillus oryzae). One subfamily of IRED enzymes is designated as reductive amination enzymes (RedAms) which catalyze a broader intermolecular reductive amination of ketones and amines in aqueous media. The direct catalysis of ketone and amine molecule condensation by reductive amination enzyme RedAm to chiral amines shows a considerably higher efficiency and a higher economic savings in atoms compared to multi-step chemical routes and other biocatalysts, including TA and ambh. In particular, aspreed am is able to directly catalyze the reaction of 1-indanone and propargylamine to yield the antiparkinsonian drug (R) -rasagiline, and in some cases aspreed am still shows high reactivity at substrate ketone to amine ratios as low as 1:1. Subsequently, the research group also reported two novel thermostable retams of fungal origin that can use inexpensive ammonium salts as amine donors for the production of primary amines and continuous flow bioconversion under mild conditions. By utilizing NADPH cofactor regeneration systems and various amines as amino donors, the RedAm catalyzed reductive amination process can maximize atomic economy, thereby contributing to environmental sustainability. These findings indicate that the reductive amination enzyme (readam) has outstanding industrial advantages and great potential for use.

At present, the number of the reported reductive amidases (RedAm) is limited, and the custom requirement for industrial application is difficult to meet, so that the development of novel reductive amidases is urgently needed in the field.

Disclosure of Invention

The invention aims to provide a novel reductive amination enzyme (RedAm) and a preparation method and application thereof.

In a first aspect of the invention, there is provided an in vitro reductive amination process comprising the steps of:

(i) Subjecting the (S1) ketone substrate or aldehyde substrate to a reductive amination reaction with the (S2) amine substrate in the presence of the reductive amination enzyme AcRedAm.

In another preferred embodiment, the method comprises:

subjecting a ketone substrate or aldehyde substrate of formula Z1 and an amine substrate of formula Z2 to a reductive amination reaction in the presence of a reductive amination enzyme AcRedAm to form a reductive amination product of formula I:

wherein the method comprises the steps of

R1 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted (C1-C6 alkylene) -phenyl, wherein the substitution indicates that one or more H atoms are replaced by a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C3-C6 cycloalkyl, halogen, or combinations thereof;

r2 is H or methyl (CH 3);

or R1 and R2 together with the attached C atom form a substituted or unsubstituted 4-10 membered heterocyclic ring;

R3 is H, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C2-C8 alkenyl, substituted or unsubstituted C2-C8 alkynyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 6-10 aryl, substituted or unsubstituted (C1-C6 alkylene) -phenyl, substituted or unsubstituted (C3-C6 cycloalkylene) -phenyl, wherein the substitution indicates that one or more H atoms are substituted with a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C3-C6 cycloalkyl, halogen, or combinations thereof.

In another preferred embodiment, the 4-10 membered heterocyclic ring includes saturated or unsaturated heterocyclic ring, or a 5-7 heterocyclic ring which is benzo.

In another preferred embodiment, the substitution means that one or more H atoms are replaced by a substituent selected from the group consisting of: C1-C3 alkyl, C3-C6 cycloalkyl, halogen, C2-C6 ester, or a combination thereof.

In another preferred embodiment, the ketone or aldehyde substrate is selected from the group consisting of:

in another preferred embodiment, the amine substrate is selected from the group consisting of:

in another preferred embodiment, the reductive amination product of formula I is a chiral amine compound.

In another preferred embodiment, the reductive amination product of formula I is selected from the group consisting of: rasagiline (9 e), N-ethylcyclohexylamine (4 b), N-cyclopropylcyclohexylamine (4 f), N-benzylcyclohexylamine (4 i), benzylprop-2-ynylamine (6 e), N-benzylaniline (6 h), N-cyclopropyl-4-fluoroamphetamine (8 f).

In another preferred embodiment, the reductive amination enzyme AcRedAm is derived or derived from aspergillus californicus (Aspergillus calidoustus).

In another preferred embodiment, the reductive amination enzyme AcRedAm is selected from the group consisting of:

(a) A polypeptide having the amino acid sequence shown in SEQ ID NO. 1;

(b) A derivative polypeptide which is formed by substituting, deleting or adding one or more (such as 1-10) amino acid residues of the polypeptide with the amino acid sequence shown in SEQ ID NO. 1 or is formed by adding a signal peptide sequence and has reductive amination activity;

(c) A polypeptide derived from the polypeptide sequence of (a) or (b);

(d) Amino acid sequence identical to SEQ ID NO:1 or more than 85% or more than 90% (preferably 95%) of the amino acid sequence shown in (a) and has reductive amination activity.

In another preferred embodiment, the sequence (c) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to the sequence (a) or (b).

In another preferred embodiment, the polypeptide is the polypeptide of the amino acid sequence shown in SEQ ID NO. 1.

In a second aspect of the invention, there is provided an isolated or purified reductive amination enzyme having the sequence shown in SEQ ID No. 1 and having at least 1 amino acid mutation.

In another preferred embodiment, the reductive amination enzyme has the following activity: catalyzing the reductive amination reaction of (s 1) a ketone substrate or aldehyde substrate with (s 2) an amine substrate.

In another preferred embodiment, the reductive amination enzyme catalyzes the reductive amination of a ketone substrate or aldehyde substrate of formula Z1 and an amine substrate of formula Z2 to form a reductive amination product of formula I.

In another preferred embodiment, the reductive amination enzyme comprises wild type and mutant forms.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation at a position selected from the group consisting of: the 207 th, 214 th, 237 th position or the combination of the 207 th, 214 th and 237 th positions of the sequence shown in SEQ ID No. 1.

In another preferred embodiment, the original amino acid residue in the above-mentioned position is replaced by another amino acid residue, preferably by an amino acid selected from the group consisting of: alanine, serine, glycine or cysteine.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: W207I, W207K, W207N, W A, W207R, W207G, W207S, W207V, W L, W207H, W M, W207C, W207P, W207E, W207T, W Q.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: Y214M, Y214T, Y S, Y214N, Y214G, Y214H, Y214V, Y214R, Y214Q, Y214A, Y214L, Y214E, Y214F, Y214K, Y I, Y214D, Y214W, Y214C.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: Q237N, Q237S, Q237A, Q237G.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: W207C, Q237A.

In another preferred embodiment, the mutant reductase is a double mutant or triple mutant reductase.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: W207S/Y214C.

In another preferred embodiment, the mutant reductive amination enzyme further has a mutation at a position selected from the group consisting of: 117 th, 90 th, 172 th, 236 th or a combination of the sequences shown in SEQ ID No. 1.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: I117L, I117Y, I C, I117A, I117N, I E, I117T, I V or a combination thereof.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: L90I, L90C, L90Y, L90M, L H, L90F, L90A, L90T, L V or a combination thereof.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: L172E, L172I, L C, L172M, L172V or a combination thereof.

In another preferred embodiment, the mutant reductive amination enzyme has a mutation selected from the group consisting of: M236L, M236I, M S, M236C, M236A, M236V, M T, M236G or a combination thereof.

In another preferred embodiment, the reductive amination enzyme comprises an immobilized enzyme.

In a third aspect of the invention there is provided an isolated polynucleotide encoding a reductive amination enzyme according to the second aspect of the invention.

The invention also provides a polynucleotide which codes for wild type reductase AcRedAm and is subjected to codon optimization, and the sequence of the polynucleotide is shown as SEQ ID NO. 2.

In another preferred embodiment, the polynucleotide encoding the mutant reductase ACREDAM of the third aspect of the invention has a sequence substantially identical to that of SEQ ID NO. 2, except that the codon encoding the mutant amino acid at the specific position differs (e.g., for W207S/Y214C mutant reductase ACREDAM, the codon corresponding to amino acid 207 is the codon encoding amino acid S and the codon corresponding to amino acid 214 is the codon encoding C).

In a fourth aspect of the invention there is provided a vector comprising a polynucleotide according to the third aspect of the invention.

In another preferred embodiment, the vector comprises an expression vector, a shuttle vector, an integration vector.

In a fifth aspect of the invention there is provided a genetically engineered host cell comprising a vector according to the fourth aspect of the invention, or having integrated into its genome a polynucleotide according to the third aspect of the invention.

In another preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell.

In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell or a plant cell.

In another preferred embodiment, the host cell is a Saccharomyces cerevisiae cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as E.coli.

In a sixth aspect of the invention there is provided the use of a reductive amination enzyme according to the second aspect of the invention or a wild type reductive amination enzyme AcRedAm, for catalyzing a reductive amination reaction or for preparing a catalytic formulation for catalyzing a reductive amination reaction.

In another preferred embodiment, the reaction product of the reductive amination reaction comprises an isomer, or a non-isomer.

In another preferred embodiment, the reaction product is in the S configuration, R configuration, or a combination thereof.

In a seventh aspect of the present invention, there is provided a method for the in vitro synthesis of rasagiline by a reductive amination enzyme comprising the steps of:

in the presence of the reductive amination enzyme according to the second aspect of the invention or the wild type reductive amination enzyme AcRedAm catalyzes the reaction of 1-indanone and propargylamine to produce rasagiline.

In an eighth aspect of the present invention, there is provided a reaction system for performing a reductive amination reaction, said reaction system comprising:

(S0) a reductive amination enzyme according to the second aspect of the invention or a wild type reductive amination enzyme AcRedAm;

(S1) a ketone substrate or aldehyde substrate;

(S2) an amine substrate; and

(S3) optionally NADPH or NADPH regeneration module.

In another preferred embodiment, the NADPH regeneration module comprises: glucose Dehydrogenase (GDH), glucose.

In another preferred embodiment, the NADPH regeneration module reacts glucose with NADP+ under the catalysis of Glucose Dehydrogenase (GDH) to produce gluconolactone and NADPH.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows a diagram of the result of SDS-PAGE analysis of the purified reductase AcRedAm.

FIG. 2 shows a graph of the optimum pH results required for the reductive amination enzyme AcRedAm reaction.

FIG. 3 shows a graph of the optimum temperature results required for the reductive amination enzyme AcRedAm reaction.

FIG. 4 shows graphs of the results of Tm value (4 a) and temperature tolerance (4 b) of the reductive amination enzyme AcRedAm.

FIG. 5 shows a graph of the results of the reductive amination of ketone (5 a) and amine substrate (5 b) used in the screening of the substrate for the enzyme AcRedAm and the formation of the different product amines (5 c).

FIG. 6 shows graphs of the relative activity and enantioselectivity of saturated mutants at position L90 (6 a), position I117 (6 b), position L172 (6 c) and position M236 (6 d) in the reductive amination enzyme AcRedAm for the synthesis of rasagiline.

FIG. 7 shows graphs of the relative activity and enantioselectivity of saturated mutants at position W207 (7 a), position Y214 (7 b) and position Q237 (7 d) in the reductive amination enzyme AcRedAm for the synthesis of rasagiline.

FIG. 8 shows a graph of the relative activity and enantioselectivity of a double-point combinatorial mutant of the reductive amination enzyme AcRedAm for the synthesis of rasagiline.

Fig. 9 shows a graph of the results of optimizing the reaction conditions for the synthesis of rasagiline.

Wherein A shows the result of optimizing the 1-indenone substrate concentration; b shows the result of optimizing propargylamine substrate concentration; c shows the results of optimization of the glucose dehydrogenase GDH concentration; d shows the results of optimization of the concentration of the reductive amination enzyme AcRedAm.

FIG. 10 shows a graph of the results of the synthesis of rasagiline by the reductive amination enzyme AcRedAm and its mutant AcQ 237A.

FIG. 11 shows an HPLC analysis of the synthesis of rasagiline by the reductive amination enzyme AcRedAm.

Wherein A is a 1-indenone standard substance map; b is propargylamine standard substance map; c is a (R) -rasagiline standard substance map; d is a (S) -rasagiline standard substance map; e is a map of the catalytic reaction product of the reductive amination enzyme AcRedAm.

FIG. 12 shows an HPLC analysis of the synthesis of rasagiline by the reductive amination enzyme AcRedAm mutant.

Wherein A is an (R) -rasagiline standard substance map; b is a (S) -rasagiline standard substance map; c is a mutant Q237A catalytic reaction product map; d is a mutant Q237G catalytic reaction product map; e is the mutant Q237S catalytic reaction product map.

FIG. 13 shows a map of recombinant plasmid pET28a-AcRedAm of the invention.

Detailed Description

The present inventors have made extensive and intensive studies and, for the first time, unexpectedly developed a reductive amination enzyme AcRedAm. Specifically, the inventors developed and directed evolution engineered a reductive amination enzyme from mold ka Li Qu (Aspergillus calidoustus) to obtain mutants with improved final reductive amination activity, such as mutants AcW207C, acQ237A and AcW207S/Y214C with significantly improved enantioselectivity to the product rasagiline. The reductive amination enzyme AcRedAm and mutants thereof of the invention are useful for the enzymatic synthesis of a variety of useful compounds (including enantiomerically pure rasagiline) in vitro. The present invention has been completed on the basis of this finding.

Specifically, the inventor combines the database to screen through researching the sequence and the structure of the reductive amination enzyme based on the principles of protein structural similarity, conserved site analysis, host source diversity and the like. Subsequently, the screened gene is functionally expressed in an escherichia coli expression system, and the purified reductive amination enzyme AcRedAM is obtained after purification. Experiments prove that the reductive amination enzyme AcRedAm from Aspergillus calidoustus has a wide substrate spectrum, can catalyze a series of ketone and amine substrates to generate corresponding primary amine and secondary amine, can directly catalyze 1-indenone and propargylamine to generate rasagiline, has a conversion rate of 44%, and has an ee value of 44% (S).

The reductive amination enzyme of the invention

As used herein, the terms "reductive amination enzyme AcRedAm", "enzyme of the invention", "reductive amination enzyme of the invention" or "aminating enzyme of the invention", are used interchangeably and refer to the reductive amination enzyme AcRedAm. It is understood that the term includes both wild-type and mutant reductive amination enzymes AcRedAm (e.g., derived polypeptides derived from the reductive amination enzymes AcRedAm).

The novel reductive amination enzyme and the coding gene thereof provided by the invention are derived from Aspergillus calidoustus, and the reductive amination enzyme is named AcRedAm protein. The wild amino acid sequence of the protein is SEQ ID NO. 1, and the nucleotide sequence is SEQ ID NO. 2.

In the present invention, the reductive amination enzyme of the present invention may be a derivative protein having the same function as the protein shown in SEQ ID NO. 1 (i.e., having a reductive amination function) by substitution, deletion or addition of one or more amino acids.

The enzymes of the invention also include mutants of the reductive amination enzyme AcRedAm. Typically, the mutant is a reductase mutant obtained by replacing an amino acid residue at one or more positions of a wild-type reductase AcRedAm with another amino acid residue; preferred substitution positions are positions 207, 214, 237 or their corresponding positions of the amino acid sequence of the reductive amination enzyme AcRedAm represented by SEQ ID NO. 1. The mutant type reductase AcRedAm can catalyze 1-indenone and propargylamine to generate rasagiline, the activity is improved compared with a wild type, and the enantioselectivity is obviously improved compared with the wild type.

Further, the reductive amination enzyme mutant is a reductive amination enzyme mutant obtained by substituting an amino acid residue at one or more positions of the reductive amination enzyme of an amino acid sequence which shows at least 90% homology with wild type reductive amination enzyme AcRedAm with another amino acid residue; preferred substitution positions are positions 207, 214, 237 of the amino acid sequence of the reductive amination enzyme AcRedAm represented by SEQ ID NO. 1 or their corresponding positions, the mutant has improved activity in catalyzing the production of rasagiline from 1-indanone and propargylamine compared with the wild type, and the enantioselectivity is significantly improved compared with the wild type.

Still further, the other amino acid residue used for substitution of the original amino acid residue is preferably cysteine (amino acid abbreviation: C), methionine (amino acid abbreviation: M), alanine (amino acid abbreviation: a), serine (amino acid abbreviation: S) or glycine (amino acid abbreviation: G).

In the present invention, the nucleotide code corresponding to the mutation site of the reductive amination enzyme is understood as the nucleotide code encoded by "another amino acid residue" as described in the present invention.

In the invention, some preferred reductase mutants and genes encoding the same are also provided, the gene sequence of the original reductase is SEQ ID NO. 2 in the sequence table, and the original amino acid sequence is SEQ ID NO. 1 in the sequence table.

Some preferred mutation types are selected from the group consisting of: a mutant in which tryptophan at position 207 is substituted with cysteine, a mutant in which tyrosine at position 214 is substituted with methionine, a mutant in which glutamine at position 237 is substituted with alanine, a mutant in which glutamine at position 237 is substituted with serine, a mutant in which glutamine at position 237 is substituted with glycine, a mutant in which tryptophan at position 207 and tyrosine at position 214 are substituted with serine and cysteine, respectively, or a combination thereof.

As used herein, an "isolated polypeptide" means that the polypeptide is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. The person skilled in the art is able to purify the polypeptides using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the polypeptide can also be further analyzed by amino acid sequence.

The active polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be reductively aminated, or may be non-reductively aminated. The polypeptides of the invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogues of the polypeptides. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the polypeptide.

The polypeptide fragments, derivatives or analogues of the invention may be (i) polypeptides having one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, substituted, which may or may not be encoded by the genetic code, or (ii) polypeptides having a substituent in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound, such as a compound that extends the half-life of the polypeptide, for example polyethylene glycol, or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence, such as a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or fusion proteins with the formation of an antigen IgG fragment. Such fragments, derivatives and analogs are within the purview of one skilled in the art and would be well known in light of the teachings herein.

The preferred sequence of the polypeptide is shown as SEQ ID NO. 1, and the term also includes variants and derivatives of the sequence shown as SEQ ID NO. 1, which have the same function as the polypeptide shown. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10) amino acids, and addition of one or several (usually 20 or less, preferably 10 or less, more preferably 5 or less) amino acids at the C-terminal and/or N-terminal end. For example, in the art, substitution with amino acids of similar or similar properties does not generally alter the function of the protein. As another example, the addition of one or more amino acids at the C-terminus and/or N-terminus typically does not alter the function of the protein. The term also includes active fragments and active derivatives of the reductive amination enzymes AcRedAm of the invention. The invention also provides analogs of the polypeptides. These analogs may differ from the native human EGFRvA polypeptide by differences in amino acid sequence, by differences in modified forms that do not affect the sequence, or by both. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, by site-directed mutagenesis or other known techniques of molecular biology. Analogs also include analogs having residues other than the natural L-amino acid (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

Modified (typically without altering the primary structure) forms include: chemically derivatized forms of polypeptides such as acetylation or carboxylation, in vivo or in vitro. Modifications also include reductive amination, such as those resulting from reductive amination modifications performed during synthesis and processing of the polypeptide or during further processing steps. Such modification may be accomplished by exposing the polypeptide to an enzyme that performs reductive amination (e.g., a mammalian reductive amination enzyme or a dereductive amination enzyme). Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides modified to improve their proteolytic resistance or to optimize solubility.

The amino-or carboxy-terminus of a protein of the invention may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used with the present invention. For example, the tag may be FLAG, HA, HA, c-Myc, poly-His, poly-Arg, strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty1. These tags can be used to purify proteins.

For secretory expression (e.g., to the outside of the cell) of the translated protein, a signal peptide sequence such as pelB signal peptide or the like may be added to the amino-terminal end of the amino acid of the reductive amination enzyme AcRedAm. The signal peptide may be cleaved off during endocrine egress of the polypeptide from the cell.

The polynucleotides of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to the coding region sequence set forth in SEQ ID NOs.1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein having SEQ ID NO. 1, but differs from the coding region sequence set forth in SEQ ID NO. 2.

Polynucleotides encoding the mature polypeptide of SEQ ID NO. 1 include: a coding sequence encoding only the mature polypeptide; a coding sequence for a mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) of the mature polypeptide, and non-coding sequences.

The term "polynucleotide encoding a polypeptide" may include polynucleotides encoding the polypeptide, or may include additional coding and/or non-coding sequences.

The invention also relates to variants of the above polynucleotides which encode polypeptides having the same amino acid sequence as the invention or fragments, analogs and derivatives of the polypeptides. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

The invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The invention relates in particular to polynucleotides which hybridize under stringent conditions (or stringent conditions) to the polynucleotides of the invention. In the present invention, "stringent conditions" means: (1) Hybridization and elution at lower ionic strength and higher temperature, e.g., 0.2 XSSC, 0.1% SDS,60 ℃; or (2) adding denaturing agents such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll,42℃and the like during hybridization; or (3) hybridization only occurs when the identity between the two sequences is at least 90% or more, more preferably 95% or more. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO. 1.

The invention also relates to nucleic acid fragments which hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides or more in length. The nucleic acid fragments can be used in nucleic acid amplification techniques (e.g., PCR) to determine and/or isolate polynucleotides encoding the reductive amination enzyme AcRedAm protein.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, and more preferably purified to homogeneity.

The full-length sequence of the reductase AcRedAm nucleotide or the fragment thereof of the invention can be obtained by PCR amplification, recombinant methods or artificial synthesis. For the PCR amplification method, primers can be designed according to the nucleotide sequences disclosed in the present invention, particularly the open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, it is already possible to obtain the DNA sequences encoding the proteins of the invention (or fragments or derivatives thereof) entirely by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors, for example) and cells known in the art. In addition, mutations can be introduced into the protein sequences of the invention by chemical synthesis.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, it is preferable to use RACE method (RACE-cDNA end rapid amplification method), and primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to vectors comprising the polynucleotides of the invention, as well as host cells genetically engineered with the vectors of the invention or the coding sequences of the reductive amination enzyme AcRedAm protein, and methods for producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequences of the invention can be used to express or produce recombinant reductive amination enzyme AcRedAm polypeptides by conventional recombinant DNA techniques. Generally, there are the following steps:

(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a reductive amination enzyme AcRedAm polypeptide of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) Host cells cultured in a suitable medium;

(3) Isolating and purifying the protein from the culture medium or the cells.

In the present invention, the reductive amination enzyme AcRedAm polynucleotide sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Any plasmid or vector may be used as long as it is replicable and stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translational control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequence encoding the reductive amination enzyme AcRedAm and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.coli; a lambda phage PL promoter; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, LTRs from retroviruses, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or viruses thereof. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

In addition, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences as described above, as well as appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, COS, 293 cells, or Bowes melanoma cells.

In another preferred embodiment, suitable host cells include gram-positive bacteria such as Bacillus subtilis, gram-negative bacteria such as Escherichia coli, actinomycetes such as Streptomyces, yeasts such as Saccharomyces cerevisiae, fungi such as Aspergillus, and cells thereof are host cells of commonly used recombinant vectors.

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase the transcription of a gene. Examples include the SV40 enhancer 100 to 270 base pairs on the late side of the origin of replication, the polyoma enhancer on the late side of the origin of replication, and adenovirus enhancers.

It will be clear to a person of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E.coli, competent cells, which are capable of absorbing DNA, can be obtained after an exponential growth phase and treated by the CaCl2 method using procedures well known in the art. Another approach is to use MgCl2. Transformation can also be performed by electroporation, if desired. When the host is eukaryotic, the following DNA transfection methods may be used: calcium phosphate co-precipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The transformant obtained can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed in a cell, or on a cell membrane, or secreted outside the cell. If desired, the recombinant proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Such methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods.

Application of

The invention also provides the use of the reductive amination enzyme AcRedAm of the invention, in particular in catalyzing the reductive amination of (S1) ketone substrates or aldehyde substrates with (S2) amine substrates.

A preferred example is for the synthesis of pharmaceutical compounds or intermediates. Representatively, the reductive amination enzyme AcRedAm of the invention can be used to prepare rasagiline and like compounds.

(R) -rasagiline, a potent antiparkinsonian drug in the rasagiline product produced by the catalysis of the enzyme reductase (RedAm), has also been shown to have significant cardioprotective activity. The reductive amination enzyme AcRedAm of the invention can catalyze the production of single enantiomer pure rasagiline.

Because of the significantly improved enantioselectivity of certain mutant reductive amidases AcRedAm of the invention to the product rasagiline (e.g., the reductive amidase mutants AcW, 207, C, acQ237A and AcW, 207S/Y214C), they are useful for enzymatic synthesis of enantiomerically pure rasagiline in vitro.

Typically, the present invention provides a method for synthesizing the corresponding primary and secondary amines in vitro using the reductive amination enzymes of the present invention. In the method, corresponding ketone and amine are taken as raw materials, and corresponding product amine can be directly generated under the catalysis of reductive amination enzyme.

Preferably, in the present invention, the conversion rate of the catalytic reaction of the reductive amination enzyme AcRedAm is 20% -96% under the optimized conditions by adopting the reductive amination enzyme AcRedAm or the mutant.

Preferably, the molar ratio of ketone to amine substrate is from 1:1 to 1:50.

Preferably, the ketone concentration is 5mM/L and the amine concentration is 5-250 mM/L.

Preferably, the hydrophilic organic solvent is dimethyl sulfoxide (DMSO).

Preferably, the final concentration of the hydrophilic organic solvent in the reaction system is 2%.

Method for synthesizing rasagiline

In the present invention, there is also provided a method for in vitro synthesis of rasagiline using a reductive amination enzyme of the invention. Typically, the method comprises: 1-indenone and propargylamine are used as raw materials, and rasagiline can be directly generated under the catalysis of reductive amination enzyme.

Experiments show that the enzyme of the invention is particularly suitable for synthesizing enantiomerically pure rasagiline by in vitro enzymatic conversion.

Preferably, the reductase AcRedAm is a mutant thereof, and under proper conditions, the activity of the mutant of the reductase AcRedAm for catalyzing 1-indenone and propargylamine to generate rasagiline is 1.2-1.3 times that of the wild type, and the ee value is increased to 99%.

Preferably, the molar ratio of 1 indenone to propargylamine is 1:50.

Preferably, the concentration of 1 indenone is 5mM/L and the concentration of propargylamine is 250mM/L.

Preferably, the hydrophilic organic solvent is dimethyl sulfoxide (DMSO).

Preferably, the final concentration of the hydrophilic organic solvent in the reaction system is 2%.

The main advantages of the invention include:

1. the reductive amination enzyme of the invention is used for synthesizing corresponding primary amine and secondary amine in an in-vitro enzymatic method, and the conversion rate of substrate ketone and amine can reach 20% -96%.

2. The conversion rate of rasagiline synthesized by the in vitro enzyme method to substrate 1-indenone and propargylamine can reach 70%; under the same conditions, the activity of the mutant for catalyzing 1-indenone and propargylamine to generate rasagiline is 1.2-1.3 times that of the wild type, and the ee value is improved to 99%.

3. The reductive amination enzyme mutant successfully realizes the synthesis of single enantiomer pure rasagiline in vitro by an enzyme method.

4. The reductive amination enzyme and the mutant thereof obtained by the invention can be used for synthesizing rasagiline by an in-vitro enzyme method, are a novel production method different from the prior production technology, and have the advantages of simplified production process, low consumption and environmental protection.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.

Materials and reagents

General description of the sources of the biological materials described herein:

1. primer synthesis: the primers used in the present invention were all prepared by synthesis from Huada gene company.

2. PrimeSTAR Max DNA polymerase used in the experiment was purchased from TakaRa company; the DNA gel recovery kit and plasmid miniprep reagent used and were all purchased from Axygen.

EXAMPLE 1 screening for reductive amination enzymes

Based on structural analysis of the reductive amination enzyme, and based on the principles of protein structural similarity, conserved site analysis, diversity of host sources and the like, databases of different species are screened, and candidate objects are cloned and verified, so that the reductive amination enzyme is obtained.

Specifically, in this example, the present invention is based on the screening that the obtained reductase is the reductase AcRedAm derived from Aspergillus calidoustus and its coding sequence. The amino acid sequence is shown as SEQ ID No. 1.

MSTITLFGLGAMGKALAAKYIEKGYTTTIWNRTPSKAAPLVEKGAKLANTVGEGLASADLIILCLLDNASVRQTLDQATAALNGKTVINLTNGTPSQARETSEWVISHGAQYIHGGIMAVPDMIGSPHAVLLYSGESAETFSRVEAHLSHLGTSKFLGTDPGSASLHDLALLSGMYGLFSGFFHATALVKSQPGTTATGFVQLLTPWLSAMTHYLGALAKQIDEGDYATQGSNMAMQVTGVQNIVRASEEAGVTADLIMPILGRMTRAAEAGYADVDVSAVIEFMKE(SEQ ID No:1)

The AcRedAm gene was codon optimized for expression in e. The optimized coding sequence is shown as SEQ ID No. 2.

ATGAGCACCATTACCCTGTTCGGTCTGGGTGCGATGGGCAAGGCGCTGGCGGCGAAGTACATCGAGAAAGGCTATACCACCACCATTTGGAACCGTACCCCGAGCAAAGCGGCGCCGCTGGTTGAGAAGGGTGCGAAACTGGCGAACACCGTTGGTGAAGGTCTGGCGAGCGCGGACCTGATCATTCTGTGCCTGCTGGATAACGCGAGCGTGCGTCAAACCCTGGACCAAGCGACCGCGGCGCTGAACGGCAAGACCGTTATCAACCTGACCAACGGTACCCCGAGCCAGGCGCGTGAGACCAGCGAATGGGTGATTAGCCACGGCGCGCAATACATCCACGGTGGCATTATGGCGGTGCCGGATATGATCGGTAGCCCGCACGCGGTTCTGCTGTATAGCGGCGAGAGCGCGGAAACCTTCAGCCGTGTTGAAGCGCACCTGAGCCACCTGGGTACCAGCAAATTTCTGGGTACCGACCCGGGTAGCGCGAGCCTGCACGATCTGGCGCTGCTGAGCGGCATGTACGGCCTGTTCAGCGGCTTCTTTCATGCGACCGCGCTGGTTAAAAGCCAACCGGGTACCACCGCGACCGGTTTTGTTCAACTGCTGACCCCGTGGCTGAGCGCGATGACCCACTACCTGGGTGCGCTGGCGAAACAGATTGACGAGGGTGATTATGCGACCCAAGGCAGCAACATGGCGATGCAGGTGACCGGTGTTCAAAACATCGTTCGTGCGAGCGAGGAAGCGGGCGTTACCGCGGACCTGATCATGCCGATTCTGGGTCGTATGACCCGTGCGGCGGAAGCGGGTTATGCGGACGTGGATGTTAGCGCGGTGATCGAGTTTATGAAGGAATAA(SEQ ID No:2)

The sequence shown in SEQ ID No. 2 was synthesized by total gene synthesis, and cleavage sites NdeI and XhoI were added at both ends, and the full-length sequence was cloned into NdeI and XhoI cleavage sites of commercially available pET28a (+) plasmids.

EXAMPLE 2 expression and purification of reductive amination enzymes

The recombinant expression plasmid heat shock of the screening gene is transformed into competent cells of escherichia coli BL21 (DE 3) to carry out gene expression and protein purification. Culturing recombinant bacteria until OD is 0.6-0.8, adding IPTG to final concentration of 0.5mM, and inducing culture at low temperature of 18deg.C and 220rpm overnight.

The cells were collected by centrifugation and resuspended in 100mM Tris-HCl buffer (pH 8.0, 300mM NaCl,30mM imidazole). 250mL of the cultured cells were finally resuspended in 40mL of a buffer, the cells were disrupted using a high-pressure cell disrupter (4-6deg.C, 700 pa), the disrupted cells were centrifuged at 12000rpm for 30min (4deg.C), the supernatant was collected again and repeated for 12000rpm for 30min (4deg.C), the supernatant was collected and purified by Ni-NTA column affinity, the protein was eluted with 100mM Tris-HCl buffer (pH 8.0, 300mM NaCl,50mM imidazole), the protein was eluted with 100mM Tris-HCl buffer (pH 8.0, 300mM NaCl,250mM imidazole), and the protein was purified by concentration and desalting.

Purified proteins were stored in 100mM Tris-HCl buffer (pH 8.0), and the purified proteins were electrophoretically detected by 12% SDS-PAGE, and the protein concentration was measured using a Bradford protein concentration measuring kit (Shanghai Biotechnology).

The results are shown in FIG. 1. The results showed a clear band at 30.1kDa, which indicates that the target protein AcRedAm has been purified.

Example 3 determination of the enzymatic Properties of the reductive amination enzyme AcRedAm

In this example, the enzymatic properties of the recombinant reductase AcRedAm prepared in example 2 were determined.

In the enzymatic assay reaction of the reductive amination enzyme AcRedAm and mutants thereof, NADPH cofactor regeneration is provided by means of a coupled Glucose Dehydrogenase (GDH).

3.1. Determination of optimum pH and optimum temperature for the reductive amination enzyme AcRedAm:

the enzyme activities of AcRedAm are respectively studied at different pH values (7.0, 8.0, 9.0 and 10.0), and the reaction system is as follows: 1mg/mL AcRedAm pure enzyme, 0.7mg/mL GDH (Albumin), 30mM D-glucose, 1mM NADP+, 5mM cyclohexanone, 5mM cyclopropylamine (in buffer adjusted to pH 9.0), and 2% (v/v) DMSO. The final reaction volume was made up to 500. Mu.L using Tris-HCl buffer. The reaction was incubated at 25℃for 24 hours with shaking at 220 rpm. Then, 30. Mu.L of 10M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using GC-FID. The relative enzyme activities under different pH reaction conditions were calculated with the highest enzyme activity defined as 100%.

The results are shown in FIG. 2. The results show that AcRedAm has high activity at pH 9.0.

3.2. Determination of the optimum temperature of the reductive amination enzyme AcRedAm:

the enzyme activities of AcRedAm are respectively explored at different temperatures (20 ℃, 25 ℃, 30 ℃ and 35 ℃), and the reaction system is as follows: 1mg/mL AcRedAm pure enzyme, 0.7mg/mL GDH (Albumin), 30mM D-glucose, 1mM NADP+, 5mM cyclohexanone, 5mM cyclopropylamine (in-situ)In buffer at pH 9.0) and 2% (v/v) DMSO. The final reaction volume was made up to 500. Mu.L using Tris-HCl buffer. The reaction was incubated at different temperatures for 24 hours with shaking at 220 rpm. Then, 30. Mu.L of 10M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using GC-FID. The relative enzyme activities under the reaction conditions of different temperatures were calculated with the highest enzyme activity defined as 100%.

The results are shown in FIG. 3. The results show that AcRedAm has high activity at 25 ℃.

3.3. Tm value determination of the reductive amination enzyme AcRedAm:

tm values of AcRedAm were determined using a Differential Scanning Calorimeter (DSC). The Tm value was determined by recording the heat capacity (Cp) at various temperatures (30-80 ℃) to investigate the unfolding of the enzyme.

The results are shown in FIG. 4 a. The results showed that AcRedAm had a Tm of 45 ℃.

3.4. Thermal stability assay of the reductive amination enzyme AcRedAm:

enzyme activities of AcRedAm are explored after enzyme liquid is treated for different time (0 min, 20min, 40min and 60 min) at 50 ℃, and a reaction system is as follows: 1mg/mL AcRedAm pure enzyme, 0.7mg/mL GDH (Albumin), 30mM D-glucose, 1mM NADP+, 5mM cyclohexanone, 5mM cyclopropylamine (in buffer adjusted to pH 9.0), and 2% (v/v) DMSO. The final reaction volume was made up to 500. Mu.L using Tris-HCl buffer. The reaction was incubated at 25℃for 24 hours with shaking at 220 rpm. Then, 30. Mu.L of 10M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using GC-FID.

The results are shown in FIG. 4 b. The results show that AcRedAm has a certain thermal stability. After 20min treatment at 50 ℃, the activity of AcRedAm decreased by approximately 50%.

3.5. Substrate profiling of the reductive amination enzyme AcRedAm:

the reaction system is as follows: 1mg/mL AcRedAm pure enzyme, 0.7mg/mL GDH (Albumin), 30mM D-glucose, 1mM NADP+, 5mM ketoneSubstrate, amine substrate in appropriate ratio (in buffer adjusted to pH 9.0) and 2% (v/v) DMSO. The final reaction volume was made up to 500. Mu.L using Tris-HCl (pH 9.0) buffer. The reaction was incubated at 25℃for 24 hours with shaking at 220 rpm. Then, 30. Mu.L of 10M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using HPLC or GC-FID.

The results are shown in FIG. 5. The results show that the reductive amination enzyme AcRedAm has obvious preference for amine substrates e and f and moderate to excellent conversion reducing capability for both aliphatic and aromatic ketone substrates.

In these reactions, the enzyme catalyzes the reaction of ketone and amine at equimolar concentrations to achieve 95% conversion, as shown in the reaction of 4f in fig. 5; the conversion of catalytic ketone substrate 1 and ketone substrate 3 (cyclopentanone) to equimolar ratios of e, f or i, respectively, is between 20% and 64%; the reaction of the amine substrate i (benzylamine) and the ketone substrate 4 or 5 to form the secondary amine with equal molar equivalents is catalyzed to achieve a conversion of 37% to 69%.

These results all indicate that the enzyme of the present invention has the activity of catalyzing the reductive amination reaction of a ketone substrate and an amine substrate and is therefore classified as a true reductive amination enzyme.

In the reaction of catalytic ketone substrate 2 and 20 molar equivalents of amine substrate e or f, the conversion of the reaction can reach 38% and 34%, respectively, with an ee value of 13% for the product 2 e. Wherein the amine substrate a and the ketone substrate 4 (cyclohexanone) can be directly catalyzed by the enzyme to generate the cyclohexylamine, and the conversion rate reaches 96 percent.

In the reaction of the catalytic substrate benzaldehyde 6 and 4 molar equivalents of the amine substrate b, e, f, h or i to secondary amine, the conversion is between 33% and 72%.

In catalyzing the reaction of some ketone substrates such as 7,8 with amine substrates e, f, respectively, the conversion is between 34% and 69%. Notably, 4a,4b,4f,4i,6e,6h and 8f in the products of these reactions can be used as relevant backbone precursors for the synthesis of some relevant drugs.

Alternatively, acRedAm can synthesize rasagiline 9e directly starting from ketone substrate 9 (1-indenone) and propargylamine e with a conversion of 44% and an ee value of 44% (S).

EXAMPLE 4 construction of the reductive amination enzyme AcRedAm mutant and enzyme Activity assay

In this example, the enzyme AcRedAm has the activity characteristic of catalytic synthesis of rasagiline, and is subjected to directed evolution modification by rational design of selection sites based on protein homology modeling and molecular docking analysis to obtain mutants capable of synthesizing enantiomerically pure rasagiline.

The recombinant plasmid pET28a-AcRedAm is used as a template (figure 13), a pair of complementary oligonucleotides with mutation sites as degenerate bases (NNK) are used as primers, and Primestar high-fidelity enzyme is used for carrying out full-plasmid PCR amplification, so that the recombinant plasmid with specific mutation sites is obtained. The primer sequences were as follows:

Mutants corresponding to the substitution of leucine at position 90 in SEQ ID NO. 2 with other 19 amino acids:

L90-F:AAGACCGTTATCAACNNKACCAACGGTA(SEQ ID No:3)

L90-R:MNNGTTGATAACGGTCTTGCCGTTCA(SEQ ID No:4)

mutants corresponding to the substitution of isoleucine at position 117 of SEQ ID NO. 2 with the other 19 amino acids:

I117-F:TACATCCACGGTGGCNNKATGGCGGTGC(SEQ ID No:5)

I117-R:MNNGCCACCGTGGATGTATTGCGCG(SEQ ID No:6)

mutants corresponding to the substitution of leucine at position 172 in SEQ ID NO. 2 with other 19 amino acids:

L172-F:CACGATCTGGCGCTGNNKAGCGGCATGT(SEQ ID No:7)

L172-R:MNNCAGCGCCAGATCGTGCAGGCTCG(SEQ ID No:8)

mutants corresponding to the substitution of tryptophan at position 207 with other 19 amino acids in SEQ ID NO. 2:

W207-F:CAACTGCTGACCCCGNNKCTGAGCGCGA(SEQ ID No:9)

W207-R:MNNCGGGGTCAGCAGTTGAACAAAACCG(SEQ ID No:10)

mutants corresponding to the substitution of tyrosine 214 with other 19 amino acids in SEQ ID NO. 2:

Y214-F:AGCGCGATGACCCACNNKCTGGGTGCGC(SEQ ID No:11)

Y214-R:MNNGTGGGTCATCGCGCTCAGCCAC(SEQ ID No:12)

mutants corresponding to the substitution of methionine at position 236 in SEQ ID NO. 2 with other 19 amino acids:

M236-F:GGCAGCAACATGGCGNNKCAGGTGACCG(SEQ ID No:13)

M236-R:MNNCGCCATGTTGCTGCCTTGGGTC(SEQ ID No:14)

mutants corresponding to the substitution of glutamine at position 237 in SEQ ID NO. 2 with 19 other amino acids:

Q237-F:AGCAACATGGCGATGNNKGTGACCGGTG(SEQ ID No:15)

Q237-R:MNNCATCGCCATGTTGCTGCCTTGG(SEQ ID No:16)

the amplification system is as follows: 20ng of recombinant plasmid template, 1ul of primer (10 um) each, 25ul of PrimeSTAR Max DNA polymerase, and additional double distilled water to 50ul. The amplification conditions were: pre-denaturation at 98℃for 1 min, denaturation at 98℃for 10 sec, annealing at 60℃for 30 sec, extension at 72℃for 1 min 45 sec for 25 cycles. After the completion of the reaction, the amplified product was detected by 0.8% agarose gel electrophoresis. The product was recovered by PCR product purification kit, digested with DpnI enzyme (NEB Co.) at 37℃for 2 hours, and the original template was degraded. The digested product was transformed into E.coli BL21 (DE 3) competent cells, plated onto LB agar plates containing 50ug/mL kanamycin, cultured overnight at 37℃and screened for positive clones, and sequenced. Obtaining the saturated mutant recombinant strain of the appointed site of the reductive amination enzyme AcRedAm.

A saturated mutant purified protein of the designated site of the reductive amination enzyme AcRedAm was obtained as in example 2.

The mutant enzyme activity measurement reaction system comprises: 1mg/mL mutant pure enzyme, 0.7mg/mL GDH (Aladine), 30mM D-glucose, 1mM NADP+, 5mM 1-indenone, 250mM propargylamine (in buffer adjusted to pH 9.0), and 2% (v/v) DMSO. The final reaction volume was made up to 500. Mu.L using Tris-HCl (pH 9.0) buffer. The reaction was incubated at 25℃for 24 hours with shaking at 220 rpm. Then, 30. Mu.L of 10M NaOH was added to quench the reaction. Reverse-rotationThe mixture was extracted twice with 500. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using HPLC or GC-FID.

The results are shown in FIG. 6. The result shows that the L90 locus is a key locus influencing correct folding of AcRedAm, only 10 mutants in the saturated locus mutant can be obtained through soluble expression and purification, and the purified mutant has little influence on the enantioselectivity of the product rasagiline. The activity of most of the mutants in saturated mutants at positions I117, L172 and M236, which are key sites affecting the catalytic activity of AcRedAm, was reduced, wherein mutant L172V exhibited moderate enantioselectivity to (R) -rasagiline with an ee value of 40%.

The results are shown in FIG. 7. The results show that some mutants have increased activity and most mutants have very high enantioselectivity to (S) -rasagiline, and the ee value can reach >99% in the saturated mutants at positions 207 and 214. Mutant W207C showed the highest activity, 1.2 times that of the wild type. Of the saturated mutants at position 237, the activity of most mutants was reduced, but some mutants such as Q237N, Q237S, Q237G and Q237A had moderate to excellent enantioselectivity to (R) -rasagiline with ee values ranging from 40% to >99%. The best mutant is Q237A, which has 70% activity compared with the wild type, very high enantioselectivity to (R) -rasagiline and ee value of >99%.

The plasmid of the mutant (Y214T, Y214I, Y214G, Y C or Y214M) with improved activity, which is selected from the 214 site saturated mutants, is used as a template, and a pair of complementary oligonucleotides with the mutant (W207A, W207S, W207C, W207V, W H or W207M) with improved activity in the 207 site saturated mutant are used as primers, and Primestar high-fidelity enzyme is used for carrying out full plasmid PCR amplification, so that the recombinant plasmid with specific mutation sites is obtained. The primer sequences were as follows:

A mutant corresponding to substitution of tryptophan at position 207 with alanine and substitution of tyrosine at position 214 with one of threonine, isoleucine, glycine, cysteine or methionine in SEQ ID No. 2:

W207A-F:CAACTGCTGACCCCGGCGCTGAGCGCG(SEQ ID No:17)

W207A-R:GCCGGGGTCAGCAGTTGAACAAAACCG(SEQ ID No:18)

a mutant corresponding to the substitution of tryptophan at position 207 with serine and the substitution of tyrosine at position 214 with one of threonine, isoleucine, glycine, cysteine or methionine in SEQ ID NO. 2:

W207S-F:CAACTGCTGACCCCGAGTCTGAGCGCGA(SEQ ID No:19)

W207S-R:ACTCGGGGTCAGCAGTTGAACAAAACCG(SEQ ID No:20)

a mutant corresponding to substitution of tryptophan at position 207 with cysteine and substitution of tyrosine at position 214 with one of threonine, isoleucine, glycine, cysteine or methionine in SEQ ID No. 2:

W207C-F:ACTGCTGACCCCGTGTCTGAGCGCGATGACCCACTA(SEQ ID No:21)

W207C-R:ACACGGGGTCAGCAGTTGAACAAAACCGGTCG(SEQ ID No:22)

a mutant corresponding to substitution of valine for tryptophan at position 207 and substitution of one of threonine, isoleucine, glycine, cysteine or methionine for tyrosine at position 214 in SEQ ID No. 2:

W207V-F:CAACTGCTGACCCCGGTGCTGAGCGCGATGACCCACT(SEQ ID No:23)

W207V-R:ACCGGGGTCAGCAGTTGAACAAAACCGGTCG(SEQ ID No:24)

a mutant corresponding to substitution of tryptophan at position 207 with histidine and substitution of tyrosine at position 214 with one of threonine, isoleucine, glycine, cysteine or methionine in SEQ ID No. 2:

W207H-F:CAACTGCTGACCCCGCATCTGAGCGCGATGACCCACTA(SEQ ID No:25)

W207H-R:ATGCGGGGTCAGCAGTTGAACAAAACCGGTCG(SEQ ID No:26)

a mutant corresponding to the substitution of tryptophan at position 207 with methionine and the substitution of tyrosine at position 214 with one of threonine, isoleucine, glycine, cysteine or methionine in SEQ ID NO. 2:

W207M-F:CAACTGCTGACCCCGATGCTGAGCGCGATGACCCACT(SEQ ID No:27)

W207M-R:ATCGGGGTCAGCAGTTGAACAAAACCGGTCG(SEQ ID No:28)

A saturated mutant purified protein of the designated site of the reductive amination enzyme AcRedAm was obtained as in example 2.

The mutant enzyme activity measurement reaction system comprises: 1mg/mL mutant pure enzyme, 0.7mg/mL GDH (Aladine), 30mM D-glucose, 1mM NADP+, 5mM 1-indenone, 250mM propargylamine (in buffer adjusted to pH 9.0), and 2% (v/v) DMSO. The final reaction volume was made up to 500. Mu.L using Tris-HCl (pH 9.0) buffer. The reaction was incubated at 25℃for 24 hours with shaking at 220 rpm. Then, 30. Mu.L of 10M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using HPLC or GC-FID.

The results are shown in FIG. 8. The results show that the activity of the combined double-point mutants is not improved obviously, but the combined double-point mutants show very high enantioselectivity to the product (S) -rasagiline, and the ee value is more than 99%. The best mutant W207S/Y214C activity was 1.3 times that of the wild type.

Example 5 amplification of the reductive amination enzyme AcRedAm and its mutant to rasagiline the amplification reaction of the synthetic rasagiline was optimized for the amplification reaction conditions of the synthetic rasagiline, and incubated at 25 ℃ for 24 hours with shaking at 220rpm, with different concentrations of 1-indenone (5 mM-50 mM), different concentrations of propargylamine (50 mM-1M), different concentrations of glucose dehydrogenase GDH (0.7 mg/mL-2 mg/mL) or different concentrations of reductive amination enzyme (0.25 mg/mL-2.5 mg/mL), respectively. Then, 30. Mu.L of 10M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using HPLC or GC-FID.

The results are shown in FIG. 9. The results show that higher conversion can be obtained at a 1-indenone concentration of 5mM, propargylamine concentration of 250mM, and moderate enzyme loading (GDH concentration of 0.7mg/mL, and reductive amination enzyme concentration of 1 mg/mL).

The amplification reaction system for synthesizing rasagiline is as follows: 1mg/mL-pure enzyme, 0.7mg/mL GDH (Albumin), 100mM D-glucose, 1mM NADP+, 5mM 1-indenone, 250mM propargylamine (in buffer adjusted to pH 9.0), and 2% (v/v) DMSO. The final reaction volume was made up to 50mL using Tris-HCl (pH 9.0) buffer. The reaction was incubated at 25℃for 180 hours with shaking at 220 rpm. 200ul was sampled at various time points and the reaction was quenched by the addition of 10. Mu.L 10M NaOH. The reaction mixture was extracted twice with 200. Mu.L of methyl tert-butyl ether. The upper organic phases were combined with anhydrous MgSO ₄ Dried and analyzed using HPLC or GC-FID.

The results are shown in FIGS. 10-12. The result shows that the conversion rate of the reaction for synthesizing rasagiline by the reductive amination enzyme AcRedAm reaches 70% after the reaction is carried out for 60 hours, and the separation yield is 60%; after 120 hours of reaction, the conversion of the mutant AcQ237A to the enantiomerically pure (R) -rasagiline (ee > 99%) reaction reached 51% and the isolated yield was 42%.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Sequence listing

<110> Shanghai university of transportation

<120> reductive amination enzyme and preparation method and application thereof

<130> P2021-3350

<160> 28

<170> PatentIn version 3.5

<210> 1

<211> 287

<212> PRT

<213> card Li Qu mould (Aspergillus calidoustus)

<400> 1

Met Ser Thr Ile Thr Leu Phe Gly Leu Gly Ala Met Gly Lys Ala Leu

1 5 10 15

Ala Ala Lys Tyr Ile Glu Lys Gly Tyr Thr Thr Thr Ile Trp Asn Arg

20 25 30

Thr Pro Ser Lys Ala Ala Pro Leu Val Glu Lys Gly Ala Lys Leu Ala

35 40 45

Asn Thr Val Gly Glu Gly Leu Ala Ser Ala Asp Leu Ile Ile Leu Cys

50 55 60

Leu Leu Asp Asn Ala Ser Val Arg Gln Thr Leu Asp Gln Ala Thr Ala

65 70 75 80

Ala Leu Asn Gly Lys Thr Val Ile Asn Leu Thr Asn Gly Thr Pro Ser

85 90 95

Gln Ala Arg Glu Thr Ser Glu Trp Val Ile Ser His Gly Ala Gln Tyr

100 105 110

Ile His Gly Gly Ile Met Ala Val Pro Asp Met Ile Gly Ser Pro His

115 120 125

Ala Val Leu Leu Tyr Ser Gly Glu Ser Ala Glu Thr Phe Ser Arg Val

130 135 140

Glu Ala His Leu Ser His Leu Gly Thr Ser Lys Phe Leu Gly Thr Asp

145 150 155 160

Pro Gly Ser Ala Ser Leu His Asp Leu Ala Leu Leu Ser Gly Met Tyr

165 170 175

Gly Leu Phe Ser Gly Phe Phe His Ala Thr Ala Leu Val Lys Ser Gln

180 185 190

Pro Gly Thr Thr Ala Thr Gly Phe Val Gln Leu Leu Thr Pro Trp Leu

195 200 205

Ser Ala Met Thr His Tyr Leu Gly Ala Leu Ala Lys Gln Ile Asp Glu

210 215 220

Gly Asp Tyr Ala Thr Gln Gly Ser Asn Met Ala Met Gln Val Thr Gly

225 230 235 240

Val Gln Asn Ile Val Arg Ala Ser Glu Glu Ala Gly Val Thr Ala Asp

245 250 255

Leu Ile Met Pro Ile Leu Gly Arg Met Thr Arg Ala Ala Glu Ala Gly

260 265 270

Tyr Ala Asp Val Asp Val Ser Ala Val Ile Glu Phe Met Lys Glu

275 280 285

<210> 2

<211> 864

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgagcacca ttaccctgtt cggtctgggt gcgatgggca aggcgctggc ggcgaagtac 60

atcgagaaag gctataccac caccatttgg aaccgtaccc cgagcaaagc ggcgccgctg 120

gttgagaagg gtgcgaaact ggcgaacacc gttggtgaag gtctggcgag cgcggacctg 180

atcattctgt gcctgctgga taacgcgagc gtgcgtcaaa ccctggacca agcgaccgcg 240

gcgctgaacg gcaagaccgt tatcaacctg accaacggta ccccgagcca ggcgcgtgag 300

accagcgaat gggtgattag ccacggcgcg caatacatcc acggtggcat tatggcggtg 360

ccggatatga tcggtagccc gcacgcggtt ctgctgtata gcggcgagag cgcggaaacc 420

ttcagccgtg ttgaagcgca cctgagccac ctgggtacca gcaaatttct gggtaccgac 480

ccgggtagcg cgagcctgca cgatctggcg ctgctgagcg gcatgtacgg cctgttcagc 540

ggcttctttc atgcgaccgc gctggttaaa agccaaccgg gtaccaccgc gaccggtttt 600

gttcaactgc tgaccccgtg gctgagcgcg atgacccact acctgggtgc gctggcgaaa 660

cagattgacg agggtgatta tgcgacccaa ggcagcaaca tggcgatgca ggtgaccggt 720

gttcaaaaca tcgttcgtgc gagcgaggaa gcgggcgtta ccgcggacct gatcatgccg 780

attctgggtc gtatgacccg tgcggcggaa gcgggttatg cggacgtgga tgttagcgcg 840

gtgatcgagt ttatgaagga ataa 864

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 3

aagaccgtta tcaacnnkac caacggta 28

<210> 4

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (2)..(3)

<223> n is a, c, g, or t

<400> 4

mnngttgata acggtcttgc cgttca 26

<210> 5

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 5

tacatccacg gtggcnnkat ggcggtgc 28

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (2)..(3)

<223> n is a, c, g, or t

<400> 6

mnngccaccg tggatgtatt gcgcg 25

<210> 7

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 7

cacgatctgg cgctgnnkag cggcatgt 28

<210> 8

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (2)..(3)

<223> n is a, c, g, or t

<400> 8

mnncagcgcc agatcgtgca ggctcg 26

<210> 9

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 9

caactgctga ccccgnnkct gagcgcga 28

<210> 10

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (2)..(3)

<223> n is a, c, g, or t

<400> 10

mnncggggtc agcagttgaa caaaaccg 28

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 11

agcgcgatga cccacnnkct gggtgcgc 28

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (2)..(3)

<223> n is a, c, g, or t

<400> 12

mnngtgggtc atcgcgctca gccac 25

<210> 13

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 13

ggcagcaaca tggcgnnkca ggtgaccg 28

<210> 14

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (2)..(3)

<223> n is a, c, g, or t

<400> 14

mnncgccatg ttgctgcctt gggtc 25

<210> 15

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 15

agcaacatgg cgatgnnkgt gaccggtg 28

<210> 16

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (2)..(3)

<223> n is a, c, g, or t

<400> 16

mnncatcgcc atgttgctgc cttgg 25

<210> 17

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

caactgctga ccccggcgct gagcgcg 27

<210> 18

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

gccggggtca gcagttgaac aaaaccg 27

<210> 19

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

caactgctga ccccgagtct gagcgcga 28

<210> 20

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

actcggggtc agcagttgaa caaaaccg 28

<210> 21

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

actgctgacc ccgtgtctga gcgcgatgac ccacta 36

<210> 22

<211> 32

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

acacggggtc agcagttgaa caaaaccggt cg 32

<210> 23

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

caactgctga ccccggtgct gagcgcgatg acccact 37

<210> 24

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

accggggtca gcagttgaac aaaaccggtc g 31

<210> 25

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

caactgctga ccccgcatct gagcgcgatg acccacta 38

<210> 26

<211> 32

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

atgcggggtc agcagttgaa caaaaccggt cg 32

<210> 27

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

caactgctga ccccgatgct gagcgcgatg acccact 37

<210> 28

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 28

atcggggtca gcagttgaac aaaaccggtc g 31

Claims (10)

1. An in vitro reductive amination process comprising the steps of:

(i) Subjecting the (S1) ketone substrate or aldehyde substrate to a reductive amination reaction with the (S2) amine substrate in the presence of the reductive amination enzyme AcRedAm.

2. The method of claim 1, wherein the method comprises:

subjecting a ketone substrate or aldehyde substrate of formula Z1 and an amine substrate of formula Z2 to a reductive amination reaction in the presence of a reductive amination enzyme AcRedAm to form a reductive amination product of formula I:

wherein the method comprises the steps of

R1 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted (C1-C6 alkylene) -phenyl, wherein the substitution indicates that one or more H atoms are replaced by a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C3-C6 cycloalkyl, halogen, or combinations thereof;

R2 is H or methyl;

or R1 and R2 together with the attached C atom form a substituted or unsubstituted 4-10 membered heterocyclic ring;

r3 is H, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C2-C8 alkenyl, substituted or unsubstituted C2-C8 alkynyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 6-10 aryl, substituted or unsubstituted (C1-C6 alkylene) -phenyl, substituted or unsubstituted (C3-C6 cycloalkylene) -phenyl, wherein the substitution indicates that one or more H atoms are substituted with a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C3-C6 cycloalkyl, halogen, or combinations thereof.

3. An isolated or purified reductive amination enzyme comprising the sequence set forth in SEQ ID No. 1 and having at least 1 amino acid mutation.

4. The reductive amination enzyme of claim 3, wherein said mutant reductive amination enzyme has a mutation at a position selected from the group consisting of: the 207 th, 214 th, 237 th position or the combination of the 207 th, 214 th and 237 th positions of the sequence shown in SEQ ID No. 1.

5. An isolated polynucleotide encoding the reductive amination enzyme of claim 3.

6. A vector comprising the polynucleotide of claim 5.

7. A genetically engineered host cell comprising the vector of claim 6, or having incorporated into its genome the polynucleotide of claim 5.

8. Use of a reductive amination enzyme according to claim 3 or of a wild type reductive amination enzyme AcRedAm, characterized in that it is used for catalyzing a reductive amination reaction or for preparing a catalytic preparation for catalyzing a reductive amination reaction.

9. A method for the in vitro synthesis of rasagiline by a reductive amination enzyme comprising the steps of:

catalyzing the reaction of 1-indanone and propargylamine in the presence of the reductive amination enzyme of claim 3 or the wild type reductive amination enzyme AcRedAm to produce rasagiline.

10. A reaction system for performing a reductive amination reaction, said reaction system comprising:

(S0) the reductive amination enzyme of claim 3 or the wild type reductive amination enzyme AcRedAm;

(S1) a ketone substrate or aldehyde substrate;

(S2) an amine substrate; and

(S3) optionally NADPH or NADPH regeneration module.

Images