CN116334121A - Method for improving secretion capacity of filamentous fungus protein - Google Patents

Abstract

The invention discloses a method for improving the secretion capacity of aspergillus proteins and a recombinant strain obtained by the method. The method comprises genetic manipulation of AspergillusTo delete or reduce specific genesAn16g07795To increase the secretion of proteins such as saccharifying enzymes, alpha-amylase, and other proteins involved in starch hydrolysis. The invention uses CRISPR-Cas9 genome editing technology to knock out the gene of Aspergillus nigerAn16g07795The obtained gene editing deletion mutant strain can obviously improve the production level of starch hydrolase, including the protein secretion level and the activity of saccharifying enzyme, so that the strain has great application value.

Description

Method for improving secretion capacity of filamentous fungus protein

Technical Field

The invention belongs to the field of genetic engineering and biotechnology. Specifically, the invention relates to a method for improving the secretion capacity of aspergillus proteins, in particular to genetic modification of aspergillus, and more particularly relates to deletion editing of specific genes on aspergillus genome.

Background

Saccharifying enzyme (Glucoamylase, EC 3.2.1.3), which is a kind of exohydrolase, can hydrolyze alpha-1, 4 glycosidic bond from non-reducing end to release single beta-D-glucose one by one, and simultaneously hydrolyze alpha-1, 6 glycosidic bond and alpha-1, 3 glycosidic bond with starch or other related polysaccharide as substrate. Saccharifying enzyme is one of the most important enzymes in industrial enzyme preparation, and is widely applied to the industrial fields of beer, monosodium glutamate, starch sugar, antibiotics and the like which require the starch to be converted into glucose to the maximum extent.

Filamentous fungi such as Aspergillus nigerAspergillus niger) Aspergillus oryzaeAspergillus oryzae) Trichoderma reesei of the genus HeTrichoderma reesei) Is one of the most important production hosts for industrial proteins, and is widely used for the production of various enzyme preparations due to its strong protein secretion ability and good safety. The main production strain of saccharifying enzyme is filamentous fungus and is derived from aspergillusAspergillus) And rhizopus genusRhizopus). The saccharifying enzyme in China is mainly prepared by refining Aspergillus niger excellent strains through submerged fermentation. The saccharifying enzyme industry in China has been developed continuously and continuously through several decades of scientific researchers, and a large number of enzyme preparation varieties such as saccharifying enzyme and the like can be produced autonomously at present. For example, chinese patent CN 102827817B discloses a thermostable glucoamylase GAI and its gene and application, and by screening thermostable glucoamylase or cloning expressed thermostable glucoamylase gene, raising the temperature of action of the glucoamylase, the saccharification process of starch can be completed in a short time like starch liquefaction; the invention patent No. CN 113061539A discloses a method for improving the production capacity of Aspergillus niger glucoamylase and a recombinant Aspergillus niger strain, and the production capacity of Aspergillus niger glucoamylase is greatly improved through the regulation and control of a fatty acid metabolic pathway. CN105255741 a discloses a strain of high-yield saccharifying enzyme, namely aspergillus niger CGMCC 10788, which is obtained by taking aspergillus niger G131 and F285 as initial strains and breeding through multiple rounds of protoplast electrofusion breeding, wherein the average fermenting enzyme activity of the strain can reach 87000-90000u/mL, and is improved by 99.3% compared with the initial strain.

Although these studies have also reached a high level, the current studies have focused mainly on the screening and cloning of thermostable glucoamylase by conventional methods, or on the screening and breeding of high-yield glucoamylase strains by conventional strain breeding methods, or on the improvement of expression levels of the glucoamylase genes by transcriptional regulation. Protein synthesis secretion involves multiple system synergies such as transcriptional expression regulation, posttranslational folding modification, and transport and secretion out of cell membranes, and is a very complex process. Therefore, there is a need for further understanding of protein secretion pathways, reducing or even eliminating the bottleneck of the secretion pathways, and further improving the secretory capacity of filamentous fungal proteins.

High secreting filamentous fungal hosts have great potential for the production of proteins. Therefore, it is necessary to develop a method for improving the secretion capacity of the filamentous fungi protein by modifying the secretion pathway, and obtain recombinant strains with significantly improved secretion levels of starch hydrolase such as saccharifying enzyme by using gene editing technology, so as to reduce the time and labor cost required by traditional screening and breeding, so as to meet the requirement of fermenting and applying saccharifying enzyme in industrial fields in China, and have important innovativeness.

Disclosure of Invention

The inventors of the present invention have found that genes in Aspergillus are identified by extensive gene screening and intensive studiesAn16g07795The knock-out editing can greatly improve the protein secretion level. Accordingly, the present invention is directed to a method for modifying a strain capable of improving the secretory capacity of a filamentous fungal protein and the productivity of amylase by genetically modifying genes related to the secretory pathway of the filamentous fungal protein to improve the secretory capacity of the filamentous fungal protein and the productivity of amylase.

For this purpose, the invention adopts the following technical scheme:

the invention provides a method for improving aspergillusAspergillus) A method for constructing a recombinant strain having a protein secretion level, characterized by comprising the step of introducing a gene into AspergillusAn16g07795Inactivation or reduction to increase its ability to secrete proteins.

Specifically, the geneAn16g07795The amino acid sequence of (2) is shown as SEQ ID NO. 1; the geneAn16g07795The nucleotide sequence of (2) is shown as SEQ ID No. 2.

In a specific embodiment, the method comprisesAn16g07795Inactivation or reduction of a gene is by complete or partial deletion of its gene expression cassette, by insertional inactivation or by means that render the gene non-functional with respect to its intended purpose to prevent expression of the functional protein by the gene, or to reduce expression of the functional protein; preferably, genes in Aspergillus cells are genetically manipulatedAn16g07795Is knocked out.

Preferably, the Aspergillus is Aspergillus nigerAspergillus niger）。

In particular embodiments, the enhanced secreted protein refers to a protein involved in starch hydrolysis. More specifically, the protein is a saccharifying enzyme and/or an alpha-amylase.

The invention therefore also provides recombinant strains obtainable by said method.

The invention further provides a method for expressing starch-hydrolysed proteins using said recombinant strain, characterized in that said recombinant strain is cultivated in the presence of a starch feedstock or a starch inducer to obtain starch-hydrolysed proteins, preferably a saccharifying enzyme and/or an alpha-amylase; further, a step of isolating the starch-hydrolyzed protein is included.

The present invention also provides a method for hydrolyzing starch using the recombinant strain, characterized in that the recombinant strain is cultured in the presence of a starch material or a starch inducer, thereby hydrolyzing starch.

In a specific embodiment, the invention respectively carries out gene editing mutant bacteria obtained by carrying out gene knockout on two aspergillus niger strains (CBS 513.88 and saccharifying enzyme industrial production strain N1). Specifically, the construction method comprises the following steps: construction of 2 targeting genesAn16g07795The nucleotide sequences of the guide RNA (sgRNA) expression elements are shown in SEQ ID NO.3 (AnU p-An16g 07795-sgRNA-1) and SEQ ID NO.4 (AnU p-An16g 07795-sgRNA-2), respectively; a homologous donor DNA sequence of gene An16G07795 containing the G418 resistance marker is constructed, and the nucleotide sequence of the homologous donor DNA sequence is shown in SEQ ID NO.5 (donor-An 16G 07795). After co-transforming the expression cassette of Cas9 protein, anU p-An16g07795-sgRNA-1 and AnU p-An16g07795-sgRNA-2 and donor DNA donor-An16g07795 into protoplast cells of two host strains, gene editing mutants can be obtained by homologous recombination, which are designated CBS-deltaAn16g07795And N1-deltaAn16g07795Is a gene mutant strain of (2), which is a knocked-out geneAn16g07795Aspergillus strain of (A).

In the present invention, the meaning of the terms used will be explained.

"recombinant" when used in reference to a strain, cell, nucleic acid, protein or vector means that the strain, cell, nucleic acid, protein or vector has been modified by the introduction of a heterologous nucleic acid or protein or by alteration of the native nucleic acid or protein. For example, a recombinant strain is one that expresses a gene not found in the native (non-recombinant) form of the strain, or that expresses a native gene.

By "host strain" or "host cell" is meant a suitable host for the expression vector or DNA construct, in particular, the host strain is preferably aspergillus, most preferably aspergillus niger. The host cell may be an aspergillus host cell or a genetically modified host cell.

"genome editing" refers to deleting, inserting or replacing genomic DNA of an organism, thereby achieving the purpose of modifying a target sequence.

The CRISPR-Cas9 editing technology refers to that Cas9 protein can cut a specific DNA sequence in a biological genome under the guidance of sgRNA to manufacture DNA double-strand break so as to trigger a repair mechanism of a cell, and Non-homologous end-connection repair (Non-homologous end joining, NHEJ) or homologous recombination (Homologous recombination, HR) repair is carried out at a DSB part so as to carry out gene knockout, gene inactivation, gene knock-in and gene replacement, thereby realizing the aim of efficient genome editing.

"target site" or "protospacer" refers to a nucleic acid sequence that defines a portion of a nucleic acid, and refers to a 20 base sequence at the 5' end of a guide RNA (sgRNA) that is identical to a DNA sequence of interest, where the sgRNA requires that the sequence bind to the DNA of interest and that the complex of Cas9 and the sgRNA cleaves the DNA of interest in the presence of sufficient binding.

"sequence" refers to a nucleotide sequence of any suitable length, which may be DNA or RNA; may be linear, circular or branched, and may be single-stranded or double-stranded. The term "donor DNA sequence" refers to a nucleotide sequence that is inserted into the genome. The donor sequence may be of any length, for example, preferably between about 500 and 3,000 nucleotides in length (or any integer value therebetween).

The invention has the following beneficial effects: genetic manipulation of Aspergillus cellsDeletion or reduction of the activity of the An16g07795 gene, which is capable of significantly increasing the production level of starch hydrolyzing enzymes. In a specific experiment, the invention uses CRISPR-Cas9 editing technology to knock out the Aspergillus niger strain CBS513.88 geneAn16g07795Obtaining the gene editing deletion mutant strain CBS-deltaAn16g07795The mutant strain can remarkably improve the production level of starch hydrolase, wherein the protein secretion level is improved by about 27-27% compared with that of the starting strain, the activity of saccharifying enzyme is improved by about 23-23% compared with that of the starting strain, and the activity of alpha-amylase is improved by about 18% compared with that of the starting strain; in another specific experiment, the gene was knocked out in an Aspergillus niger strain N1 industrially produced by saccharifying enzymesAn16g07795Obtaining the deletion mutant strain N1-deltaAn16g07795The mutant strain can remarkably improve the production level of starch hydrolase, wherein the protein secretion level is improved by about 18% to 18% compared with the original strain, and the activity of saccharifying enzyme is improved by about 16% compared with the original strain, so that the mutant strain has a larger application value.

Drawings

FIG. 1 is a schematic representation of target gene knockout by CRISPR-Cas9 editing technologyAn16g07795Is a schematic diagram of (a).

FIG. 2 is a schematic representation of target gene knockout by CRISPR-Cas9 editing techniquesAn16g07795Is a PCR identification nucleic acid electrophoretogram.

FIG. 3A. Niger geneAn16g07795Deletion mutant strain CBS-deltaAn16g07795And protein SDS-PAGE analysis of the fermentation supernatant of the starting strain CBS513.88 under starch induction.

FIG. 4 shows Aspergillus niger geneAn16g07795Deletion mutant strain CBS-deltaAn16g07795And protein secretion amount of the starting strain CBS513.88 fermented under starch induction conditions.

FIG. 5A. Niger geneAn16g07795Deletion mutant strain CBS-deltaAn16g07795And the saccharifying enzyme activity of the fermentation supernatant of the original strain CBS513.88 under the starch induction condition.

FIG. 6A. Niger geneAn16g07795Deletion mutant strain CBS-deltaAn16g07795And the alpha-amylase activity of the fermentation supernatant of the starting strain CBS513.88 under the starch induction condition.

FIG. 7 is a sugarDeletion gene in Aspergillus niger strain N1 produced by industrial production of chemo-enzymeAn16g07795Protein bleeding levels and saccharifying enzyme activities of the later fermentation under starch-induced conditions.

Detailed Description

In order to further illustrate the technical means adopted by the present invention and the effects thereof, the following technical solutions of the present invention will be further described in conjunction with the preferred embodiments of the present invention, and it should be understood that these embodiments are merely for illustrating the present invention and are not intended to limit the scope of the present invention. It will be understood by those skilled in the art that various changes and substitutions can be made in the details and form of the technical solution of the present invention without departing from the spirit and scope of the invention, but these changes and substitutions fall within the scope of the present invention.

The methods used in the examples below are conventional methods unless otherwise specified, and specific steps can be found in: molecular Cloning: A Laboratory Manual (Sambrook, J., russell, david W., molecular Cloning: A Laboratory Manual,3rd edition,2001,NY,Cold Spring Harbor).

The various biomaterials described in the examples were obtained by merely providing an experimental route for achieving the objectives of the specific disclosure and should not be construed as limiting the source of biomaterials of the present invention. In fact, the source of the biological material used is broad, and any biological material that is available without violating law and ethics may be used instead as suggested in the examples.

The original starting strain used in the examples, aspergillus niger CBS513.88, was purchased from the Centraalbureau voor Schimmelcultures CBS Fungal Biodiversity Centre fungal biodiversity center and is commercially available; aspergillus niger strain N1 produced by saccharifying enzyme is from Shandong Long Kete enzyme preparation limited company, and the preservation number is CGMCC No. 10788.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were commercially available through regular channels, not identified to the manufacturerConventional products. Wherein the percentage concentrations are mass percentage concentrations unless otherwise specified. The primers used and the nucleic acid sequencing were all performed by GENEWIZ, biosciences limited, jin Weizhi, su. Wherein "An16g07795"Gene locus numbering of Aspergillus niger.

Example 1 construction of CRISPR-Cas9 mediated Aspergillus niger GeneAn16g07795Editing carrier

The dynamic change of 266 transcription factors of Neurospora crassa under the condition of endoplasmic reticulum stress is analyzed at the early stage of a research group through the whole genome level, 33 transcription factors are identified to be significantly up-regulated, the cellulase secretion phenotype of the transcription factors is screened systematically, and a new transcription factor (homologous gene of An16g 07795) is identified to influence lignocellulose secretion. Therefore, the invention performs gene An16g07795 knockout in two strains CBS513.88 of Aspergillus niger and a saccharifying enzyme industrial strain N1, and researches whether the strain can promote the secretion of saccharifying enzyme.

(1) GeneAn16g07795Construction of sgRNA expression cassette vectors of (E)

Design of target genes by software sgRNACas9 toolAn16g07795Is a target site of (c). And (3) connecting an Aspergillus niger AnU p promoter, a target site and an sgRNA framework together by adopting a fusion PCR method, and constructing the sgRNA expression frame vector by adopting a gene overlap extension (SOE) method. The primer sequences required for the sgRNA expression cassette vectors are shown in table 1.

The PCR reaction system is as follows: 10. Mu.L of 5 Xphusion HF buffer, 1. Mu.L of 10mM dNTPs, 2.5. Mu.L of upstream/downstream primer, 1. Mu.L of template DNA, 0.5. Mu.L of Phusion DNA polymerase and 32.5. Mu.L of ddH 2O.

The PCR reaction conditions were: firstly, the temperature is 98 ℃ for 30s; then 98℃10s,65℃30s,72℃1min,34 cycles; finally, the temperature is 72 ℃ for 10min and the temperature is 4 ℃ for 10min.

The sgRNA expression plasmids AnU p-An16g07795-sgRNA-1 and AnU p-An16g07795-sgRNA-2, the sequences of which are shown in SEQ ID No.3 and SEQ ID No.4, respectively, were formed by amplification of SOE-PCR.

(2) Homologous donor DNA vector construction

In this example, homologous donor DNA fragments are each derived from the target geneAn16g07795Upstream and downstreamA homologous fragment of the natal (944 and 936 bp), the PtrpC-neo fragment of the geneticin (G418) resistance gene expression cassette, was ligated into the plasmid pUC118 linearized by the restriction enzymes BamHI and HindIII by the method of Gibson Assembly, and finally a donor DNA fragment, donor-An16G07795, the nucleic acid sequence of which is shown in SEQ ID No.5, was constructed. The PCR primer sequences required for constructing the donor DNA fragment are shown in Table 1.

TABLE 1 primers used in example 1

SEQ ID NO.	Primer(s)	Sequence (5 '-3')
			6	AnU6p-F	CAGTTACTTATAAGCTTGGAGCTTG
7	gRNA-R	AAAAAGCACCGACTCGGTGC
			8	An16g07795-T1-R	GCTCTAAAACAAGCCATTCGTTGTCTGGACTTTGAATTATATAGGAATAATGGTT
9	An16g07795-T1-F	AATTCAAAGTCCAGACAACGAATGGCTTGTTTTAGAGCTAGAAATAGCAAGTT
			10	An16g07795-T2-R	GCTCTAAAACGTCATAAGAGGAAGCACGTCTTTGAATTATATAGGAATAATGGTT
11	An16g07795-T2-F	AATTCAAAGACGTGCTTCCTCTTATGACGTTTTAGAGCTAGAAATAGCAAGTT
			12	An16g07795-up-F	ATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTTCCCTCTGCTACTTGCGGTGTT
13	An16g07795-up-R	CTCCTTCAATATCAGTTAACGTCGGTTTAAACTGGACCCAGTCTTCCGAGATAGCAT
			14	AnNeo-F	ATGCTATCTCGGAAGACTGGGTCCAGTTTAAACCGACGTTAACTGATATTGAAGGAGCAT
15	AnNeo-R	GGGACTGAACCGAGGAGACCGATGAGGTACCTCAGAAGAACTCGTCAAGAAGGCGATA
			16	An16g07795-down-F	CGCCTTCTTGACGAGTTCTTCTGAGGTACCTCATCGGTCTCCTCGGTTCAGTCCC
17	An16g07795-down-R	CGTTGTAAAACGACGGCCAGTGCCAAGCTTCTGCCCATCAAAGACACATAGGACA
			18	An16g07795-ko-F	ACATTAACCCTCGCATCCTCCCACC
19	An16g07795-ko-R	GCAGGTGACGATGGGGCACTTTTCG

Example 2 CRISPR-Cas9 System pair Aspergillus niger GeneAn16g07795Gene knockout was performed

(1) Aspergillus niger protoplast transformation

A. Mycelium preparation

Mature Aspergillus niger spores were collected with 0.05% Tween-80 sterilized water, filtered through a piece of mirror paper to remove mycelia, inoculated in MM liquid culture, and cultured at 30℃and 200rpm for 16h.

B. Protoplast preparation

Mycelium is filtered and collected and then placed in 30mL of lysate (formula: 0.15g of lyase, 30mL of solution A, filtration and sterilization; solution A: 1.0361g of monopotassium phosphate, 21.864g of sorbitol, dissolved in 90mL of deionized water, pH adjusted to 5.6, quantified to 100mL, sterilized at high temperature), and subjected to 30 ℃ for 2 hours, and gently shaken every 30 minutes. Then, after filtration with cellophane, centrifugation was performed at 2000rpm for 10min at 4℃and the supernatant was discarded, 4mL of solution B (formulation: calcium chloride 0.735 g, sorbitol 18.22 g, tris-HCl (1M, pH 7.5) 1mL was added, dissolved in 90mL of deionized water, pH was adjusted to 7.6, quantified to 100mL, sterilized at high temperature) was added, and centrifugation was performed at 2000rpm for 10min at 4℃to obtain a solution; the supernatant was discarded and a volume of solution B was added at 200. Mu.L/plasmid.

C. Protoplast transformation

In a precooled 15mL centrifuge tube, 50 mu L of precooled PEG (12.5g PEG6000,0.368g calcium chloride, 500 mu L of Tris HCl (1M pH 7.5) are sequentially added, DNA fragments to be converted are added into 200 mu L of protoplasts after being mixed, 2mL of precooled PEG liquid is added after being placed on ice for 20min, the mixture is placed at room temperature for 5min, 4mL of solution B is added, the mixture is gently mixed, 3mL of the solution is added into 12mL of melted MM medium containing 1.5 mg/mL FOA, the mixture is spread on a flat plate, and the mixture is cultured at 35 ℃, and after 3d, single mycelia are picked up for growth on a corresponding resistance flat plate.

(2) CRISPR-Cas9 system for Aspergillus niger genesAn16g07795Gene knockout at site

Cas9 protein expression element p0380-Ptef1-Cas9 was mixed with AnU p-An16g07795-sgRNA-1 and AnU p-An16g07795-sgRNA-2 expression elements and homologous donor DNA donor-An16g07795 in equal proportions and co-transformed into Aspergillus niger strain CBS513.88 and strain N1 protoplast cells, respectively. As shown in fig. 1, cas9 recognizes a target site for cleavage by pairing a target sequence with a DNA strand of a target gene on a host cell genome under the mediation of sgrnas, and then a donor DNA fragment undergoes homologous recombination with sequences on both sides of the target site, thereby achieving the purpose of genome editing, and transformants are selected by adding G418 to a plate.

(3) Aspergillus niger transformant validation

A. Extraction of Aspergillus niger genome

Extracting genome DNA from the transformant selected in the above transformation process by phenol chloroform method, specifically comprising the following operations:

1) 2.0 mL to a sterile DNA extraction tube was added 200mg of zirconium beads and 1mL of lysate (formulation: 0.2M Tris.HCl (pH 7.5), 0.5M NaCl,10mM EDTA,1% SDS (w/v), and Aspergillus niger mycelia grown in the plates were picked up in DNA extraction tubes;

2) Placing all the DNA extraction tubes on a grinding aid, oscillating for 30s at the maximum rotation speed, and repeating for two times;

3) Water bath at 65 ℃ for 30min, and vortex oscillation is carried out every several minutes in the water bath process;

4) After the water bath is finished, 80 mu L of 1M Tris-HCl with the pH of 7.5 is added into each tube to neutralize;

5) 400 μl of phenol was added: chloroform (1:1), 13000rpm for 5 minutes;

6) mu.L of the supernatant was taken in a fresh 1.5mL EP tube and 600. Mu.L of 95% ethanol (DNA grade) was added;

7) Incubation on ice for one hour followed by centrifugation at 13000rpm at 4℃and white DNA was seen to precipitate at the bottom of the EP tube;

8) 400. Mu.L of 75% alcohol (DNA grade) was washed, centrifuged at 13000rpm at 4℃and the supernatant was gently removed;

9) Placing the EP tube in a vacuum concentrator to remove residual alcohol;

10 Add 50 μl ddH2O to dissolve DNA, measure DNA concentration with NanoDrop, after concentration measurement, place the extracted DNA in-20 ℃ refrigerator for further PCR validation.

B. PCR verification of transformants

The genome DNA extracted as described above was used as a template, and the transformants were subjected to gene PCR verification using the primers An16g07795-ko-F and An16g 07795-ko-R. PCR reagents were purchased from Nanjinopran Biotechnology Co., ltd.

The primer sequences were as follows:

An16g07795-ko-F:ACATTAACCCTCGCATCCTCCCACC（SEQ ID No. 18）

An16g07795-ko-R: GCAGGTGACGATGGGGCACTTTTCG（SEQ ID No. 19）

the PCR reaction system is as follows: 10×Taq Buffer 2. Mu.L, 10mM dNTP Mix 0.2. Mu.L, upstream/downstream primers of 0.4. Mu.L each, DNA template of 1. Mu.L, taq DNA Polymerase 0.2.2. Mu.L, and water of 15.8. Mu.L.

The PCR reaction conditions were: 94 ℃ for 5min; then 94 ℃ for 30s,55 ℃ for 30s,72 ℃ for 1.2min,30 cycles; finally, 7min at 72℃and 10min at 4 ℃.

Experimental results: the PCR amplified product is subjected to 1% agarose gel electrophoresis (120V voltage for 30 minutes), obvious gene amplification bands are shown under a gel imaging system, the PCR amplified band of the mutant is 1880bp, the target band of the wild strain is 1148 bp, and the result is shown in figure 2, which shows that the homologous recombination of the donor DNA fragment and the sequences at both sides of the target site occurs, and then the gene editing mutant strain is obtained. Among the 20 transformants obtained with the A.niger strain CBS513.88, 7 transformants were successfully knocked out with a knocking-out efficiency of 35%. Of the 20 transformants obtained in A.niger strain N1, 4 transformants were successfully knocked out with a knockdown efficiency of 20%.

Example 3 Gene editing deletion Strain CBS-ΔAn16g07795Protein secretion level analysis under starch-induced conditions

(1) The deletion mutant strain is cultured in a starch induction medium: the above obtained gene is subjected to the above proceduresAn16g07795Deletion mutant strain (CBS-delta)An16g07795-1，CBS-ΔAn16g07795-2 and CBS-deltaAn16g07795-3) and the starting strain CBS513.88 were inoculated into 50mL of medium in 250mL flasks, respectively. The formula of the culture medium comprises: 30g maltose, 10g peptone extract, 5g yeast extract, 1g KH ₂ PO ₄ ，0.5 gMgSO ₄ , 0.03 g ZnCl ₂ ，0.02 g CaCl ₂ ，0.0076 gMnSO ₄ ，0.3 g FeSO ₄ 3mL Tween 80, constant volume to 1000 mL, autoclaved) at an inoculum size of 2.5 x 10 ⁵ The cells were incubated at 30℃and 200rpm for 6 days, and the supernatant was centrifuged to obtain SDS-PAGE for analysis and protein concentration measurement.

(2) Concentration determination of secreted proteins: the protein concentration in the supernatant was detected using the rapid test kit for Bradford protein, as shown in FIG. 3, and the protein yields of all mutant strains were significantly improved compared to the starting strain CBS513.88, which was increased by about 24% and about 27% times over the starting strain on days 5 and 6, respectively, under the starch culture conditions.

(3) Supernatant SDS-PAGE electrophoresis detection: an equal volume of the supernatant was aspirated according to the 6 th protein concentration and subjected to 4-12% SDS-PAGE electrophoresis, and the results are shown in FIG. 4. Compared with the original strain CBS513.88, the corresponding bands of amylase such as saccharifying enzyme and the like are obviously deepened, the secretion protein level is obviously higher than that of the original strain, and the original strain CBS513.88 and genesAn16g07795The protein yield of the deletion mutant strain is 0.34g/L and 0.43g/L respectively.

Example 4 Gene editing deletion Strain CBS-. DELTA.An16g07795Phenotypic analysis for production of saccharification enzymes and alpha-amylases

Deletion mutant strain (CBS-. DELTA.s) of An16g07795 gene obtained as described aboveAn16g07795-1，CBS-ΔAn16g07795-2 and CBS-deltaAn16g07795-3) and the starting strain CBS513.88 were inoculated into 50mL of medium in 250mL flasks, respectively. The formula of the culture medium comprises: 30g maltose, 10g eggsWhite peptone extract, 5g yeast extract, 1g KH2PO4,0.5 gMgSO4, 0.03 g ZnCl2,0.02 g CaCl2,0.0076 gMnSO4,0.3 g FeSO4,3 mL Tween 80, volume to volume 1000 mL, autoclaving) at an inoculum size of 2.0 x 10 ⁵ The cells were incubated at 30℃and 200rpm for 6 days, and the supernatant was collected by centrifugation, and the activities of the saccharifying enzyme and the alpha-amylase were measured.

(1) And (3) measuring the activity of saccharifying enzyme: diluting the crude enzyme solution with 0.05M sodium acetate buffer solution with pH of 4.6 to a proper multiple, wherein the final volume is 0.25 mL, placing the crude enzyme solution into a 40 ℃ water bath for preheating, taking out, adding 0.25 mL of 1% soluble starch substrate solution preheated in the 40 ℃ water bath, uniformly mixing, reacting for 10min at 40 ℃, stopping the reaction with 0.5mL of LDNS solution, boiling for 10min, cooling on ice, adding steaming water to a constant volume of 2.5 mL, shaking up and down uniformly, measuring the released glucose amount by a DNS method, measuring the OD value at a wavelength of 540 nm, and using the inactivated enzyme solution as a control for a blank group.

Definition of saccharifying enzyme activity: 1mL of enzyme solution hydrolyzes soluble starch to generate 1 mu mol of glucose per minute under the condition of 40℃, pH and 4.6, namely, the enzyme amount is one enzyme activity unit (U).

As a result, as shown in FIG. 5, the gene was compared with the starting strainAn16g07795The enzyme activity of the saccharifying enzyme of the deletion mutant strain is obviously improved, the saccharifying enzyme activity is improved by 23 percent times compared with that of the original strain, and the original strain CBS513.88 and genes are adoptedAn16g07795The saccharifying enzyme activities of the deletion mutant strain are 427.6U/mL and 524.1U/mL respectively.

(2) Alpha-amylase activity assay: the activity of alpha-amylase was determined using the amylase activity detection kit of Solarbio (cat# BC 0610). Diluting the crude enzyme solution with 0.05M phosphate buffer solution with pH of 6.0 to a proper multiple, adding the final volume of 0.25 mL into a 70 ℃ water bath kettle for passivation for 15min, taking out, adding the preheated starch substrate reagent with 0.25 mL into the 40 ℃ water bath kettle, uniformly mixing, reacting for 5min at 40 ℃, stopping the reaction with 0.5mL DNS solution, boiling for 10min, cooling on ice, adding steaming water to a constant volume of 2.5 mL, shaking up and down uniformly, measuring the released reducing sugar amount by a DNS method, measuring the OD value at a wavelength of 540 nm, and using the inactivated enzyme solution as a control for a blank group.

Alpha-amylase activity definition: 1mL of enzyme solution hydrolyzes soluble starch to generate 1 mg reducing sugar per min under the conditions of 40 ℃ and pH6.0, namely, the enzyme amount is one enzyme activity unit (U).

As shown in FIG. 6, compared with the original strain, the alpha-amylase activity of the gene An16g07795 deletion mutant strain is obviously improved, the alpha-amylase activity is improved by 18.6% compared with the original strain, and the alpha-amylase activities of the original strain CBS513.88 and the gene An16g07795 deletion mutant strain are respectively 10.8U/mL and 13.1U/mL.

Example 5 Gene editing deletion Strain N1-deltaAn16g07795Phenotypic analysis of protein secretion levels and production of glucoamylase

Deletion mutant strain (N1-delta) of gene An16g07795 obtained aboveAn16g07795-1，N1-ΔAn16g07795-2 and N1-deltaAn16g07795-3) and the starting strain N1 were inoculated into 50mL of medium in 250mL Erlenmeyer flasks, respectively. The formula of the culture medium comprises: 10g glucose, 1.5 g corn steep liquor, 1.5 g bean pulp powder, constant volume to 50mL, autoclaving, inoculum size of 2.0 x 10 ⁵ The cells were incubated at 30℃and 200rpm for 6 days per mL, and the supernatant was collected by centrifugation, and the protein concentration and the activity of the saccharifying enzyme were measured.

(1) Concentration determination of secreted proteins: the protein concentration in the supernatant was detected using the rapid test kit for Bradford protein, as shown in FIG. 7, the protein yield of the mutant strain was significantly improved compared with that of the wild type strain, and the protein yields were increased by 18% as compared with that of the starting strain, starting strain N1 and deletion mutant strain N1-delta, respectively, at day 6 under the starch culture conditionsAn16g07795The protein yields of the protein are 4.0g/L and 4.8g/L respectively.

(3) And (3) measuring the activity of saccharifying enzyme: diluting the crude enzyme solution with 0.05M sodium acetate buffer solution with pH of 4.6 to a proper multiple, wherein the final volume is 0.25 mL, placing the crude enzyme solution into a 40 ℃ water bath for preheating, taking out, adding 0.25 mL of 1% soluble starch substrate solution preheated in the 40 ℃ water bath, uniformly mixing, reacting for 10min at 40 ℃, stopping the reaction with 0.5mL of LDNS solution, boiling for 10min, cooling on ice, adding steaming water to a constant volume of 2.5 mL, shaking up and down uniformly, measuring the released glucose amount by a DNS method, measuring the OD value at a wavelength of 540 nm, and using the inactivated enzyme solution as a control for a blank group.

Definition of saccharifying enzyme activity: 1mL of enzyme solution hydrolyzes soluble starch to generate 1 mu mol of glucose per minute under the condition of 40℃, pH and 4.6, namely, the enzyme amount is one enzyme activity unit (U).

The results are shown in FIG. 7, which shows the genes compared to the starting strainAn16g07795The enzyme activity of the saccharifying enzyme of the deletion mutant strain is obviously improved, the saccharifying enzyme activity is improved by 16 percent compared with that of the original strain, and the original strain CBS513.88 and the gene are adoptedAn16g07795The saccharifying enzyme activities of the deletion mutant strain are 22200U/mL and 25733U/mL respectively.

<110> Shandong Long Kete enzyme preparation Co., ltd; tianjin industry and biotechnology institute of academy of sciences in China

<120> a method for improving secretion ability of filamentous fungal protein

<160> 19

<210> 1

<211>681

<212> PRT

<213> Aspergillus niger

<400> 1

MQSHADTSDFVLFPTHFTGDNKMLALDSSRQQHPPYFQSYPMDPSTFIDPLAFHVDDLGFSQTHDQSGVPQSSNYGTPPIYSESFSDANKAAGFPPMPATPPSLPYSSDHFIPGLSTASGPSVASASSSAIGSPNTGSAHAISEDWVQTTNGLGLPAAVMSDYFPNEYFGNTLDSEGFYQQKCPENFVGATSDPSVIQPMLQQHPINPPTISFPEQPDYVVSQSAFLPQSPDPSHLHPSESYAANQSFAQHPSLVPTSSPSMAPALPQSRRASSYDRRSSVSSVQSQRSHPSPAASNAESDDDTKEKGRCPFPECRRVFKDLKAHILTHQSERPEKCPIVTCEYHIKGFARKYDKNRHTLTHYKGTMVCGFCPGSGSPAEKSFNRADVFKRHLTSVHGVEQTPPNCRKRSPTAAASKGTSSYSPDATGKCSTCSITFSNAQDFYEHLDDCVLRVVQQEEPSEAINQKLLSEVDADEEVQKTMEKHNLNDTAGTVDIYNDEYDDDDDDAYEYSNLRSGKGPLKSTKGSGAVARPILGVNNAVTKGSSNANAKMRATTSKRRNNRDRYPQSWGCPSSSIKTKKRVLCVFDGQRRLWKDEMMLDNEFEVRVKLPGGAGDGTNREAYVTDLDVETLKRAEGVLSANDEERGPWVDNQSTQLIGQPAVLLPDTYRPHDAEPMDMTY 681

<210>2

<211>2033

<212>DNA

<213> Aspergillus niger

<400>2

TGCAATCTCACGCAGACACTTCCGACTTCGTACTATTCCCTACCCACTTCACCGGTGACAACAAAATGCTGGCCCTGGATTCGTCCAGACAGCAGCATCCCCCGTACTTCCAGTCCTACCCCATGGATCCTAGTACCTTTATCGATCCTCTTGCCTTCCATGTGGACGATCTAGGTTTCAGCCAGACCCACGACCAATCCGGTGTACCCCAGTCCTCCAACTACGGTACGCCGCCTATCTACTCCGAGTCTTTCTCGGACGCCAATAAAGCTGCTGGATTTCCACCTATGCCCGCCACTCCCCCGTCCCTCCCTTATTCTTCCGATCACTTCATTCCTGGACTTTCTACTGCGTCCGGTCCTTCCGTTGCCAGCGCCTCCTCGTCCGCCATCGGATCGCCCAATACGGGTTCTGCGCATGCTATCTCGGAAGACTGGGTCCAGACAACGAATGGCTTGGGGCTTCCCGCCGCGGTCATGAGTGACTACTTCCCCAATGAGTATTTTGGCAACACGCTGGACTCGGAGGGTTTCTACCAGCAGAAATGCCCAGAAAACTTTGTTGACCCTTCTGTTATACAGCCAATGCTACAGCAGCATCCCATCAACCCCCCTACCATCTCGTTCCCCGAACAGCCTGATTATGTCGTATCGCAAAGCGCGTTTCTGCCCCAATCCCCTGACCCTTCCCACCTCCATCCCTCGGAGAGCTACGCTGCGAACCAATCATTCGCACAGCACCCCAGTCTTGTGCCGACCTCTTCCCCTTCCATGGCTCCTGCCCTACCCCAGTCACGACGTGCTTCCTCTTATGACCGGAGGTCATCGGTCTCCTCGGTTCAGTCCCAGCGCTCTCATCCAAGCCCGGCTGCCAGTAATGCAGAGTCCGACGATGACACCAAGGAAAAGGGACGATGCCCTTTCCCGGAGTGCAGACGTGTTTTCAAGGATCTCAAGGCTCACATCCTGACACACCAGTCAGAGAGACCCGAAAAGTGCCCCATCGTCACCTGCGAATACCATATCAAGGGTTTCGCCCGCAAGTATGACAAGAACCGTCATACTCTTACTCACTACAAAGGAACGATGGTTTGCGGCTTCTGCCCGGGGTCTGGGTCGCCCGCCGAGAAGAGCTTCAACAGGGCGGACGTCTTCAAGCGCCACTTGACATCAGTGCATGGCGTCGAACAGACACCACCTAACTGCCGGAAGAGAAGTCCAACTGCAGCGGCAAGCAAGGGGACATCTAGCTACAGCCCCGATGCGACTGGCAAGTGCTCAACTTGCTCCATTACGTTCAGTAACGCACAGGACTTCTACGAGCATCTGGACGACTGTGTGCTTCGGGTTGTGCAACAGGAAGAGCCCAGCGAGGCCATCAACCAGAAGCTGCTTTCTGAAGTCGATGCTGACGAGGAGGTGCAAAAGACGATGGAGAAACATAACTTGAACGACACGGCTGGCACCGTCGACATATACAACGACGAATATGATGATGACGATGATGACGCTTACGAATATTCGAACCTACGTTCGGGCAAAGGCCCCCTGAAGAGCACCAAGGGATCAGGGGCGGTGGCCCGTCCTATCTTGGGCGTCAACAACGCAGTCACAAAGGGTTCGTCCAATGCCAATGCTAAGATGCGTGCGACTACATCCAAGCGACGCAACAACCGTGATCGTTACCCTCAGTCCTGGGGTTGCCCTAGCAGCAGCATCAAAACGAAGAAGCGTGTCCTATGTGTCTTTGATGGGCAGCGCCGTCTGTGGAAGGACGAGATGATGCTTGACAATGAGTTCGAAGTCCGCGTCAAACTTCCGGGTGGTGCAGGAGATGGCACCAACCGGGAAGCTTACGTGACTGACTTGGACGTCGAGACATTGAAGCGTGCTGAGGGTGTTCTTAGTGCCAATGACGAAGAACGCGGCCCTTGGGTCGACAACCAGTCCACCCAGCTCATTGGACAACCGGCCGTTCTCCTCCCTGATACGTACCGGCCGCATGATGCCGAGCCCATGGACATGACCTACTAA 2033

<210>3

<211>625

<212>DNA

<213> artificial sequence

<400>3

CAGTTACTTATAAGCTTGGAGCTTGGATCTCTTTGAGGTGGACCTTCCTTGAAGGGTTTCATCTCTGTACTATCATGCGAATGCTAAAGCAGAACTTTAACAGAACCACCAGTGTCTAATAAATTCGATCCGTATATTGTGCACCATTACTCATCTGTGTTTCCCCCAAACATGCAGTCTCCTGCGCAGATAGACTGTCAACTATAGTAATTCCCGTCCGCGAAGCCGCCCTATCCAAAAGTGTATTACCCTCTCTTGTATGCAACAAGAGTCGTTCTTTCTCGCGCTAATACCCATCCGTCTATCGCACAATTAAACCTTCTGATCCCTACAATTTGCCTGACAAAATAAATGAAGTTCAACGTGCAAACAAGCTAGAGCCAGTGTACATTGAGTATCATCTGCAGCTCTACTCAAGGTACTATAGTACCTCAGCCAATTTGATGTTCCTGCCTTCCCGCCCCTCGCTTAGCCGACCAATTAGAGTTCGTTAATTCTAACCATTATTCCTATATAATTCAAAGTCCAGACAACGAATGGCTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT 625

<210>4

<211>625

<212>DNA

<213> artificial sequence

<400>4

CAGTTACTTATAAGCTTGGAGCTTGGATCTCTTTGAGGTGGACCTTCCTTGAAGGGTTTCATCTCTGTACTATCATGCGAATGCTAAAGCAGAACTTTAACAGAACCACCAGTGTCTAATAAATTCGATCCGTATATTGTGCACCATTACTCATCTGTGTTTCCCCCAAACATGCAGTCTCCTGCGCAGATAGACTGTCAACTATAGTAATTCCCGTCCGCGAAGCCGCCCTATCCAAAAGTGTATTACCCTCTCTTGTATGCAACAAGAGTCGTTCTTTCTCGCGCTAATACCCATCCGTCTATCGCACAATTAAACCTTCTGATCCCTACAATTTGCCTGACAAAATAAATGAAGTTCAACGTGCAAACAAGCTAGAGCCAGTGTACATTGAGTATCATCTGCAGCTCTACTCAAGGTACTATAGTACCTCAGCCAATTTGATGTTCCTGCCTTCCCGCCCCTCGCTTAGCCGACCAATTAGAGTTCGTTAATTCTAACCATTATTCCTATATAATTCAAAGACGTGCTTCCTCTTATGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT 625

<210>5

<211>3057

<212>DNA

<213> artificial sequence

<400>5

TCTTCCCTCTGCTACTTGCGGTGTTAAACTTTTGCTGCCTCTTCTGCCTTCCCAGCGCCCCAAGATTCGGATCTGCAAGTGACAAAATACTTCGTCGCCTTGCAGTTGGTGGATTCAAATACCGAGCTTTTAGACACGTTCTTCCAAGCTCCCTCTTTTGTCTTCTATAGGGAAATTCCCCGAACCTCGTTGGAGCTTGCTTGTGTCTCGTCACTACTACTAGGCTCCCGCTAAATACCAGGACTATCAGGGCGATAGATAGTAGGTTCCCCGAGCGGGCCGTTCCCAATCTTTGAACTCAATAACCTTCTCTCCCAAGCCCCCGGGTCCAAGGGAGCCCTGCCGGACATTATTTCCATGCCATTGATTGAGACATCAGATTGCTAACGCTCATCATGTTGCAGATCGATTGCATCCCTCCTTCTCTTCTTCTACATTAACCCTCGCATCCTCCCACCTGGAACCCAAGGAAACGAGCCAACCACTGCACGGAGCGTGGGCATGCAATCTCACGCAGACACTTCCGACTTCGTACTATTCCCTACCCACTTCACCGGTGACAACAAAATGCTGGCCCTGGATTCGTCCAGACAGCAGCATCCCCCGTACTTCCAGTCCTACCCCATGGATCCTAGTACCTTTATCGATCCTCTTGCCTTCCATGTGGACGATCTAGGTTTCAGCCAGACCCACGACCAATCCGGTGTACCCCAGTCCTCCAACTACGGTACGCCGCCTATCTACTCCGAGTCTTTCTCGGACGCCAATAAAGCTGCTGGATTTCCACCTATGCCCGCCACTCCCCCGTCCCTCCCTTATTCTTCCGATCACTTCATTCCTGGACTTTCTACTGCGTCCGGTCCTTCCGTTGCCAGCGCCTCCTCGTCCGCCATCGGATCGCCCAATACGGGTTCTGCGCATGCTATCTCGGAAGACTGGGTCCAGTTTAAACCGACGTTAACTGATATTGAAGGAGCATTTTTTGGGCTTGGCTGGAGCTAGTGGAGGTCAACAATGAATGCCTATTTTGGTTTAGTCGTCCAGGCGGTGAGCACAAAATTTGTGTCGTTTGACAAGATGGTTCATTTAGGCAACTGGTCAGATCAGCCCCACTTGTAGCAGTAGCGGCGGCGCTCGAAGTGTGACTCTTATTAGCAGACAGGAACGAGGACATTATTATCATCTGCTGCTTGGTGCACGATAACTTGGTGCGTTTGTCAAGCAAGGTAAGTGGACGACCCGGTCATACCTTCTTAAGTTCGCCCTTCCTCCCTTTATTTCAGATTCAATCTGACTTACCTATTCTACCCAAGCATCCAAATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGTACCTCATCGGTCTCCTCGGTTCAGTCCCAGCGCTCTCATCCAAGCCCGGCTGCCAGTAATGCAGAGTCCGACGATGACACCAAGGAAAAGGGACGATGCCCTTTCCCGGAGTGCAGACGTGTTTTCAAGGATCTCAAGGCTCACATCCTGACACACCAGTCAGAGAGACCCGAAAAGTGCCCCATCGTCACCTGCGAATACCATATCAAGGGTTTCGCCCGCAAGTATGACAAGAACCGTCATACTCTTACTCACTACAAAGGAACGATGGTTTGCGGCTTCTGCCCGGGGTCTGGGTCGCCCGCCGAGAAGAGCTTCAACAGGGCGGACGTCTTCAAGCGCCACTTGACATCAGTGCATGGCGTCGAACAGACACCACCTAACTGCCGGAAGAGAAGTCCAACTGCAGCGGCAAGCAAGGGGACATCTAGCTACAGCCCCGATGCGACTGGCAAGTGCTCAACTTGCTCCATTACGTTCAGTAACGCACAGGACTTCTACGAGCATCTGGACGACTGTGTGCTTCGGGTTGTGCAACAGGAAGAGCCCAGCGAGGCCATCAACCAGAAGCTGCTTTCTGAAGTCGATGCTGACGAGGAGGTGCAAAAGACGATGGAGAAACATAACTTGAACGACACGGCTGGCACCGTCGACATATACAACGACGAATATGATGATGACGATGATGACGCTTACGAATATTCGAACCTACGTTCGGGCAAAGGCCCCCTGAAGAGCACCAAGGGATCAGGGGCGGTGGCCCGTCCTATCTTGGGCGTCAACAACGCAGTCACAAAGGGTTCGTCCAATGCCAATGCTAAGATGCGTGCGACTACATCCAAGCGACGCAACAACCGTGATCGTTACCCTCAGTCCTGGGGTTGCCCTAGCAGCAGCATCAAAACGAAGAAGCGTGTCCTATGTGTCTTTGATGGGCAG 3057

<210>6

<211>25

<212>DNA

<213> artificial sequence

<400>6

CAGTTACTTATAAGCTTGGAGCTTG 25

<210>7

<211>20

<212>DNA

<213> artificial sequence

<400>7

AAAAAGCACCGACTCGGTGC 20

<210>8

<211>55

<212>DNA

<213> artificial sequence

<400>8

GCTCTAAAACAAGCCATTCGTTGTCTGGACTTTGAATTATATAGGAATAATGGTT 55

<210>9

<211>53

<212>DNA

<213> artificial sequence

<400>9

AATTCAAAGTCCAGACAACGAATGGCTTGTTTTAGAGCTAGAAATAGCAAGTT 53

<210>10

<211>55

<212>DNA

<213> artificial sequence

<400>10

GCTCTAAAACGTCATAAGAGGAAGCACGTCTTTGAATTATATAGGAATAATGGTT 55

<210>11

<211>53

<212>DNA

<213> artificial sequence

<400>11

AATTCAAAGACGTGCTTCCTCTTATGACGTTTTAGAGCTAGAAATAGCAAGTT 53

<210>12

<211>57

<212>DNA

<213> artificial sequence

<400>12

ATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTTCCCTCTGCTACTTGCGGTGTT 57

<210>13

<211>57

<212>DNA

<213> artificial sequence

<400>13

CTCCTTCAATATCAGTTAACGTCGGTTTAAACTGGACCCAGTCTTCCGAGATAGCAT 57

<210>14

<211>60

<212>DNA

<213> artificial sequence

<400>14

ATGCTATCTCGGAAGACTGGGTCCAGTTTAAACCGACGTTAACTGATATTGAAGGAGCAT 60

<210>15

<211>58

<212>DNA

<213> artificial sequence

<400>15

GGGACTGAACCGAGGAGACCGATGAGGTACCTCAGAAGAACTCGTCAAGAAGGCGATA 58

<210>16

<211>55

<212>DNA

<213> artificial sequence

<400>16

CGCCTTCTTGACGAGTTCTTCTGAGGTACCTCATCGGTCTCCTCGGTTCAGTCCC 55

<210>17

<211>55

<212>DNA

<213> artificial sequence

<400>17

CGTTGTAAAACGACGGCCAGTGCCAAGCTTCTGCCCATCAAAGACACATAGGACA 55

<210>18

<211>25

<212>DNA

<213> artificial sequence

<400>18

ACATTAACCCTCGCATCCTCCCACC 25

<210>19

<211>25

<212>DNA

<213> artificial sequence

<400>19

GCAGGTGACGATGGGGCACTTTTCG 25

Claims (10)

1. Aspergillus is improvedAspergillus) A method for constructing a recombinant strain having a protein secretion level, characterized by comprising the step of introducing a gene into AspergillusAn16g07795Inactivation or reduction to increase its ability to secrete proteins.

2. The method of claim 1, wherein the gene isAn16g07795The amino acid sequence of (2) is shown as SEQ ID NO. 1.

3. As claimed inThe method according to 1, wherein the geneAn16g07795The nucleotide sequence of (2) is shown as SEQ ID No. 2.

4. The method of claim 1, wherein the step of combining the two components is performed byAn16g07795Inactivation or reduction of a gene is by complete or partial deletion of its gene expression cassette, by insertional inactivation or by means that render the gene non-functional with respect to its intended purpose to prevent expression of the functional protein by the gene, or to reduce expression of the functional protein; preferably, genes in Aspergillus cells are genetically manipulatedAn16g07795Is knocked out.

5. The method of any one of claims 1 to 4, wherein the aspergillus is aspergillus nigerAspergillus niger）。

6. The method according to any one of claims 1 to 4, wherein the enhanced secreted protein is a protein involved in starch hydrolysis.

7. The method of claim 6, wherein the protein is a saccharifying enzyme and/or an alpha-amylase.

8. Recombinant strain obtainable by the method according to any one of claims 1 to 8.

9. Method for expressing a starch-hydrolysed protein using a recombinant strain according to claim 8, characterized in that the recombinant strain according to claim 8 is cultivated in the presence of a starch feedstock or starch inducer to obtain a starch-hydrolysed protein, preferably a saccharifying enzyme and/or an alpha-amylase; further, a step of isolating the starch-hydrolyzed protein is included.

10. A method for hydrolyzing starch using the recombinant strain of claim 7, wherein the recombinant strain of claim 9 is cultured in the presence of a starch feedstock or a starch inducer, thereby hydrolyzing starch.

Images