CN116333953A

CN116333953A - Genetically engineered bacterium for high-yield cytidine and application thereof

Info

Publication number: CN116333953A
Application number: CN202211325470.6A
Authority: CN
Inventors: 刘慧燕; 柳凤敏; 方海田; 魏晓博; 叶彤; 马聪
Original assignee: Ningxia University
Current assignee: Ningxia University
Priority date: 2022-10-27
Filing date: 2022-10-27
Publication date: 2023-06-27

Abstract

The invention provides a genetic engineering bacterium for high yield of cytidine and application thereof, which belong to the technical field of genetic engineering, and an escherichia coli aspartate transcarbamylase (ATPase) pyrBI mutant is constructed by utilizing a method of gene site-directed mutagenesis, wherein the mutant comprises the following components: m1 (H20L), M2 (K60E), M3 (K94E). Then knocking out cytidine deaminase cdd, ATP phosphoribosyl transferase gene hisG, pyruvate dehydrogenase poxB, uridine-cytidine kinase gene udk, nucleoside hydrolase encoding gene rihB and aspartate transcarbamylase regulation subunit encoding gene pyrI in escherichia coli to obtain the genetic engineering bacteria. By weakening the histidine anabolism pathway, cutting off the degradation pathway of cytidine, weakening the acetic acid synthesis pathway and increasing precursors, the aim of improving the cytidine yield is achieved, and the highest yield reaches 74.89 +/-1.032 g/L.

Description

Genetically engineered bacterium for high-yield cytidine and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a genetically engineered bacterium for producing cytidine at high yield and application thereof.

Background

Cytidine (Cytidine) is a structural component of RNA, and plays a very important role in regulating and controlling various important biochemical reactions in organisms. Cytidine is white powder, is used as pyrimidine nucleoside and is an ingredient of nucleoside functional food, and is mostly used for synthesizing medicines for treating tumors and resisting viruses. Cytidine plays an important role in the fields of foods and medicines as a raw material of functional foods and medicines, and market demands are increasing year by year.

The current methods for producing cytidine include chemical synthesis and biological synthesis, wherein the biological synthesis is further divided into RNA hydrolysis and microbial fermentation. Chemical synthesis processes generally use uridine or cytosine in the production process under certain catalytic conditions to form cytidine. RNA hydrolysis is to hydrolyze ribonucleic acid under the action of enzyme, and then to separate and purify to form cytidine. The microbial fermentation method mainly comprises a direct fermentation method, a precursor addition fermentation method and a fermentation by utilizing a gene recombination construction strain. The microbial fermentation method has the advantages of simple production process, short period, high efficiency and easy control, and has higher application value. Therefore, in order to select and breed high-yield strain which can be inherited stably, the development direction of the future industrialized production of cytidine is a microbial fermentation method.

The microbial fermentation method for synthesizing cytidine mainly depends on the fermentation action of microorganisms, so that the type of microorganisms selected for microbial fermentation is very important. Strains capable of synthesizing cytidine under natural conditions mainly originate from escherichia coli, but the cytidine synthesis amount is low.

Disclosure of Invention

In view of the above, the invention aims to provide a genetically engineered bacterium for producing cytidine with high yield and application thereof, and the genetically engineered bacterium provided by the invention is used for producing cytidine, so that the yield of cytidine is obviously improved.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a genetic engineering bacterium for high-yield cytidine, which is prepared by constructing an escherichia coli ATPase enzyme pyrBI mutant, and then knocking out cdd, hisG, poxB, udk, rihB and pyrI genes to obtain the genetic engineering bacterium;

the Escherichia coli ATPase pyrBI mutant is characterized in that His20B on the ATPase enzyme is mutated into Leu20B, lys60B is mutated into Glu60B, or Lys94B is mutated into Glu94B.

Preferably, the E.coli comprises E.coli K12.

Preferably, the initial strain of the escherichia coli K12 is escherichia coli MG1655.

Preferably, the gene is knocked out using CRISPR/Cas9 mediated gene editing techniques.

Preferably, the nucleotide sequence of the cdd gene is shown as SEQ ID No. 1; the nucleotide sequence of the hisG gene is shown as SEQ ID No. 2; the nucleotide sequence of the poxB gene is shown as SEQ ID No. 3; the nucleotide sequence of the udk gene is shown as SEQ ID No. 4; the nucleotide sequence of the rihB gene is shown as SEQ ID No. 5; the nucleotide sequence of the pyrI gene is shown in SEQ ID No. 6.

The invention also provides application of the genetically engineered bacterium in preparing cytosine nucleosides.

Preferably, the application comprises the steps of:

1) Inoculating the genetically engineered bacteria into a seed culture medium for culture to obtain seed liquid;

2) Inoculating the seed solution obtained in the step 2) into a fermentation medium for fermentation to obtain cytosine nucleoside.

Preferably, the seed culture medium in step 1) uses water as a solvent, and each liter comprises: 2 to 5g of ammonium nitrate, 5 to 10g of glucose, 0.002 to 0.004g of biotin, 5 to 8g of yeast powder and 8 to 12g of peptone, and the pH value is 7.0 to 7.2.

Preferably, the fermentation medium of the step 2) uses water as a solvent, and each liter comprises: 8-10 g of dipotassium hydrogen phosphate, 80-100 g of glucose, 10-15 g of calcium carbonate, 15-20 g of corn steep liquor, 20-30 g of ammonium nitrate, 0.4-0.8 g of monopotassium phosphate, 0.4-0.8 g of magnesium sulfate heptahydrate, 0.01-0.05 g of ferrous sulfate and phenol red, wherein the pH value is 7.0-7.2;

the mass percentage of phenol red in the fermentation medium is 0.1-0.5%.

Preferably, the fermentation conditions of step 2) include: the temperature is 37 ℃, the time is 40-50 h, and the rotating speed is 200rpm.

The mechanism of the genetically engineered bacterium for improving the output of cytosine nucleoside provided by the invention is as follows:

according to the invention, cdd, udk, rihB gene is knocked out, a degradation path of cytidine is cut off, hisG and pyrI genes are knocked out, precursors are added, poxB genes are knocked out, and a path of pyruvic acid to acetic acid metabolism is weakened; after site-directed mutagenesis of E.coli ATPase mutant enzyme gene pyrBI, the feedback regulation of UMP and CTP on the enzyme is released. After the recombinant strain is obtained, the yield of cytosine nucleoside produced by the genetically engineered bacteria is improved.

The invention has the following effective effects:

1. the invention provides a genetically engineered bacterium for high-yield cytidine, which constructs escherichia coli ATPase mutant enzyme pyrBI by utilizing a gene site-directed mutagenesis method to obtain three mutants: m1 (H20L), M2 (K60E), M3 (K94E), knock-out cytidine deaminase cdd, ATP phosphoribosyl transferase gene hisG, pyruvate dehydrogenase poxB, uridine-cytidine kinase gene udk, nucleoside hydrolase encoding gene rihB and aspartate transcarbamylase regulatory subunit encoding gene pyrI; the aim of improving the yield of cytidine is achieved by weakening the anabolism pathway of histidine, cutting off the degradation pathway of cytidine, weakening the synthesis pathway of acetic acid and increasing precursors, and a scientific basis is provided for subsequent and more efficient cytidine production strain breeding.

2. The strain provided by the technical scheme has the advantages of simple culture medium, simple fermentation process and low cost, and is suitable for industrial application.

3. The provided genetically engineered bacteria cytidine yields were respectively 290+ -9.17 mg/L, M (K60E) for M1 (H20L) 305+ -4.04 mg/L, M (K94E) 445+ -7.02 mg/L, 10.604 + -0.011 g/L for E.coli K-12 (Δcdd ΔhisG), 20.789 + -0.016 g/L for E.coli K-12 (Δcdd ΔhisG ΔpoxB) 40.64+ -0.02 g/L, 60.10+ -0.07 g/L for E.coli K-12 (Δcdd ΔhisG ΔpoxB Δudk), 65.53+ -0.09 g/L for E.coli K-12 (Δcdd ΔhisG Δudk ΔtriB) and 84.032 g/L for E.i K-12 (Δcdd ΔhisG ΔpoxB Δudk ΔtriB).

Drawings

FIG. 1 is a recombinant strain engineering strategy;

FIG. 2 shows cytidine yields of the recombinant strains.

Detailed Description

The invention provides a genetically engineered bacterium for high-yield cytosine nucleosides, which constructs escherichia coli ATPase mutant enzyme pyrBI by utilizing a gene site-directed mutagenesis method to obtain three mutants: m1 (H20L), M2 (K60E) and M3 (K94E), the knockdown cytidine deaminase cdd, ATP phosphoribosyl transferase gene hisG, pyruvate dehydrogenase poxB, uridine-cytidine kinase gene udk, nucleoside hydrolase encoding gene rihB and aspartate transcarbamylase regulatory subunit encoding gene pyrI in the escherichia coli are knocked down to obtain the genetically engineered bacterium. In the invention, the Escherichia coli ATPase pyrBI mutant is formed by mutating His20B on ATPase enzyme into Leu20B, or mutating Lys60B into Glu60B, or mutating Lys94B into Glu94B. The genotype of the genetically engineered bacterium is named as E.coli K12 MG1655 delta cddΔhisGΔpoxBΔudkΔrihBΔpyrI.

In the present invention, the starting strain of E.coli is preferably E.coli K12 MG1655.

In the present invention, the nucleotide sequence of the pyrBI gene is shown in SEQ ID No.7, and is specifically as follows:

atggctaatccgctatatcagaaacatatcatttccataaacgaccttagtcgcgatgaccttaatctggtgctggcgacagcggcgaaactgaaagcaaacccgcaaccagagctgttgaagcacaaagtcattgccagctgtttcttcgaagcctctacccgtacccgcctctctttcgaaacatctatgcaccgcctgggggccagcgtggtgggcttctccgacagcgccaatacatcactgggtaaaaagggcgaaacgctggccgataccatttcggttatcagcacttacgtcgatgcgatagtgatgcgtcatccgcaggaaggtgcggcgcgcctggccaccgagttttccggcaatgtaccggtactgaatgccggtgatggctccaaccaacatccgacgcaaaccttgctggacttattcactattcaggaaacccaggggcgtctggacaatctccacgtcgcaatggttggtgacctgaaatatggccgcaccgttcactccctgactcaggcgttagcgaagttcgacggcaaccgtttttacttcatcgcgccggacgcgctggcaatgccgcaatacattctggatatgctcgatgaaaaagggatcgcatggagtctgcacagctctattgaagaagtgatggcggaagtagacatcctgtacatgacccgcgtgcaaaaagagcgtctggacccgtccgagtacgccaacgtgaaagcgcagtttgttcttcgcgccagcgatctccacaacgccaaagccaatatgaaagtgctgcatccgctgccgcgtgttgatgagattgcgacggatgttgataaaacgccacacgcctggtacttccagcaggcaggcaacgggattttcgctcgccaggcgttactggcactggttctgaatcgcgatctggtactgtaaggggaaatagagatgacacacgataataaattgcaggttgaagctattaaacgcggcacggtaattgaccatatccccgcccagatcggttttaagctgttgagtctgttcaagctgaccgaaacggatcagcgcatcaccattggtctgaacctgccttctggcgagatgggccgcaaagatctgatcaaaatcgaaaatacctttttgagtgaagatcaagtagatcaactggcattgtatgcgccgcaagccacggttaaccgtatcgacaactatgaagtggtgggtaaatcgcgcccaagtctgccggagcgcatcgacaatgtgctggtctgcccgaacagcaactgtatcagccatgccgaaccggtttcatccagctttgccgtgcgaaaacgcgccaatgatatcgcgctcaaatgcaaatactgtgaaaaagagttttcccataatgtggtgctggccaattaa。

in the invention, the nucleotide sequence of the cdd gene is shown as SEQ ID No.1, and is specifically as follows:

atgcatccacgttttcaaaccgcttttgcccaacttgcggataacttgcaatctgcactggaacctattctggcagacaagtacttccccgctttgttgaccggggagcaagtctcatcgctgaagagcgcaacggggctggacgaagacgcgctggcattcgcactacttccgctggcggcggcctgtgcgcgtacgccattgtcgaattttaatgttggcgcaattgcgcgcggtgtgagcggaacctggtatttcggtgccaatatggaatttattggtgcgacaatgcagcaaaccgttcatgccgaacaaagcgcgatcagccacgcctggttgagtggtgaaaaagcgcttgcagccatcaccgttaactacacgccttgtggtcactgccgtcagtttatgaatgaactgaacagcggtctggatctgcgtattcatctgccgggccgcgaggcacacgcgctgcgtgactatctgccagatgcctttgggccgaaagatctggagattaaaacgctgctgatggacgaacaggatcacggctatgcgctgacgggtgatgcgctttctcaggcagcgattgcggcggcaaaccgttcgcacatgccttacagtaagtcgccaagcggtgtcgcgctggaatgtaaagacggtcgtattttcagtggcagctacgctgaaaacgccgcattcaacccgactctgccaccgttgcagggagcgttaattctgttgaatctcaagggttatgattacccggatatccagcgcgcggttctggcagaaaaagccgatgcgccgttgattcagtgggatgccacctccgcaacgctgaaagctctcggctgtcacagtatcgaccgagtgcttctcgcttaa；

the nucleotide sequence of the hisG gene is shown as SEQ ID No.2, and is specifically as follows:

atgacagacaacactcgtttacgcatagctatgcagaaatccggccgtttaagtgatgactcacgcgaattgctggcgcgctgtggcattaaaattaatcttcacacccagcgcctgatcgcgatggcagaaaacatgccgattgatattctgcgcgtgcgtgacgacgacattcccggtctggtaatggatggcgtggtagaccttgggattatcggcgaaaacgtgctggaagaagagctgcttaaccgccgcgcccagggtgaagatccacgctactttaccctgcgtcgtctggatttcggcggctgtcgtctttcgctggcaacgccggttgatgaagcctgggacggtccgctctccttaaacggtaaacgtatcgccacctcttatcctcacctgctcaagcgttatctcgaccagaaaggcatctcttttaaatcctgcttactgaacggttctgttgaagtcgccccgcgtgccggactggcggatgcgatttgcgatctggtttccaccggtgccacgctggaagctaacggcctgcgcgaagtcgaagttatctatcgctcgaaagcctgcctgattcaacgcgatggcgaaatggaagaatccaaacagcaactgatcgacaaactgctgacccgtattcagggtgtgatccaggcgcgcgaatcaaaatacatcatgatgcacgcaccgaccgaacgtctggatgaagtcatcgccctgctgccaggtgccgaacgcccaactattctgccgctggcgggtgaccaacagcgcgtagcgatgcacatggtcagcagcgaaaccctgttctgggaaaccatggaaaaatgaaagcgctgggtgccagttcaattctggtcctgccgattgagaagatgatggagtga；

the nucleotide sequence of the poxB gene is shown as SEQ ID No.3, and is specifically as follows:

atgaaacaaacggttgcagcttatatcgccaaaacactcgaatcggcaggggtgaaacgcatctggggagtcacaggcgactctctgaacggtcttagtgacagtcttaatcgcatgggcaccatcgagtggatgtccacccgccacgaagaagtggcggcctttgccgctggcgctgaagcacaacttagcggagaactggcggtctgcgccggatcgtgcggccccggcaacctgcacttaatcaacggcctgttcgattgccaccgcaatcacgttccggtactggcgattgccgctcatattccctccagcgaaattggcagcggctatttccaggaaacccacccacaagagctattccgcgaatgtagtcactattgcgagctggtttccagcccggagcagatcccacaagtactggcgattgccatgcgcaaagcggtgcttaaccgtggcgtttcggttgtcgtgttaccaggcgacgtggcgttaaaacctgcgccagaaggggcaaccatgcactggtatcatgcgccacaaccagtcgtgacgccggaagaagaagagttacgcaaactggcgcaactgctgcgttattccagcaatatcgccctgatgtgtggcagcggctgcgcgggggcgcataaagagttagttgagtttgccgggaaaattaaagcgcctattgttcatgccctgcgcggtaaagaacatgtcgaatacgataatccgtatgatgttggaatgaccgggttaatcggcttctcgtcaggtttccataccatgatgaacgccgacacgttagtgctactcggcacgcaatttccctaccgcgccttctacccgaccgatgccaaaatcattcagattgatatcaacccagccagcatcggcgctcacagcaaggtggatatggcactggtcggcgatatcaagtcgactctgcgtgcattgcttccattggtggaagaaaaagccgatcgcaagtttctggataaagcgctggaagattaccgcgacgcccgcaaagggctggacgatttagctaaaccgagcgagaaagccattcacccgcaatatctggcgcagcaaattagtcattttgccgccgatgacgctattttcacctgtgacgttggtacgccaacggtgtgggcggcacgttatctaaaaatgaacggcaagcgtcgcctgttaggttcgtttaaccacggttcgatggctaacgccatgccgcaggcgctgggtgcgcaggcgacagagccagaacgtcaggtggtcgccatgtgcggcgatggcggttttagcatgttgatgggcgatttcctctcagtagtgcagatgaaactgccagtgaaaattgtcgtctttaacaacagcgtgctgggctttgtggcgatggagatgaaagctggtggctatttgactgacggcaccgaactacacgacacaaactttgcccgcattgccgaagcgtgcggcattacgggtatccgtgtagaaaaagcgtctgaagttgatgaagccctgcaacgcgccttctccatcgacggtccggtgttggtggatgtggtggtcgccaaagaagagttagccattccaccgcagatcaaactcgaacaggccaaaggtttcagcctgtatatgctgcgcgcaatcatcagcggacgcggtgatgaagtgatcgaactggcgaaaacaaactggctaaggtaa；

the nucleotide sequence of the udk gene is shown as SEQ ID No.4, and is specifically as follows:

atgactgatcagtctcatcagtgcgtcattatcggtatcgctggcgcatcggcttccggcaagagtcttattgccagtaccctttatcgtgaattgcgtgagcaagtcggtgatgaacacatcggcgtaattcccgaagactgctattacaaagatcaaagccatctgtcgatggaagaacgcgttaagaccaactacgaccatcccagcgcgatggatcacagtctgctgcttgagcatttacaagcgttgaaacgcggctcggcaattgacctgccggtttacagctatgttgaacatacgcgtatgaaagaaacggtgacggttgagccgaagaaggtcatcattctcgaaggcattttgttgctgacggatgcgcgtttgcgtgacgaacttaacttctccattttcgttgataccccgctggatatctgcctgatgcgccgcatcaagcgtgacgttaacgagcgtgggcgttcaatggattcagtgatggcgcaatatcaaaaaaccgtgcgcccgatgttcctgcaattcattgagccttctaaacaatatgcggacattatcgtgccgcgcggcgggaaaaaccgcatcgcgatcgatatattgaaagcgaaaataagtcagttctttgaataa；

the nucleotide sequence of the rihB gene is shown as SEQ ID No.5, and is specifically as follows:

atggaaaagagaaaaattattctggattgtgatccgggtcatgatgatgctattgctataatgatggcggcgaaacatccggcaatagatttattaggcatcactattgtagcgggtaatcagacgcttgataaaacattaattaatggcctgaatgtttgccagaaactggagattaatgttccggtttatgcggggatgccgcagcccattatgcgtcaacaaatcgttgccgataatattcacggtgaaaccggactggatggcccggtattcgagccgctgacccgccaggcagaaagcactcatgcggtgaaatatatcattgataccctgatggcaagcgatggcgatatcactctggtgccggttggtccgctttcaaatatcgcggtggcaatgcgtatgcaacccgcgatcctgcccaaaatccgtgaaattgtgctaatgggcggcgcttacggtacaggcaacttcacgccatctgccgagttcaacatctttgccgacccggaagccgcacgcgtagtgttcacctccggcgttccattagtgatgatgggcctcgatctcaccaaccagaccgtttgcaccccggacgtgattgctcggatggaaagggcaggcggccccgccggagagctgttcagcgacatcatgaacttcactctcaaaacgcagttcgaaaactacggccttgctggcggcccggtgcacgacgccacctgcatcggttatctgattaaccctgatggcattaaaacccaggagatgtacgtcgaagtggacgtcaacagtggcccttgctatgggcgtaccgtctgcgacgagctgggcgttcttggcaagcccgccaataccaaagtcggcatcactattgatacagactggttctggggattagtcgaagagtgcgtgcgcggctacatcaaaacccattaa；

the nucleotide sequence of the pyrI gene is shown as SEQ ID No.6, and is specifically as follows:

atgacacacgataataaattgcaggttgaagctattaaacgcggcacggtaattgaccatatccccgcccagatcggttttaagctgttgagtctgttcaagctgaccgaaacggatcagcgcatcaccattggtctgaacctgccttctggcgagatgggccgcaaagatctgatcaaaatcgaaaatacctttttgagtgaagatcaagtagatcaactggcattgtatgcgccgcaagccacggttaaccgtatcgacaactatgaagtggtgggtaaatcgcgcccaagtctgccggagcgcatcgacaatgtgctggtctgcccgaacagcaactgtatcagccatgccgaaccggtttcatccagctttgccgtgcgaaaacgcgccaatgatatcgcgctcaaatgcaaatactgtgaaaaagagttttcccataatgtggtgctggccaattaa。

the invention preferably utilizes a gene site-directed mutagenesis method to construct an E.coli ATPase enzyme pyrBI mutant.

The gene was knocked out using CRISPR/Cas9 mediated gene editing techniques. The CRISPR/Cas9 mediated gene editing technology is not particularly limited, and a person skilled in the art can knock out the gene conventionally.

In still another embodiment of the present invention, in the above construction method, a gene site-directed mutagenesis kit is used for the point mutation, the gene knockout method is a one-step knockout technique, and the nucleotide mutant fragment used has two homology arms upstream and downstream of the knockout gene and a kanamycin resistance gene cassette.

In yet another embodiment of the present invention, the mutant M1, M2, M3 nucleotide fragments are obtained by PCR direct amplification; the cdd, hisG, poxB, udk, rihB and pyrI knocked-out nucleotide mutant fragments were obtained by recombinant PCR.

In yet another embodiment of the present invention, wherein the primer sequences for amplifying the mutant M1, M2, M3 nucleotide fragments are shown in SEQ ID NOS.8-15, the primer sequences for amplifying the cdd, hisG, poxB, udk, rihB and pyrI nucleotide mutant fragments are shown in SEQ ID NOS.16-53.

In the present invention, the application includes the steps of:

The genetic engineering bacteria are inoculated in a seed culture medium for culture, so as to obtain seed liquid. In the present invention, the seed medium preferably contains water as a solvent, and each liter of the seed medium contains: 2 to 5g of ammonium nitrate, 5 to 10g of glucose, 0.002 to 0.004g of biotin, 5 to 8g of yeast powder and 8 to 12g of peptone, and the pH value is 7.0 to 7.2. In the present invention, the conditions of the culture preferably include: the temperature was 37℃and the rotational speed was 180rpm for 12 hours.

The invention inoculates the seed liquid obtained in the fermentation medium to ferment and obtain the cytosine nucleoside. In the present invention, the fermentation medium preferably comprises water as a solvent, per liter: 8-10 g of dipotassium hydrogen phosphate, 80-100 g of glucose, 10-15 g of calcium carbonate, 15-20 g of corn steep liquor, 20-30 g of ammonium nitrate, 0.4-0.8 g of monopotassium phosphate, 0.4-0.8 g of magnesium sulfate heptahydrate, 0.01-0.05 g of ferrous sulfate and phenol red, wherein the pH value is 7.0-7.2; the mass percentage of phenol red in the fermentation medium is 0.1-0.5%. In the present invention, the conditions of the fermentation include: the temperature is 37 ℃, the time is 40-50 h, and the rotating speed is 180rpm. In the present invention, the seed solution is preferably inoculated in an amount of 10 to 15%. The cytosine nucleoside content obtained by the fermentation is 0-10 g/L.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention. In the examples described below, materials, reagents, plasmids, kits for exclusive use, strains, etc., were obtained commercially, unless otherwise specified.

Example 1

Construction of E.coli aspartate carbamyl transferase (ATPase) anti-feedback inhibition mutant

1. Construction of recombinant E.coli expression plasmid

Primers were designed based on the nucleotide sequence (GenBank: U00096) of the ATPase gene pyrBI of E.coli K12 standard strain MG1655 retrieved on NCBI for cloning and site-directed mutagenesis of the ATPase gene, the pyrBI gene was amplified using E.coli K12 genomic DNA as template and primers P1 and P2, and ligated into pSTV28 vector by conventional molecular cloning means, containing resistance markers of

Cm ^r The target gene fragment amplified by the primers P1 and P2 is connected to a P STV28 carrier, and then the primers F1 and R1, the primers F2 and R2 and the primers F3 and R3 are respectively used for carrying out recombinant plasmid

PCR to obtain recombinant plasmid. Wherein the primer sequences for amplifying the nucleotide mutant fragments are as follows:

P1：CTGAGGAT CCATGGCTAATCCGCTATATCAGAAAC(SEQ ID No.8)

P2：CTGAAAGCTTTTAATTGGCCAGCACCACATTATGGG(SEQ ID No.9)

F1：

R1：

F2：

R2：

F3：

R3：

2. site-directed mutagenesis of recombinant E.coli expression plasmids

Gene Site-directed mutagenesis kit (Site-directed Gene Mutagenesis Kit) was used for point mutagenesis. PCR was performed on the constructed recombinant plasmid. The target gene fragments are cloned from genome and respectively introduced into mutation sites for plasmid PCR. Nucleotide sequencing was performed by sending the site-directed mutated pyrBI to the large gene company.

Carrying out PCR on the constructed recombinant plasmid, and then carrying out transformation and clone identification: 5-10 mu L of the DpnI digested mutant product is added into 100 mu LDH5 alpha competent cells, the ice bath is carried out for 20min, the heat shock is carried out at 42 ℃ for 60s, the ice bath is carried out for 2min, 890 mu L of SOC culture medium is added, and the temperature is 3 ℃ and 180r/min is recovered for 1h. Centrifugation was performed for 1min at 5000r/min before plating, all were uniformly plated onto LB plates containing chloramphenicol, incubated overnight at 37℃for colony PCR, and then single clone was picked up to extract plasmids for enzyme digestion verification. According to the screening result of colony PCR, selecting bacterial strain from single colony of each recombinant plasmid, culturing, taking proper quantity of culture solution, extracting plasmid by using plasmid DNA small quantity extraction kit of Bomaide company, making the purified plasmid respectively implement single enzyme digestion reaction by means of BamHI and HindIII, at the same time making double enzyme digestion reaction. Sequencing and sequence analysis of the obtained gene show that His20B on ATPase has been mutated into Leu20B, lys60B has been mutated into Glu60B, lys94B has been mutated into Glu94B mutated gene, and the obtained ATPase gene sequence accords with the designed mutation. These three strains were designated M1, M2 and M3, respectively, in which His20B of ATPase in M1 was mutated to Leu20B, M2 was mutated to Glu60B at Lys60B on the M1 basis, and M3 was mutated to Glu94B at Lys94B on the M2 basis.

Example 2

Construction of genetically engineered bacterium for high cytidine yield

(1) Cdd gene of mutant strain M3 is knocked out by CRISPR Cas9 gene editing technology

1. Coli M3 obtained in example 1 was used as starting strain;

2. coli K-12 competent cells containing pCas plasmid were prepared.

3. The genome DNA of the escherichia coli M3 is used as a template, primers cdd-Up-F, cdd-Up-RPCR are respectively designed for amplification to obtain an upstream homology arm segment N1, and primers cdd-Down-F, cdd-Down-R are used for PCR amplification to obtain a downstream homology arm segment N2. The cd upstream and downstream homology arm fragments were ligated using overlap extension (SOE) PCR. SOE PCR amplification is performed by using upstream and downstream homology arm fragments N1 and N2 as templates and primers cdd-Up-F, cdd-Down-R to synthesize Donor DNA. PCR amplification is carried out by taking pTargetF plasmid as a template and sg20-F-SpeI and sg20-R as primers, correct transformants are screened, plasmids are extracted, and the recombinant plasmid pTargetF-cdd capable of recognizing cdd genes is obtained.

3. The constructed plasmid pTargetF-cdd and the knocked-out DNA fragment are added into 40 mu L of E.coli K-12 delta cdd competent cells containing pCas plasmid, after gentle mixing, the mixture is injected into a straight 1 mm-sized electrorotating cup which is pre-cooled in advance, under the condition of 1.8kV voltage, electric shock is carried out for 5ms, 1mL of LB liquid medium is rapidly added after electric shock is finished, the mixture is cultured for 2h at 180rpm and 30 ℃ for resuscitation, and then bacterial suspension is uniformly coated on LB resistant solid medium of 50mg/L spectinomycin and 50mg/L kanamycin, and is cultured overnight at 30 ℃.

4. Clones containing pCas and pTargetF-cdd identified as correct were inoculated into LB liquid medium containing 0.5mmol/L IPTG and 50mg/L kanamycin and cultured overnight at 37 ℃. Then, the bacterial liquid is coated on an LB solid plate containing 50mg/L kanamycin, cultured overnight, after single colony grows out, randomly picked colonies are inoculated on the LB solid plate containing 50mg/L spectinomycin, cultured overnight to eliminate plasmid pTargetF, then the strain is inoculated into an LB solid culture medium, cultured overnight at 37 ℃ to eliminate pCas plasmid, and the knockout strain E.coli K-12 (delta cdd) is obtained. Plasmid elimination results were verified using B0871-F, B0871-R as primers.

5. Picking single colony of active original bacteria E.coli K-12 and mutant strain E.coli K-12 (delta cdd) on LB plate into LB liquid test tube, and culturing at 37 deg.C and 180-200 rpm overnight. Bacterial liquid PCR was performed using the identification primer cdd-S, cdd-A to verify the knockdown results.

Based on the knockdown strain E.coli K-12 (Δcdd), the gene hisG, poxB, udk, rihB, pyrI was knocked down in the same manner as in the step (1). Wherein the primer sequences for amplifying the nucleotide mutant fragments are as follows:

sg20-F-SpeI：GTCCTAGGTATAATACTAGTTTTATGAATGAACTGAACAGGTTTTAGAGCTAGAAATAGC(SEQ ID No.16)；

sg20-R：TTCAAAAAAAGCACCGACTCGG(SEQ ID No.17)；

cdd-Up-F：CCGAGTCGGTGCTTTTTTTGAAGCAGTTTGCGTGATTTTCGTCGG(SEQ ID No.18)；

cdd-Up-R：TGAAAACGTGGATGCATGGCG(SEQ ID No.19)；

cdd-Down-F：CGCCATGCATCCACGTTTTCACGCTTAAGCCTGGTGCCGGA(SEQ ID No.20)；

cdd-Down-R：ACGCGTCGACCAATGCGTTATCGCCGCTCAGTA(SEQ ID No.21)；

cdd-S：CCCATTACATGATTATGAGGC(SEQ ID No.22)；

cdd-A：CGCAAGAAACGGCAAACT(SEQ ID No.23)；

hisG-Up-F：

ATGACAGACAACACTCGTTTACGCATAGCTATGCAGAAATCCGGCCGTTTAAGTGATTGAGCGATTGT GTAGGCTGGAG(SEQ ID No.24)；

hisG-Up-R：

TCACTCCATCATCTTCTCAATCGGCAGGACCAGAATTGAACTGGCACCCAGCGCTTTAACGGCTGACA TGGGAATTAGC(SEQ ID No.25)；

hisG-S：CGGTTGATAACGGTTCAGACAG(SEQ ID No.26)；

hisG-A：TTAAAGCTCATGGCGATCACTA(SEQ ID No.27)；

poxB-Up-F：CCGAGTCGGTGCTTTTTTTGAAGCGGTCTGAAATTCACCAAACTG(SEQ ID No.28)；

poxB-Up-R：GCTGCAACCGTTTGTTTCATGG(SEQ ID No.29)；

poxB-Down-F：CCATGAAACAAACGGTTGCAGCGCTAAGGTAAAAAGGGTGGCATT(SEQ ID No.30)；

poxB-Down-R ACGCGTCGACGGGTTTGATTTTCATCGCCACT(SEQ ID No.31)；

poxB-S：ACCGTTATCACATTCAGGAG(SEQ ID No.32)；

poxB-A：AACGGTATCACTGCGTAAAT(SEQ ID No.33)；

udk-Up-S：CCGAGTCGGTGCTTTTTTTGAAGATGGACGTCGGGAACCACAGTG(SEQ ID No.34)；

udk-Up-A：AGTCATATATTTAGCGACCTGATTAACCTGGAT(SEQ ID No.35)；

udk-Down-S：ATCCAGGTTAATCAGGTCGCTAAATATATGACTGAATAAGCTTGATAAATTGTGTACCGTTCAGTGA(SEQ ID No.36)；

udk-Down-A：ACGCGTCGACGTGACGTGCACCATCAGCCCC(SEQ ID No.37)；

udk-S：ATCCAGGTTAATCAGGTCG(SEQ ID No.38)；

udk-A：ACGCCAATTACGTCAAGG(SEQ ID No.39)；

rihB-Up-S：CCGAGTCGGTGCTTTTTTTGAACGGACGGTAATGTTTCATAGGGAGC(SEQ ID No.40)；

rihB-Up-A：CTTTTCCATTGTTTATTTCCTCTGTTTCCA(SEQ ID No.41)；

rihB-Down-S：TGGAAACAGAGGAAATAAACAATGGAAAAGCATTAAGTGTTGATAACAAGCCGGGC(SEQ ID No.42)；

rihB-Down-A：ACGCGTCGACTCGAATTAAAATCCCCATCACACCG(SEQ ID No.43)；

rihB-S：CCCTCCGTCAGATGAACTAAAC(SEQ ID No.44)；

rihB-A：TTATGACGGGAAATGCCACC(SEQ ID No.45)；

pyrI-Up-F：CCGAGTCGGTGCTTTTTTTGAATCGCAATGGTTGGTGACCTGAAAT(SEQ ID No.46)；

pyrI-Up-R：TTTATTATCGTGTGTCATCTCTATTTCCCCTTA(SEQ ID No.47)；

pyrI-Down-F：TAAGGGGAAATAGAGATGACACACGATAATAAATAATTGCGGTTGGTAATAAAAGTCTGGC(SEQ ID No.48)；

pyrI-Down-R：AACTGCAGGCCCGGATTTCCATCAAGATTAGC(SEQ ID No.49)；

pyrI-S：CGT TAC TGG CAC TGG TTC TGA(SEQ ID No.50)；

pyrI-A：GTC GCGATAGTT TTG CTCATG(SEQ ID No.51)。

example 3

Shake flask fermentation production of cytidine using escherichia coli starting strain and knockout strain

The colonies of the E.coli K-12 and the knock-out strains M1, M2, M3, E.coli K-12 (. DELTA.cdd), E.coli K-12 (. DELTA.cdd. DELTA.hisG), E.coli K-12 (. DELTA.cdd. DELTA.hisG. DELTA.poxB. DELTA.udk. DELTA.uhb) and E.coli K-12 (. DELTA.cdd. DELTA.hisG. DELTA.poxB. DELTA.udk. DELTA.rihB. DELTA.pyrI) prepared in examples 1 and 2 were picked up, respectively, inoculated onto LB slant medium, and cultured overnight at 37 ℃. Single colonies stored on the slant medium were spotted with sterile toothpicks, the toothpicks with the colonies attached were placed into 50mL of seed medium, sealed with sterile gauze, and cultured at 37℃for 12 hours at 200rpm. 5mL of seed fermentation liquid is sucked and mixed in a fermentation culture medium with the volume of 45mL, a sterile gauze is used for sealing, three bacteria are inoculated in parallel, the culture is carried out for 48h under the condition of 200rpm and 37 ℃, ammonia water is added in the fermentation process, the pH value is maintained within the range of 6.5-7, the fermentation liquid is sampled every 4h for measuring the concentration of bacteria and the content of glucose, and the samples are stored in a refrigerator with the temperature of minus 20 ℃. And (5) measuring the cytidine content of the fermented sample by using a high performance liquid chromatograph. The results are shown in Table 1.

The conditions of the high performance liquid chromatography are as follows: c (C) ₁₈ The chromatographic column detects the acetonitrile with the wavelength of 270nm, the flow rate of 1ml/min and the mobile phase of 4 percent.

The seed culture medium (g/L) is: ammonium nitrate 2, glucose 5, biotin 0.002, yeast powder 5, peptone 10, pH7.0-7.2.

The shake flask culture medium (g/L) is: dipotassium hydrogen phosphate 10, glucose 100, calcium carbonate 10, corn steep liquor 20, ammonium nitrate 20, monopotassium phosphate 0.5, magnesium sulfate heptahydrate 0.4, ferrous sulfate 0.01, phenol red (0.1%) 2mL, pH7.0-7.2.

E.coli K-12 (Δcdd), E.coli K-12 (Δcdd ΔhisG ΔpoxB Δudk ΔrihB), E.coli K-12 (Δcdd ΔhisG ΔpoxB ΔrihB ΔpyrI) are hereinafter abbreviated as knock 1, knock 2, knock 3, knock 4, knock 5, and knock 6.

TABLE 1 influence of wild-type and mutant-containing Gene recombination on cytidine yield (mg/L)

Fermentation time	E.coliK-12	M1	M2	M3
					40h	125±5.57	290±9.17	305±4.04	445±7.02

TABLE 2 cytidine yield (g/L) of original and knocked out strains

Fermentation time	K12	Knock out 1	Knock-out 2	Knock-out 3	Knock out 4	Knock-out 5	Knock-out 6
								40h	0.549	10.604	20.789	40.64	60.10	65.53	74.89

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. A genetic engineering bacterium for producing cytosine nucleosides with high yield is characterized in that an escherichia coli ATPase enzyme pyrBI mutant is constructed, and then cdd, hisG, poxB, udk, rihB and pyrI genes are knocked out to obtain the genetic engineering bacterium;

2. The genetically engineered bacterium of claim 1, wherein the escherichia coli comprises escherichia coli K12.

3. The genetically engineered bacterium of claim 2, wherein the starting strain of e.coli K12 is e.coli MG1655.

4. The genetically engineered bacterium of claim 1, wherein the gene is knocked out using CRISPR/Cas 9-mediated gene editing techniques.

5. The construction method according to claim 1, wherein the cdd gene has a nucleotide sequence shown in SEQ ID No. 1; the nucleotide sequence of the hisG gene is shown as SEQ ID No. 2; the nucleotide sequence of the poxB gene is shown as SEQ ID No. 3; the nucleotide sequence of the udk gene is shown as SEQ ID No. 4; the nucleotide sequence of the rihB gene is shown as SEQ ID No. 5; the nucleotide sequence of the pyrI gene is shown in SEQ ID No. 6.

6. The use of the genetically engineered bacterium of any one of claims 1 to 5 in the preparation of cytosine nucleosides.

7. The application according to claim 6, characterized in that the application comprises the steps of:

8. The use according to claim 7, wherein the seed medium of step 1) is water-soluble and comprises per liter: 2 to 5g of ammonium nitrate, 5 to 10g of glucose, 0.002 to 0.004g of biotin, 5 to 8g of yeast powder and 8 to 12g of peptone, and the pH value is 7.0 to 7.2.

9. The use according to claim 7, wherein the fermentation medium of step 2) is water-soluble and comprises per liter: 8-10 g of dipotassium hydrogen phosphate, 80-100 g of glucose, 10-15 g of calcium carbonate, 15-20 g of corn steep liquor, 20-30 g of ammonium nitrate, 0.4-0.8 g of monopotassium phosphate, 0.4-0.8 g of magnesium sulfate heptahydrate, 0.01-0.05 g of ferrous sulfate and phenol red, wherein the pH value is 7.0-7.2;

the mass percentage of phenol red in the fermentation medium is 0.1-0.5%.

10. The use according to claim 7, wherein the fermentation conditions of step 2) comprise: the temperature is 37 ℃, the time is 40-50 h, and the rotating speed is 200rpm.