CN116298310A - Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease - Google Patents

Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease Download PDF

Info

Publication number
CN116298310A
CN116298310A CN202310130290.0A CN202310130290A CN116298310A CN 116298310 A CN116298310 A CN 116298310A CN 202310130290 A CN202310130290 A CN 202310130290A CN 116298310 A CN116298310 A CN 116298310A
Authority
CN
China
Prior art keywords
nosip
agmat
chronic obstructive
obstructive pulmonary
pulmonary disease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310130290.0A
Other languages
Chinese (zh)
Inventor
潘文
王宗玲
戴丽娜
王凤良
徐硕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Fuwai Cardiovascular Hospital Co ltd
Original Assignee
Qingdao Fuwai Cardiovascular Hospital Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Fuwai Cardiovascular Hospital Co ltd filed Critical Qingdao Fuwai Cardiovascular Hospital Co ltd
Priority to CN202310130290.0A priority Critical patent/CN116298310A/en
Publication of CN116298310A publication Critical patent/CN116298310A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N1/00—Sampling; Preparing specimens for investigation
    • G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
    • G01N1/30—Staining; Impregnating ; Fixation; Dehydration; Multistep processes for preparing samples of tissue, cell or nucleic acid material and the like for analysis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/12—Pulmonary diseases
    • G01N2800/122—Chronic or obstructive airway disorders, e.g. asthma COPD
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides application of a reagent for detecting a marker in preparation of a product for diagnosing and/or predicting chronic obstructive pulmonary disease. The marker of the invention is any one or more of NOSIP, AGMAT, LINC01215, the invention discovers that NOSIP, AGMAT and/or LINC01215 have significant differential expression between blood samples of patients with chronic obstructive pulmonary disease and normal people for the first time, and the detection of whether NOSIP, AGMAT and/or LINC01215 have differential expression in blood of a subject can be used as a method for early diagnosis of chronic obstructive pulmonary disease, thereby developing tools and products for early diagnosis of chronic obstructive pulmonary disease, and having important significance for guiding prevention and screening of high risk groups of chronic obstructive pulmonary disease.

Description

Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease
Technical Field
The invention relates to the technical field of biological medicines, in particular to application of a reagent for detecting a marker in preparation of a product for diagnosing and/or predicting chronic obstructive pulmonary disease.
Background
Chronic obstructive pulmonary disease (Chronic obstructive pulmonary disease, COPD), abbreviated as chronic obstructive pulmonary disease, is a common preventable and treatable condition characterized by sustained airflow limitation, a progressive progression associated with an enhanced chronic inflammatory response of the airways and lungs to toxic particles or gases. Chronic obstructive pulmonary disease is one of the most common diseases in respiratory medicine, the airways of patients have persistent chronic inflammation, and the inflammation is not limited to the lungs, most patients show systemic inflammatory response, namely extrapulmonary effects, and the most common systemic clinical manifestations caused by the chronic inflammatory response are weight loss, skeletal muscle dysfunction, malnutrition and the like, and mental depression, anxiety, anorexia and the like. Chronic obstructive pulmonary disease is characterized by a sustained, incompletely reversible respiratory airflow limitation. Currently, the diagnostic gold standard for slow pulmonary resistance is lung function examination following bronchodilator inhalation, FEV1/pre <80% and FEV1/FVC <70%. The slow-blocking lung can be divided into two stages of a stable stage and an acute exacerbation stage according to the disease progress. Along with the aging of the global population and the increasingly serious global environment problem, the prevalence rate and the death rate of slow pulmonary resistance are gradually increased, so that the global public health is greatly threatened, the labor capacity and the life quality of patients are seriously affected, and the medical economic burden of individuals and families is increased. According to the world health organization, 6 hundred million people worldwide have slow lung resistance, and about 270 ten thousand people die each year. Slow lung obstruction has become the fourth leading cause of death worldwide, next to cerebrovascular disease, heart disease and acute lung infection. Currently, high morbidity and mortality in chronic obstructive pulmonary disease has attracted global attention.
COPD diagnosis relies on medical history, symptoms, signs, imaging, lung function examination, and the like. The patient had mainly the following medical history: (1) history of long-term massive smoking; (2) a history of long-term harmful substances or harmful gases exposure; (3) familial COPD; (4) a history of recurrent respiratory tract infections and acute exacerbations. Major clinical symptoms: (1) chronic cough, with early morning heavy, night cough is not obvious; (2) most of the phlegm is expectorated, and the phlegm is purulent phlegm when the phlegm is combined with infection; (3) dyspnea is a hallmark symptom of COPD and is also a major cause of anxiety in patients; (4) chest distress and asthma symptoms can exist, but no specificity exists; (5) can be accompanied by extrapulmonary effects. As the disease progresses, there are mainly the following signs: (1) a barrel chest; (2) low breath sounds; (3) the percussion is overdriven. X-ray chest radiography: the early stage can not have obvious change, and with the development of diseases, the chest film can show lung field transmittance increase, diaphragmatic low and flat, chest anterior and posterior diameter increase and other lung over-inflation manifestations; pulmonary vessels are stump-like and lung blebs are sometimes seen. Lung function examination: pulmonary function examination was performed after bronchodilator inhalation, with FEV1/pre <80% and FEV1/FVC <70% being diagnostic. GOLD (Global Initiative forChronic Obstructive Lung Disease) and the "diagnosis and treatment guide for chronic obstructive pulmonary disease" in China all use FEV1/FVC <70% as the diagnosis standard of COPD, and with the wide propaganda of this diagnosis mode, it is accepted by more and more domestic and foreign respiratory doctors and lung function examination technicians in recent years. However, there is growing evidence that a diagnosis of COPD with FEV1/FVC <70% may lead to a large number of clinical misdiagnoses, which is currently being challenged by unprecedented challenges. Therefore, developing a method for accurately diagnosing COPD early is one of the problems to be solved in the art.
Disclosure of Invention
In order to solve the technical problems, the invention provides application of a reagent for detecting a marker in preparing a product for diagnosing and/or predicting chronic obstructive pulmonary disease, and the technical scheme of the invention is realized as follows:
in one aspect, the use of an agent for detecting a marker of the invention, any one or more of NOSIP, AGMAT, LINC01215, in the manufacture of a product for diagnosing and/or prognosticating chronic obstructive pulmonary disease.
As a preferred embodiment, the reagent comprises a reagent for detecting the expression level of one or more of NOSIP, AGMAT, LINC01215 in a sample using protein immunization techniques, dye techniques, nucleic acid sequencing techniques, nucleic acid hybridization techniques, digital imaging techniques, chromatographic techniques, mass spectrometry techniques.
As a preferred embodiment, the reagent for detecting the expression level of one or more of NOSIP, AGMAT, LINC01215 in a sample using protein immunization techniques comprises an antibody; the antibodies are labeled antibodies specific for one or more epitopes in NOSIP, AGMAT, LINC01215;
the reagent for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample using a dye technique comprises a dye; the dye is a dye with specificity to one or more of NOSIP, AGMAT, LINC and 01215;
the reagent for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample by using a nucleic acid sequencing technology comprises a primer; the primer is a primer which specifically binds to one or more sequences in NOSIP, AGMAT, LINC01215;
the reagent for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample by using a nucleic acid hybridization technique comprises a probe; the probes are labeled probes that are specifically complementary to one or more of the sequences in NOSIP, AGMAT, LINC 01215.
In another aspect, the invention provides a product for diagnosing and/or prognosticating chronic obstructive pulmonary disease, the product comprising a detection kit comprising reagents for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample; the detection kit also comprises a reagent for detecting the reference gene, wherein the reagent for detecting the reference gene comprises a primer and/or a probe aiming at the reference gene.
As a preferred embodiment, the detection kit further comprises dNTPs, mg 2+ Ions, DNA polymerase or DNA comprising dNTPs, mg 2+ A PCR system for ionic, DNA polymerase; the detection kit further comprises bisulphite or hydrazine salt.
As a preferred embodiment, the product further comprises a chip and a test strip comprising a test strip carrier and an oligonucleotide immobilized on the test strip carrier, said oligonucleotide being capable of detecting the expression level of one or more of NOSIP, AGMAT, LINC01215 or a functional fragment thereof.
In a further aspect, the use of a marker of the invention, any one or more of NOSIP, AGMAT, LINC01215, in the construction of a diagnostic and/or prognostic system for chronic obstructive pulmonary disease; the system comprises a detection module and an evaluation module; the detection module is used for detecting the expression level of one or more of NOSIP, AGMAT, LINC01215 in a subject sample; the evaluation module is used for comparing the detected value of the subject obtained by the detection module with a normal sample detection value or a normal reference value, and judging that the subject is a chronic obstructive pulmonary disease patient or the risk of the subject suffering from the chronic obstructive pulmonary disease is high when the expression level of one or more of NOSIP, AGMAT, LINC and 01215 is obviously lower than the normal sample detection value or the normal reference value.
In a further aspect, the invention provides the use of a marker of any one or more of NOSIP, AGMAT, LINC01215 in the screening of a medicament for the diagnosis and/or prognosis of chronic obstructive pulmonary disease.
As a preferred embodiment, the method of screening for a drug for diagnosing and/or predicting chronic obstructive pulmonary disease comprises the steps of: (1) Adding a drug to be tested to a system expressing or containing one or more of NOSIP, AGMAT, LINC01215; (2) Detecting the expression level of one or more of NOSIP, AGMAT, LINC01215 in the system; (3) Drugs that significantly increase the expression level of one or more of NOSIP, AGMAT, LINC01215 are selected as candidate drugs.
As a preferred embodiment, the test agents include, but are not limited to: agents, binding molecules, small molecule compounds designed for one or more genes in NOSIP, AGMAT, LINC01215 or upstream or downstream genes thereof that promote expression of one or more of NOSIP, AGMAT, LINC01215; the system is selected from: a cellular system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.
Compared with the prior art, the invention has the beneficial effects that: the invention discovers that NOSIP, AGMAT and/or LINC01215 have significant differential expression between blood samples of patients with chronic obstructive pulmonary disease and normal people for the first time, and the detection of whether the differential expression exists in the blood of a subject NOSIP, AGMAT and/or LINC01215 can be used as a method for diagnosing the chronic obstructive pulmonary disease in an early stage, so that tools and products for diagnosing the chronic obstructive pulmonary disease in an early stage can be developed, and the method has important significance for guiding the prevention and screening of high risk groups with the chronic obstructive pulmonary disease.
Drawings
FIG. 1 shows a graph of the results of differential expression of NOSIP between Chronic Obstructive Pulmonary Disease (COPD) and healthy controls (normal);
FIG. 2 shows a graph of the results of differential expression of AGMAT between Chronic Obstructive Pulmonary Disease (COPD) and healthy controls (normal);
FIG. 3 shows a graph of the results of differential expression of LINC01215 between Chronic Obstructive Pulmonary Disease (COPD) and healthy controls (normal);
FIG. 4 shows a graph of diagnostic efficacy results of NOSIP as a diagnostic marker for chronic obstructive pulmonary disease;
FIG. 5 shows a graph of diagnostic efficacy results of AGMAT as a diagnostic marker for chronic obstructive pulmonary disease;
FIG. 6 shows a graph of the diagnostic efficacy results of LINC01215 as a diagnostic marker for chronic obstructive pulmonary disease;
fig. 7 shows a graph of the results of differential expression of NOSIP, AGMAT, LINC01215 between chronic obstructive pulmonary disease patients and healthy controls, wherein, panel a: NOSIP, B diagram: AGMAT, C panel: LINC01215;
fig. 8 shows a volcanic and thermal map of differentially expressed mRNA in chronic obstructive pulmonary disease, wherein a is: volcanic plot, B plot: a heat map;
fig. 9 shows volcanic and manhattan plots of differential methylation sites in chronic obstructive pulmonary disease, wherein a plot a: volcanic plot, B plot: manhattan diagram;
FIG. 10 shows a statistical plot of the results of hypermethylation of low expressed genes in chronic obstructive pulmonary disease;
FIG. 11 shows graphs of GO enrichment analysis results of hypermethylated low-expression genes in chronic obstructive pulmonary disease;
FIG. 12 shows a KEGG enrichment analysis result graph of hypermethylated low expression genes in chronic obstructive pulmonary disease;
FIG. 13 shows a graph of the protein interaction network of hypermethylated low-expression genes in chronic obstructive pulmonary disease.
Detailed Description
The invention is further illustrated below in conjunction with specific examples, which are intended to illustrate the invention and are not to be construed as limiting the invention. One of ordinary skill in the art can appreciate that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents. The experimental procedure, in which no specific conditions are noted in the examples below, is generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer.
Unless defined otherwise, all technical and scientific terms used in the context of this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition, some terms are explained as follows.
The term "primer" as used herein refers to 7-50 nucleic acid sequences that are capable of forming base pairs (basepair) complementary to a template strand and serve as starting points for replication of the template strand. Primers are usually synthesized, but naturally occurring nucleic acids may also be used. The sequence of the primer need not be exactly the same as the sequence of the template, but may be sufficiently complementary to hybridize with the template. Additional features may be incorporated that do not alter the basic properties of the primer. Examples of additional features that can be incorporated include methylation, capping, substitution of one or more nucleic acids with homologs, and modification between nucleic acids, but are not limited thereto.
The term "probe" as used herein refers to nucleic acid fragments, such as RNA or DNA, as short as a few to as long as hundreds of bases, which can establish specific binding with mRNA and can determine the presence of a particular mRNA by virtue of a Labeling effect. Probes can be prepared in the form of oligonucleotide probes, single-stranded DNA probes, double-stranded DNA probes, RNA probes, and the like. In the present invention, cervical cancer can be predicted by hybridization using the labeled polynucleotide of the present invention and a complementary probe, and by whether hybridization is performed. Appropriate selection of probes and hybridization conditions can be modified based on what is known in the art.
The term "antibody" as used herein refers to a substance that specifically binds to an antigen to elicit an antigen-antibody reaction. For the purposes of the present invention, an antibody refers to an antibody that specifically binds to the marker (NOSIP, AGMAT, LINC 01215) of the present invention for early diagnosis of chronic obstructive pulmonary disease. Antibodies of the invention include polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. The antibodies described above can be readily prepared using techniques well known in the art. For example, polyclonal antibodies can be produced according to methods known in the art by a process that includes injecting an animal with a marker protein antigen as described above and collecting blood from the animal to obtain serum containing the antibodies. Such polyclonal antibodies may be prepared by any animal such as goats, rabbits, sheep, monkeys, horses, pigs, cows, dogs, etc. Also, monoclonal antibodies can be prepared using hybridoma methods or phage antibody library techniques well known in the art. The antibody prepared by the above method can be separated and purified by gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography, etc. Furthermore, the antibodies of the invention include not only intact forms having 2 full length light chains and 2 full length heavy chains, but also functional fragments of the antibody molecules. Functional fragments of antibody molecules refer to fragments having at least antigen binding function, including Fab, F (ab') 2 Fv and the like. Furthermore, the antibodies of the invention are commercially available.
The terms "comprising," "including," "having," "containing," or "involving," as used herein, refer to an Inclusive or open-ended process and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If a group is defined herein to include at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only those embodiments.
The term "sample" as used herein refers to a composition obtained or derived from a subject (e.g., an individual of interest) that comprises cells and/or other molecular entities to be characterized and/or identified according to, for example, physical, biochemical, chemical, and/or physiological characteristics. For example, a sample refers to any sample derived from a subject of interest that is expected or known to contain the cell and/or molecular entity to be characterized. Samples include, but are not limited to, tissue samples (e.g., tumor tissue samples), primary or cultured cells or cell lines, cell supernatants, cell lysates, platelets, serum, plasma, vitreous humor, lymph, synovial fluid, follicular fluid, semen, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebral spinal fluid, saliva, sputum, tears, sweat, mucus, tumor lysates, tissue culture fluid, tissue extracts, homogenized tissue, tumor tissue, cell extracts, and combinations thereof. As a preferred embodiment, the sample is selected from a blood sample of a subject.
The term "expression level" or "expression amount" as used herein refers to the level or amount of a polynucleotide or amino acid product or protein in a biological sample. "expression" generally refers to the process by which information encoded by a gene is converted into a structure that is present and operational in a cell. Thus, as used herein, "expression" of a marker refers to transcription into a polynucleotide, translation into a protein, or even post-translational modification of a protein. Transcribed polynucleotides, translated proteins, or fragments of post-translationally modified proteins are also considered expressed, whether they originate from transcripts produced by alternative splicing or degraded transcripts, or from post-translational processing of proteins (e.g., by proteolysis). "expressed genes" include those transcribed into polynucleotides (e.g., mRNA) and then translated into proteins, as well as those transcribed into RNA but not translated into proteins (e.g., transfer RNA and ribosomal RNA).
The term "AUC" or "AUC value" as used herein refers to the area under a subject's operating characteristic curve, and refers to a graphical curve that shows the change in performance of a binary classifier system with its discrimination threshold. The curve is created by plotting true positive rate versus false positive rate at various threshold settings. True positive rate is also known as sensitivity. The false positive rate was calculated to be 1-specific. Thus, the ROC curve is a graphical display of true positive versus false positive (sensitivity vs (1-specificity)) over a range of cut-offs and a way to select the best cut-off for clinical use. Accuracy is expressed as area under ROC curve (AUC), providing a useful parameter for comparing test performance. An AUC close to 1 indicates that the test is highly sensitive and highly specific, whereas an AUC close to 0.5 indicates that the test is neither sensitive nor specific.
In the specific embodiment of the invention, all experiments are completed according to at least 3 times, the result data are expressed in a mean value plus or minus standard deviation mode, SPSS statistical software is adopted for statistical analysis, paired T test is adopted for comparison between two groups, single factor analysis of variance is adopted for three groups and more, and LSD-T test is adopted for multiple comparison. The difference of P <0.05 is statistically significant.
In order to overcome the technical problem in the art that FEV1/FVC <70% is taken as a COPD diagnosis standard to cause a large number of clinical misdiagnosis, the inventor of the present invention firstly identified a marker which can be used as a marker for accurately diagnosing chronic obstructive pulmonary disease in early stage, wherein the marker comprises NOSIP, AGMAT, LINC01215 and can distinguish and judge chronic obstructive pulmonary disease patients and healthy persons with high diagnosis capability.
Thus, in a first aspect the invention provides the use of an agent that detects the level of expression of one or more of NOSIP, AGMAT, LINC01215 in the manufacture of a product for early diagnosis and/or prognosis of chronic obstructive pulmonary disease.
Wherein the markers NOSIP (Nitric oxide synthase interacting protein, gene ID: 51070), AGMAT (Agmatinase, gene ID: 79814), LINC01215 (Long intergenic non-protein coding RNA1215, ensembl: ENSG 00000271856) include genes and encoded proteins and homologs, mutations, and isoforms thereof. The term encompasses full length, unprocessed biomarkers, as well as any form of biomarker derived from processing in a cell. The term encompasses naturally occurring variants (e.g., splice variants or allelic variants) of the biomarker. The gene ID is available at https:// www.ncbi.nlm.nih.gov/gene.
In one embodiment, at least one gene in said NOSIP, AGMAT, LINC01215 is compared to a reference level of the corresponding gene. The comparison enables a determination of whether the individual has chronic obstructive pulmonary disease or has a high or low risk of chronic obstructive pulmonary disease.
In a preferred embodiment, the reference level is determined by measuring at least one reference biological sample (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1000 healthy subjects not suffering from chronic obstructive pulmonary disease) isolated from the subject (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50, 100, 150, 200, 300, 400, 500, or 1000) of the subject (e.g., healthy subject) isolated from the chronic obstructive pulmonary disease. The at least one subject not suffering from chronic obstructive pulmonary disease may be considered a healthy subject relative to a chronic obstructive pulmonary disease patient.
In a preferred embodiment, the expression level of NOSIP, AGMAT, LINC01215 is significantly down-regulated in patients with chronic obstructive pulmonary disease compared to a normal control (reference level).
In a preferred embodiment, the level of expression of NOSIP, AGMAT, LINC01215 is measured to determine whether the subject has chronic obstructive pulmonary disease or is at risk of having chronic obstructive pulmonary disease.
In the present invention, the sample includes, but is not limited to, a tissue sample, a blood (e.g., whole blood or blood components, such as blood cells/cell components, serum or plasma) sample, a urine sample, aqueous humor, or a sample from other peripheral sources.
In a specific embodiment of the invention, the sample is selected from blood from a subject.
The test kit for early diagnosis or prognosis of chronic obstructive pulmonary disease provided in the second aspect of the present invention may also contain materials as desired from a commercial and user standpoint, including buffers, reagents and/or diluents for determining the levels described above, and the like.
The invention will now be described in further detail with reference to the drawings and examples. The following examples are only illustrative of the present invention and are not intended to limit the scope of the invention. The experimental methods for which specific conditions are not specified in the examples are generally conducted under conventional conditions or under conditions recommended by the manufacturer.
Example 1
Real Time PCR detection of Gene expression in COPD samples
1. Source of research crowd
The invention retrospectively collects the blood samples of 14 chronic obstructive pulmonary disease patients treated by the Qingdao external cardiovascular disease hospital as an experimental group, wherein the information sources of the samples of the experimental group are shown in Table 1, and the sample serial numbers are 17-30 respectively. Blood samples of 16 healthy physical examination volunteers in the same period are collected as a control group, and the sample serial numbers are respectively 1-16. All described the experimental conditions with subjects and subject families and signed informed consent with them, and passed the consent of the tissue ethics committee.
Inclusion and exclusion criteria for chronic obstructive pulmonary disease were as follows:
inclusion criteria: (1) clinically, the patients in the study group are diagnosed with chronic obstructive pulmonary disease, the recent clinical symptoms are continuously aggravated and worsened, the acute phase time is less than 7 days, and the medical record is complete; (2) patients signed informed consent for the study.
Exclusion criteria: (1) patients with tumor diseases such as lung cancer, liver cancer, colorectal cancer, etc.; (2) patients who used antibiotics during the current month of blood collection; (3) patients with severe mental disorder diseases such as schizophrenia; (4) patients with other respiratory diseases such as bronchial asthma and pulmonary tuberculosis; (5) patients who have severe dyspnea symptoms that require mechanical ventilation therapy are combined.
Table 1 experimental group blood sample information sources for chronic obstructive pulmonary disease
Sample name Sample number Sample source
1 17 Grandchild x
2 18 King ×
3 19 Conception and conception of
4 20 Chu x
5 21 Week ×
6 22 King ×
7 23 Poplar x
8 24 Solution ×
9 25 Quotient of
10 26 Tension ×
11 27 Cow
12 28 Zhang (PZQ DXW)
13 29 Chen x
14 30 Liu x
2. Experimental main reagent
The main experimental reagents used in this example are shown in Table 2.
TABLE 2 Main Experimental reagents in this example
Figure BDA0004083544870000111
3. Main experimental instrument
The main experimental instruments used in this example are shown in table 3.
TABLE 3 Main laboratory instruments in this example
Instrument name Instrument model Manufacturer' s
Centrifugal machine Centrifuge 5424R Eppendorf
NanoVue Plus 28956057 BIOCHROM LTD
Fluorescent quantitative PCR instrument ABI7300 Applied Biosystems
4. Experimental method
(1) Primer design
Real Time PCR detection gene primer. The primers shown in Table 4 below were synthesized by Bomadder.
TABLE 4Real Time PCR detection Gene primer sequence information
Primer name Primer sequence (5 'to 3')
GAPDH-F (internal reference) GGAGCGAGATCCCTCCAAAAT(SEQ ID NO:1)
GAPDH-R (internal reference) GGCTGTTGTCATACTTCTCATGG(SEQ ID NO:2)
ACTB-F (internal reference) CATGTACGTTGCTATCCAGGC(SEQ ID NO:3)
ACTB-R (internal reference) CTCCTTAATGTCACGCACGAT(SEQ ID NO:4)
NOSIP-F GGGTCCTCCAAGTAAGGACAAG(SEQ ID NO:5)
NOSIP-R GAGCTGTCTAGCGGTGTGAAGT(SEQ ID NO:6)
AGMAT-F ACGACCTTGGATCCCTACAGA(SEQ ID NO:7)
AGMAT-R AGCAATTTCAGGTGTCCCTGT(SEQ ID NO:8)
LINC01215-F GGTTGTGAGAGGGGACCAAT(SEQ ID NO:9)
LINC01215-R GGCAGGAGAATAGGGTCTGG(SEQ ID NO:10)
(2) Extraction of sample Total RNA
(1) 0.75mL of lysis solution RLS was added to each 0.25mL of blood sample, and the liquid sample was blown several times with a sample gun to help lyse the cells in the sample. Every 5-10×10 6 At least 0.75mL of lysate RLS was added to each cell. The final volume ratio of lysate RLS to liquid sample was always 3:1.
(2) 0.75mL of lysate RLS and 0.25mL of blood sample were added to the EP tube, followed by shaking continuously for 30s with force, mixing, and incubating at 15-30deg.C for 10min to completely decompose nucleoprotein.
(3) 0.2mL chloroform was added to each 0.75mL lysate RLS, vigorously shaken for 15s, and left at room temperature for 5min.
(4) Centrifugation was carried out at 12000rpm at 4℃for 10min, and the sample was divided into three layers: the lower organic phase, the middle and upper colorless aqueous phases, and RNA present in the upper aqueous phase. The volume of the aqueous phase layer was about 70% of the volume of RLS added, and the aqueous phase was transferred to a fresh tube for the next operation.
(5) 1 volume of 70% ethanol was added (first checking if absolute ethanol had been added) and mixed upside down (precipitation may occur at this time). The resulting solution is transferred to an adsorption column RA (the column is nested in a collection tube) together with the possible precipitation.
(6) Centrifuging at 12000rpm for 45s, discarding the waste liquid, and re-sleeving the adsorption column into the collection tube.
(7) 0.5mL deproteinized solution RE was added, centrifuged at 12000rpm for 45s, and the waste solution was discarded.
(8) 0.5mL of rinse solution RW (checked first whether absolute ethanol has been added) was added, centrifuged at 12000rpm for 45s, and the waste solution was discarded.
(9) 0.5mL of rinse RW was added, centrifuged at 12000rpm for 45s, and the waste liquid was discarded.
The adsorption column RA is put back into a hole collecting pipe, and is centrifuged at 13000rpm for 2min, so that the rinsing liquid is removed as much as possible, and the residual ethanol in the rinsing liquid is prevented from inhibiting downstream reaction.
Figure BDA0004083544870000131
Taking out the adsorption column RA, placing into an RNase free centrifuge tube, adding 30-50 mu L RNase free water (with better heating effect in water bath at 65-70deg.C) at the middle part of the adsorption membrane according to the expected RNA yield, standing at room temperature for 2min, and centrifuging at 12000rpm for 1min. If more RNA is needed, the obtained solution can be added into a centrifugal adsorption column again for centrifugation for 1min, or added with 30 mu L RNase free water for 1min, and the two eluents are combined.
(3) Reverse transcription synthesis of mRNA cDNA
mRNA reverse transcription was performed using FastKing cDNA first Strand Synthesis kit (cat# KR 116), genomic DNA reaction was first removed, 5 XgDNA Buffer 2.0. Mu.L, total RNA 1. Mu.g, and RNase Free ddH were added to the tube 2 O was added to a total volume of 10. Mu.L, heated in a water bath at 42℃for 3min, and then 10 XKing RT Buffer 2.0. Mu.L, fastKing RT Enzyme Mix 1.0.0. Mu.L, FQ-RT Primer mix 2.0. Mu.L, RNase Free ddH was added 2 O5.0 mu L, adding into the test tube, mixing together to obtain 20 mu L, heating at 42deg.C for 15min and 95 deg.C for 3min in a water bath, and storing at-20deg.C or lower when the synthesized cDNA is required to be stored for a long period of time.
(4) RealTimePCR detection
(1) Instrument and analysis method
Using ABI 7300 type fluorescent quantitative PCR instrument (2) -△△CT The method performs a relative quantitative analysis of the data.
(2) Operation procedure
The reaction system: amplification was performed using SuperRealPreMix Plus (SYBR Green) (cat# FP 205) and the experimental procedure was followed according to the product instructions. The realtem reaction system is shown in table 5.
TABLE 5 reaction system
Reagent(s) Usage amount
2×SuperReal PreMix Plus 10μL
Upstream primer (10. Mu.M) 0.6μL
Downstream primer (10. Mu.M) 0.6μL
50×ROX Reference Dye △ 2μL
DNA template 2μL
Sterilized distilled water 4.8μL
Amplification procedure: 95℃for 15min, (95℃for 10sec,55℃for 30sec,72℃for 32 sec). Times.40 cycles, 95℃for 15sec,60℃for 60sec,95℃for 15 sec).
Primer screening: mixing cDNA of each sample, carrying out 10-time gradient dilution by taking the cDNA as a template, taking 2 mu L of each diluted sample as the template, respectively amplifying the template by using a target gene primer and an internal reference gene primer, simultaneously carrying out dissolution curve analysis at 60-95 ℃, and carrying out primer screening according to the principles of high amplification efficiency and single peak of the dissolution curve.
Sample realtem PCR detection: after 3-10-fold dilution of each sample cDNA, 2. Mu.L was used as a template, and amplified with the objective gene primer and the internal reference gene primer, respectively (see Table 6). And simultaneously carrying out dissolution curve analysis at 60-95 ℃.
TABLE 6 sample RealTime PCR detection design
Template Sample cDNA Sample cDNA
Repeatedly detecting the number of pore channels 3 3
Primer(s) Gene primer of interest Internal reference gene primer
Relative quantitative analysis of each sample: according to the RealTimePCR original detection result, according to 2 -△△ct The relative quantitative calculation formula is:
Figure BDA0004083544870000141
the relative quantitative result of the target gene of each sample, namely the difference of mRNA transcription level of the target gene of each other sample relative to the control sample, is calculated.
5. Experimental results
The results showed that NOSIP, AGMAT, LINC01215 was significantly differentially expressed in the blood of chronic obstructive pulmonary disease patients compared to healthy controls and the differences were statistically significant (P < 0.05), wherein the expression of NOSIP in the blood of chronic obstructive pulmonary disease patients was significantly down-regulated (see fig. 1), the expression of AGMAT in the blood of chronic obstructive pulmonary disease patients was significantly down-regulated (see fig. 2), and the expression of LINC01215 in the blood of chronic obstructive pulmonary disease patients was significantly down-regulated (see fig. 3) compared to healthy controls.
Example 2
Analysis and validation of diagnostic efficacy
1. Experimental method
The ROC curve was plotted using pROC (version 1.15.0) in R-pack, the diagnostic efficacy (sensitivity, specificity, AUC value) of each gene (NOSIP, AGMAT, LINC 01215) in the chronic obstructive pulmonary disease dataset (GSE 94916, control: copd=6:6, sample type is peripheral blood sample) was analyzed, and when gene NOSIP, AGMAT, LINC01215 was analyzed as the diagnostic efficacy of chronic obstructive pulmonary disease as a biomarker, the expression level (expression level) of gene NOSIP, AGMAT, LINC01215 was directly used for analysis, and the level corresponding to the point with the greatest Youden index was selected as the cutoff value for diagnosing chronic obstructive pulmonary disease using the biomarker. Carrying out logistic regression on the expression quantity of each gene, calculating the probability of each individual disease through a fitted regression curve, determining different probability division thresholds, and calculating corresponding diagnosis effectiveness results (sensitivity, specificity, accuracy and the like) according to the determined probability division thresholds
2. Experimental results
The analysis and verification results of the diagnosis efficacy show that NOSIP, AGMAT, LINC01215 has higher accuracy, higher sensitivity and specificity when applied to early diagnosis of chronic obstructive pulmonary disease (see fig. 4-6), and NOSIP, AGMAT, LINC01215 is significantly down-regulated in chronic obstructive pulmonary disease (see fig. 7), which indicates that NOSIP, AGMAT, LINC01215 can be applied to auxiliary diagnosis of early chronic obstructive pulmonary disease clinically.
Example 3
Integrated analysis based on high throughput transcriptome data and methylation data
Differential analysis of mRNA: GSE42057 data set is downloaded from GEO database, probes are corresponding to genes, average value of a plurality of probes corresponding to one gene is taken as the expression quantity of the gene, and mRNA data set is subjected to differential analysis through limma package of analysis software R-4.0.5. The set screening criteria were p.value <0.05. Analysis gave 1592 differentially expressed genes, including 479 up-regulated, 1113 down-regulated, as shown in FIG. 8A for the mRNA volcanic pattern, and FIG. 8B for the corresponding heat pattern.
Differential methylation analysis: differential methylation analysis was performed on methylation data (GSE 118468) using the CHAMP package. The set screening criteria were p.value <0.05&|deltabeta| >0.1, resulting in 5840 differential methylation sites, 2634 total differential methylation genes, including 607 hypermethylation genes, 2027 hypomethylation genes. The volcanic pattern of the differential methylation sites is shown in FIG. 9A, and the corresponding Manhattan pattern is shown in FIG. 9B.
Hypermethylation low expression genes: intersection of the differentially expressed downregulated gene and the hypermethylated gene was taken to obtain a differentially expressed gene with aberrant methylation regulation, resulting in 81 hypermethylation modified expression downregulated genes. The statistical results of the hypermethylated low-expression genes are shown in FIG. 10.
GO and KEGG enrichment analysis of hypermethylated low-expression genes: GO functional enrichment and KEGG functional enrichment analysis was performed on hypermethylated hypoexpressed genes using the David database (https:// David. Ncifcrf. Gov/tools. Jsp). The screening criteria were: PValue <0.05, go enrichment analysis results are shown in fig. 11, KEGG enrichment analysis results are shown in fig. 12.
Protein interaction network diagram of hypermethylation low expression genes: in order to investigate the protein interaction relationship between the screened aberrant methylation modified differentially expressed genes, the present example constructed PPI networks of the 81 selected hypermethylated low expressed genes using the online database sting. FIG. 13 shows PPI networks of 81 hypermethylated low-expression genes constructed using STRING database. The PPI network includes 373 interactive gene pairs. The present invention then imports the results obtained in the STRING database into the Cytoscape software (http:// www.cytoscape.org /), and screens the core gene (HUB gene) using the CytoHubba plug-in. The core genes obtained by screening comprise NOSIP. This result again demonstrates its effectiveness in early diagnosis of chronic obstructive pulmonary disease.
The above description of the embodiments is only for the understanding of the method of the present invention and its core ideas. It should be noted that it will be apparent to those skilled in the art that several improvements and modifications can be made to the present invention without departing from the principle of the invention, and these improvements and modifications will fall within the scope of the claims of the invention.

Claims (10)

1. Use of an agent for detecting a marker for the preparation of a product for diagnosing and/or prognosticating chronic obstructive pulmonary disease, characterized in that:
the marker is any one or more of NOSIP, AGMAT, LINC and 01215.
2. Use of a reagent for detecting a marker according to claim 1 for the preparation of a product for diagnosing and/or prognosticating chronic obstructive pulmonary disease, characterized in that:
the reagent comprises a reagent for detecting one or more expression levels in a sample NOSIP, AGMAT, LINC01215 by adopting a protein immune technology, a dye technology, a nucleic acid sequencing technology, a nucleic acid hybridization technology, a digital imaging technology, a chromatographic technology and a mass spectrometry technology.
3. Use of a reagent for detecting a marker according to claim 1 for the preparation of a product for diagnosing and/or prognosticating chronic obstructive pulmonary disease, characterized in that:
the reagent for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample by adopting protein immune technology comprises an antibody; the antibodies are labeled antibodies specific for one or more epitopes in NOSIP, AGMAT, LINC01215;
the reagent for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample using a dye technique comprises a dye; the dye is a dye with specificity to one or more of NOSIP, AGMAT, LINC and 01215;
the reagent for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample by using a nucleic acid sequencing technology comprises a primer; the primer is a primer which specifically binds to one or more sequences in NOSIP, AGMAT, LINC01215;
the reagent for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample by using a nucleic acid hybridization technique comprises a probe; the probes are labeled probes that are specifically complementary to one or more of the sequences in NOSIP, AGMAT, LINC 01215.
4. A product for diagnosing and/or prognosing chronic obstructive pulmonary disease, characterized in that:
the product comprises a detection kit,
the detection kit comprises reagents for detecting one or more expression levels in NOSIP, AGMAT, LINC01215 in a sample;
the detection kit also comprises a reagent for detecting the reference gene, wherein the reagent for detecting the reference gene comprises a primer and/or a probe aiming at the reference gene.
5. A product for diagnosing and/or prognosing chronic obstructive pulmonary disease as claimed in claim 4, characterised in that:
the detection kit also comprises dNTPs and Mg 2+ Ions, DNA polymerase or DNA comprising dNTPs, mg 2+ A PCR system for ionic, DNA polymerase;
the detection kit further comprises bisulphite or hydrazine salt.
6. A product for diagnosing and/or prognosing chronic obstructive pulmonary disease as claimed in claim 4, characterised in that:
the product also comprises a chip and a test paper,
the test paper comprises a test paper carrier and an oligonucleotide fixed on the test paper carrier, wherein the oligonucleotide can detect the expression level of one or more of NOSIP, AGMAT, LINC01215 or a functional fragment thereof.
7. Use of a marker for constructing a diagnostic and/or prognostic system for chronic obstructive pulmonary disease, characterized in that:
the marker is any one or more of NOSIP, AGMAT, LINC and 01215;
the system comprises a detection module and an evaluation module;
the detection module is used for detecting the expression level of one or more of NOSIP, AGMAT, LINC01215 in a subject sample;
the evaluation module is used for comparing the detected value of the subject obtained by the detection module with a normal sample detection value or a normal reference value, and judging that the subject is a chronic obstructive pulmonary disease patient or the risk of the subject suffering from the chronic obstructive pulmonary disease is high when the expression level of one or more of NOSIP, AGMAT, LINC and 01215 is obviously lower than the normal sample detection value or the normal reference value.
8. Use of a marker for screening for a medicament for diagnosing and/or prognosticating chronic obstructive pulmonary disease, characterized by:
the marker is any one or more of NOSIP, AGMAT, LINC and 01215.
9. Use of a marker according to claim 8 for screening for a medicament for diagnosing and/or prognosticating chronic obstructive pulmonary disease, wherein the method for screening for a medicament for diagnosing and/or prognosticating chronic obstructive pulmonary disease comprises the steps of:
(1) Adding a drug to be tested to a system expressing or containing one or more of NOSIP, AGMAT, LINC01215;
(2) Detecting the expression level of one or more of NOSIP, AGMAT, LINC01215 in the system;
(3) Drugs that significantly increase the expression level of one or more of NOSIP, AGMAT, LINC01215 are selected as candidate drugs.
10. The use of a marker according to claim 9 for screening for a medicament for diagnosing and/or prognosticating chronic obstructive pulmonary disease,
the drugs to be tested include, but are not limited to: agents, binding molecules, small molecule compounds designed for one or more genes in NOSIP, AGMAT, LINC01215 or upstream or downstream genes thereof that promote expression of one or more of NOSIP, AGMAT, LINC01215;
the system is selected from: a cellular system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.
CN202310130290.0A 2023-02-17 2023-02-17 Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease Pending CN116298310A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310130290.0A CN116298310A (en) 2023-02-17 2023-02-17 Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310130290.0A CN116298310A (en) 2023-02-17 2023-02-17 Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease

Publications (1)

Publication Number Publication Date
CN116298310A true CN116298310A (en) 2023-06-23

Family

ID=86829776

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310130290.0A Pending CN116298310A (en) 2023-02-17 2023-02-17 Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease

Country Status (1)

Country Link
CN (1) CN116298310A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116656851A (en) * 2023-07-28 2023-08-29 广东省科学院生物与医学工程研究所 Biomarker and application thereof in diagnosis of chronic obstructive pulmonary disease

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116656851A (en) * 2023-07-28 2023-08-29 广东省科学院生物与医学工程研究所 Biomarker and application thereof in diagnosis of chronic obstructive pulmonary disease
CN116656851B (en) * 2023-07-28 2023-10-24 广东省科学院生物与医学工程研究所 Biomarker and application thereof in diagnosis of chronic obstructive pulmonary disease

Similar Documents

Publication Publication Date Title
CN105143467B (en) Method for predicting the risk of interstitial pneumonia
KR20160045547A (en) Composition for diagnosing pancreatic cancer and method for diagnosing pancreatic cancer using the same
JP2021043216A (en) Composition for diagnosis of diseases
WO2023143326A1 (en) Biomarker for predicting risk of pancreatic cancer, method, and diagnostic device
CN116298310A (en) Use of a reagent for detecting markers for the preparation of a product for the diagnosis and/or prognosis of chronic obstructive pulmonary disease
CN110229899B (en) Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer
US11371096B2 (en) Blood biomarkers for appendicitis and diagnostics methods using biomarkers
CN110331207A (en) Adenocarcinoma of lung biomarker and related application
US20150376723A1 (en) Prognostic biomarkers for influenza
CN115873936A (en) Biomarker CXCL8 and application thereof
Jeon et al. Transcriptomic profiles and their correlations in saliva and gingival tissue biopsy samples from periodontitis and healthy patients
US20230357856A1 (en) Methods and compositions for prognosing glioblastoma or breast cancer
JP2017510304A (en) Methods and kits for identifying precancerous colorectal polyps and colorectal cancer
CN114107489A (en) Marker for diagnosing glaucoma and application thereof
KR20220039065A (en) Novel biomarker for predicting drug-responsibility to colon cancer
KR102515934B1 (en) Use of CD20 as a biomarker for diagnosis of non-infectious pulmonary diseases
CN111440871A (en) Application of gene marker in lung cancer prognosis judgment
KR102259708B1 (en) Novel biomarker for predicting drug-responsibility to colon cancer
CN115011682B (en) Application of biomarker in preparation of diagnostic tool for allergic rhinitis-asthma syndrome
KR102618065B1 (en) Composition for Diagnosing Pancreatic Cancer and Method for Diagnosing Pancreatic Cancer Using the same
KR102259695B1 (en) Novel biomarker for predicting drug-responsibility to colon cancer
CN118326031B (en) System for identifying traditional Chinese medicine symptoms of rheumatoid arthritis through molecular markers
CN116068193B (en) Tuberculosis molecular marker combination and application thereof
KR102347899B1 (en) Urinary exosome-derived biomarkers for diagnosis or prognosis of BK virus-associated nephropathy in kidney allografts
KR102350228B1 (en) Urinary exosome-derived biomarkers for diagnosis or prognosis of T cell-mediated rejection in kidney allografts

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination