CN116287479A - Primer combination for detecting respiratory viruses and application thereof - Google Patents
Primer combination for detecting respiratory viruses and application thereof Download PDFInfo
- Publication number
- CN116287479A CN116287479A CN202310547537.9A CN202310547537A CN116287479A CN 116287479 A CN116287479 A CN 116287479A CN 202310547537 A CN202310547537 A CN 202310547537A CN 116287479 A CN116287479 A CN 116287479A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- kit
- virus
- upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000700605 Viruses Species 0.000 title claims abstract description 61
- 230000000241 respiratory effect Effects 0.000 title claims abstract description 35
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 34
- 241000713196 Influenza B virus Species 0.000 claims abstract description 11
- 241000701161 unidentified adenovirus Species 0.000 claims abstract description 11
- 241000712431 Influenza A virus Species 0.000 claims abstract description 10
- 241000725643 Respiratory syncytial virus Species 0.000 claims abstract description 10
- 241000711573 Coronaviridae Species 0.000 claims abstract description 9
- 241000709661 Enterovirus Species 0.000 claims abstract description 6
- 241000046923 Human bocavirus Species 0.000 claims abstract description 6
- 241000726041 Human respirovirus 1 Species 0.000 claims abstract description 6
- 241000712003 Human respirovirus 3 Species 0.000 claims abstract description 6
- 241001559187 Human rubulavirus 2 Species 0.000 claims abstract description 5
- 238000012408 PCR amplification Methods 0.000 claims description 25
- 239000002773 nucleotide Substances 0.000 claims description 12
- 125000003729 nucleotide group Chemical group 0.000 claims description 12
- 208000002606 Paramyxoviridae Infections Diseases 0.000 claims description 11
- 238000004925 denaturation Methods 0.000 claims description 8
- 230000036425 denaturation Effects 0.000 claims description 8
- 238000000137 annealing Methods 0.000 claims description 6
- 238000012257 pre-denaturation Methods 0.000 claims description 6
- 238000003752 polymerase chain reaction Methods 0.000 claims description 5
- 241000124740 Bocaparvovirus Species 0.000 claims description 3
- 230000001351 cycling effect Effects 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 2
- 238000001514 detection method Methods 0.000 abstract description 46
- 230000035945 sensitivity Effects 0.000 abstract description 10
- 244000005700 microbiome Species 0.000 abstract description 2
- 239000011324 bead Substances 0.000 description 28
- 239000000203 mixture Substances 0.000 description 25
- 238000012163 sequencing technique Methods 0.000 description 20
- 239000000047 product Substances 0.000 description 17
- 238000000034 method Methods 0.000 description 14
- 230000003321 amplification Effects 0.000 description 10
- 239000007788 liquid Substances 0.000 description 10
- 238000003199 nucleic acid amplification method Methods 0.000 description 10
- 239000000523 sample Substances 0.000 description 10
- 108090000623 proteins and genes Proteins 0.000 description 9
- 239000006228 supernatant Substances 0.000 description 9
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 8
- 230000000052 comparative effect Effects 0.000 description 8
- 238000000746 purification Methods 0.000 description 8
- 108020004414 DNA Proteins 0.000 description 7
- 238000006243 chemical reaction Methods 0.000 description 7
- 238000007403 mPCR Methods 0.000 description 7
- 239000013612 plasmid Substances 0.000 description 7
- 210000002345 respiratory system Anatomy 0.000 description 7
- 238000005516 engineering process Methods 0.000 description 5
- 238000002474 experimental method Methods 0.000 description 5
- 230000003612 virological effect Effects 0.000 description 5
- 241001493065 dsRNA viruses Species 0.000 description 4
- 238000012165 high-throughput sequencing Methods 0.000 description 4
- 238000002156 mixing Methods 0.000 description 4
- 108020004707 nucleic acids Proteins 0.000 description 4
- 102000039446 nucleic acids Human genes 0.000 description 4
- 150000007523 nucleic acids Chemical class 0.000 description 4
- 230000010355 oscillation Effects 0.000 description 4
- 238000003908 quality control method Methods 0.000 description 4
- 238000001179 sorption measurement Methods 0.000 description 4
- 206010057190 Respiratory tract infections Diseases 0.000 description 3
- 239000012295 chemical reaction liquid Substances 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 230000001900 immune effect Effects 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 230000009385 viral infection Effects 0.000 description 3
- -1 10 Xbuffer Substances 0.000 description 2
- 241000342334 Human metapneumovirus Species 0.000 description 2
- 241000711504 Paramyxoviridae Species 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 238000007605 air drying Methods 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000007405 data analysis Methods 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 244000052769 pathogen Species 0.000 description 2
- 239000008223 sterile water Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 108091093088 Amplicon Proteins 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 208000003322 Coinfection Diseases 0.000 description 1
- 208000035473 Communicable disease Diseases 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 101100165575 Danio rerio boka gene Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 241000233866 Fungi Species 0.000 description 1
- 241000711920 Human orthopneumovirus Species 0.000 description 1
- 241000430519 Human rhinovirus sp. Species 0.000 description 1
- 241000204031 Mycoplasma Species 0.000 description 1
- 241000712464 Orthomyxoviridae Species 0.000 description 1
- 241000701945 Parvoviridae Species 0.000 description 1
- 241000709664 Picornaviridae Species 0.000 description 1
- 208000036142 Viral infection Diseases 0.000 description 1
- 230000003044 adaptive effect Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 244000052616 bacterial pathogen Species 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 210000000234 capsid Anatomy 0.000 description 1
- 238000004590 computer program Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000006862 enzymatic digestion Effects 0.000 description 1
- 230000004907 flux Effects 0.000 description 1
- 238000004108 freeze drying Methods 0.000 description 1
- 108020004445 glyceraldehyde-3-phosphate dehydrogenase Proteins 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000028993 immune response Effects 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000000977 initiatory effect Effects 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 239000007791 liquid phase Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 241000264288 mixed libraries Species 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- XEBWQGVWTUSTLN-UHFFFAOYSA-M phenylmercury acetate Chemical compound CC(=O)O[Hg]C1=CC=CC=C1 XEBWQGVWTUSTLN-UHFFFAOYSA-M 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000035755 proliferation Effects 0.000 description 1
- 239000003223 protective agent Substances 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000004451 qualitative analysis Methods 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 239000012744 reinforcing agent Substances 0.000 description 1
- 208000020029 respiratory tract infectious disease Diseases 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 241000007181 unidentified human coronavirus Species 0.000 description 1
- 241000712461 unidentified influenza virus Species 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer combination for detecting respiratory viruses and application thereof, belonging to the technical field of microorganism detection. The primer combination comprises an upstream primer and a downstream primer of respiratory syncytial virus, an upstream primer and a downstream primer of rhinovirus, an upstream primer and a downstream primer of influenza B virus, an upstream primer and a downstream primer of influenza A virus, an upstream primer and a downstream primer of adenovirus, an upstream primer and a downstream primer of human bocavirus, an upstream primer and a downstream primer of human parainfluenza virus 1, an upstream primer and a downstream primer of human parainfluenza virus 2, an upstream primer and a downstream primer of human parainfluenza virus 3 and an upstream primer and a downstream primer of coronavirus. The kit containing the primer combination has high detection accuracy and sensitivity and lower detection cost, and plays an important role in detecting respiratory viruses.
Description
Technical Field
The invention belongs to the technical field of microorganism detection, and particularly relates to a primer combination for detecting respiratory viruses and application thereof.
Background
Respiratory tract infections are infectious diseases caused by pathogens such as bacteria, viruses, fungi, mycoplasma, and the like. The respiratory viruses have the characteristics of strong infectivity, quick transmission, high mixed infection rate and the like, and the respiratory viruses destroy the normal physiological operation of the host cells and finally lead the cells to death mainly by invading the host cells in the proliferation process. After viral infection, the host activates the immune response of the body to combat its infection and protect the body's health. The current detection method for respiratory viruses mainly comprises virus culture separation, immunological detection, molecular detection and the like. Virus culture isolation is a gold standard for laboratory detection, but is time-consuming and labor-consuming, and is difficult to apply to rapid diagnosis in early clinical stages. Although the immunological detection is popularized clinically, the specificity and the sensitivity of the immunological detection are limited to a certain extent, and misdiagnosis and other conditions are easy to occur in the clinical detection. At present, based on the continuous development of nucleic acid amplification technology, a kit for detecting respiratory viruses has been developed.
The invention discloses a six-respiratory-tract virus nucleic acid detection kit and a use method thereof, wherein the detection kit comprises six respiratory-tract virus reaction liquids, positive control liquid and negative control liquid, and the six respiratory-tract virus reaction liquids are freeze-dried powders pre-packaged into eight connecting tubes. The six respiratory tract virus reaction liquid A/B tubes contain a plurality of probes, primers, enzyme mixtures, reinforcing agents, freeze-drying protective agents, 10 Xbuffer, nucleotide mixtures and the like which are marked by different fluorescence, so that whether respiratory tract syncytial virus, respiratory tract adenovirus, human metapneumovirus, parainfluenza virus I, parainfluenza virus II and parainfluenza virus III exist can be detected in the same reaction system, and the accuracy of PCR detection is higher.
The invention discloses a kit for detecting respiratory viruses and application thereof in Chinese patent CN201510479372.1, wherein the kit provided by the invention comprises a primer pair group for detecting the respiratory viruses, and consists of 4 primer pairs, namely a respiratory syncytial virus primer pair, a rhinovirus primer pair, an adenovirus primer pair and a human metapneumovirus primer pair. The kit provided by the invention supports high flux, can rapidly and accurately detect common respiratory tract virus infection, and can obtain detection results of 4 virus indexes within 1 hour for clinic. The method is faster than the current commonly adopted real-time fluorescence quantitative PCR method, and has important significance for rapid auxiliary guiding of treatment and medication. However, the kit according to the present invention can detect only 4 viruses, and the detected respiratory viruses are less in variety.
Chinese patent CN202011348437.6 discloses a primer combination for simultaneously detecting 9 respiratory viruses, wherein the primer combination comprises detection primer pairs of influenza A virus, influenza B virus, H7 influenza virus, NL63 coronavirus, 229E coronavirus, parainfluenza virus type 2, boka virus, A respiratory syncytial virus, B respiratory syncytial virus and human internal reference GAPDH genes. The invention relies on the liquid phase chip technology, the manufactured detection kit can simultaneously carry out qualitative analysis on various respiratory viruses, and the detection sensitivity and specificity reach the PCR level; can rapidly and accurately judge the type of respiratory tract virus infection, and is beneficial to early etiology diagnosis of clinical respiratory tract infection.
However, the respiratory virus detection method based on targeted sequencing is simultaneously adaptive to the rapid sequencing technology, so that the detection result can be obtained rapidly, the detection accuracy and sensitivity are high, and the method can be applied to the detection of respiratory viruses.
Disclosure of Invention
Term interpretation and statement of the invention:
in the present invention, the term "respiratory syncytial virus (Respiratory syncytial virus) is a non-segmented, single-stranded negative-strand (-) RNA virus having an envelope, belonging to the Paramyxoviridae family.
In the present invention, the term "Rhinovirus", non-enveloped, spherical, of about 30nm diameter, belongs to the genus enterovirus in the family picornaviridae. The viral genome is a single positive strand RNA virus and the whole genome is 7.2-8.5kb in length.
In the present invention, the terms "influenza b virus (Influenza B virus)" and "influenza a virus (Influenza A virus)" belong to the enveloped single-stranded negative-strand (-) RNA viruses in the orthomyxoviridae family. The genomes of influenza A virus and influenza B virus contain 8 segments of RNA, and 11 proteins can be encoded.
In the present invention, the term "Adenovirus" (non-enveloped capsids), having a diameter of about 70-100nm, belongs to the genus Marsteviridae, the family Adenovirus. Adenovirus genome is a linear double-stranded DNA that is not segmented and is between 35-36kb in size.
In the present invention, the term "Human bocavirus" is non-enveloped, circular, and has a diameter of 21-22nm, belonging to the family parvoviridae, genus bocavirus, wherein the Human bocavirus genome is linear, and the size of the single negative strand DNA is about 5.5kb.
In the present invention, the term "human parainfluenza virus (Human parainfluenza virus)", enveloped, spherical, belongs to the genus respiratory virus of the family Paramyxoviridae, human parainfluenza virus is a single-stranded negative-strand RNA virus, and the viral genome is about 14.9-17.3kb in length.
In the present invention, the term "Coronavirus" is enveloped and spherical and has a diameter of about 120nm, belonging to the genus coronaviridae of the order coronaviridae. The genome of coronaviruses is linear, single-stranded, positive-stranded RNA, ranging in size from 27-32 kb.
The invention aims to provide a primer combination and a kit for simultaneously detecting 10 respiratory viruses, and the kit provided by the invention is used for combining a target amplicon sequencing technology with a multiple PCR technology and introducing a single-molecule recognition bar code sequence SMB aiming at clinical suspected respiratory infection samples, has high detection accuracy and simple detection method, and has an important effect on respiratory virus detection.
The technical scheme of the invention comprises the following steps:
in a first aspect, the invention provides a primer combination for detecting respiratory viruses, the primer combination comprising an upstream primer and a downstream primer of respiratory syncytial viruses shown as SEQ ID NO. 1 and SEQ ID NO. 2, an upstream primer and a downstream primer of rhinoviruses shown as SEQ ID NO. 3 and SEQ ID NO. 4, an upstream primer and a downstream primer of influenza B viruses shown as SEQ ID NO. 5 and SEQ ID NO. 6, an upstream primer and a downstream primer of influenza A viruses shown as SEQ ID NO. 7 and SEQ ID NO. 8, an upstream primer and a downstream primer of adenoviruses shown as SEQ ID NO. 9 and SEQ ID NO. 10, an upstream primer and a downstream primer of human bocavirus shown as SEQ ID NO. 11 and SEQ ID NO. 12, an upstream primer and a downstream primer of human parainfluenza virus type 1 shown as SEQ ID NO. 13 and SEQ ID NO. 14, an upstream primer and a downstream primer of human parainfluenza 2 shown as SEQ ID NO. 15 and SEQ ID NO. 16, respectively, and an upstream primer and a downstream primer of human parainfluenza virus type 17 shown as SEQ ID NO. 19 and SEQ ID NO. 20, respectively.
In yet another aspect, the invention provides the use of a primer combination as described above in the preparation of a kit for detecting respiratory viruses.
In yet another aspect, the invention provides a kit for detecting respiratory viruses, said kit comprising the primer combination described above.
Preferably, the kit can further comprise 2× Phanta Flash Master Mix, dNTPs and a buffer solution.
Further preferably, the primers in the kit are mixed in equal proportion, and the final concentration of the primer combination is 10 mu M.
Preferably, the kit further comprises a first round of PCR amplification primers; the first round PCR amplification primer comprises a forward primer F1 and a reverse primer R1;
the forward primer F1 connects the nucleotide sequence Read 1 shown in SEQ ID NO. 21 and the single-molecule identification tag sequence SMB with the upstream primer in the 5'-3' direction.
Still further preferably, the sequence of the single molecule recognition tag sequence SMB is nnnnnnnnnn, wherein N represents any one of A, T, C, G.
Preferably, the reverse primer R1 is formed by connecting the nucleotide sequence Read 2 shown in SEQ ID NO. 22 with a downstream primer in the 5'-3' direction.
Preferably, the first round PCR amplification reaction system comprises: 2X Phanta Flash Master Mix, template plasmid DNA and final concentration of 10. Mu.M primer combination.
In some embodiments of the invention, the first round PCR amplification reaction 50. Mu.L system comprises: 2X Phanta Flash Master Mix mu L of template plasmid DNA 2uL, wherein the Primer Mix is the Primer combination, the primers are mixed in equal proportion, the final concentration is 10 mu M, the volume is 2 mu L, and the RNase-free ddH 2 O was made up to 50. Mu.L.
In some embodiments of the invention, the above-described upstream primer sequence is ligated to the ligation sequences Read 1, SMB, and the downstream primer is ligated to Read 2 in the order of 5'-3' end to end for the first round of PCR amplification. The base composition of the linker sequence is as follows (5 '-3'):
the base composition of the sequence of the combined forward primer F1 is as follows (5 '-3'):
F1：CTACACGACGCTCTTCCGATCT（SEQ ID NO:21）+SMB+Primer F；
wherein SMB is a single molecule identification tag, and the sequence is NNNNNNNN, wherein N represents any one of A, T, C, G.
The sequence base composition of the reverse primer R1 combined is as follows (5 '-3'):
R1：GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC（SEQ ID NO:22）+Primer R；
preferably, the kit also comprises a second round of PCR amplification primers, wherein the second round of PCR amplification primers comprise a forward primer F2 and a reverse primer R2; the nucleotide sequence of the forward primer F2 is shown as SEQ ID NO. 23, and the nucleotide sequence of the reverse primer R2 is shown as SEQ ID NO. 24.
Specifically, the sequence base composition of the reverse primer R2 is as follows (5 '-3'):
R2：CAAGCAGAAGACGGCATACGAGAT+Index+GTGACTGGAGTTCAGACGTGT（SEQ ID NO:24）；
wherein, the sample recognizes a bar code sequence Index, and the nucleotide sequence of the Index is any Index suitable for an Illumina sequencer.
In some embodiments of the invention, the second round PCR amplification reaction system comprises: the DNA product of the first round of PCR amplification, 2X Phanta Flash Master Mix. Mu.L, 2. Mu.L of the upstream primer (10. Mu.M), 2. Mu.L of the downstream primer (10. Mu.M), RNase-free ddH 2 O was made up to 50. Mu.L.
Preferably, the first round PCR amplification procedure of the kit is: pre-denaturation at 98 ℃ for 2 min, and circulation for 1 time; denaturation at 98℃for 10 sec, annealing at 58℃for 15 sec, elongation at 72℃for 30 sec, cycling 20 times; extending for 1 min at 72 ℃, and circulating for 1 time; preserving at 4 ℃.
Preferably, the second round PCR amplification procedure of the kit is: pre-denaturation at 98 ℃ for 2 min, and circulation for 1 time; denaturation at 98℃for 10 sec, annealing at 58℃for 15 sec, elongation at 72℃for 30 sec, cycle 6 times; extending for 1 min at 72 ℃, and circulating for 1 time; preserving at 4 ℃.
Preferably, the respiratory viruses are respiratory syncytial virus, influenza a virus, influenza b virus, adenovirus, parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, bocavirus and coronavirus.
In some embodiments of the invention, the first round and the second round of PCR amplification products are purified after the first round and the second round of PCR amplification are completed, respectively.
Preferably, the purification method includes but is not limited to enzymatic digestion, magnetic bead purification.
In some embodiments of the invention, the purification is performed using nupraise magnetic beads.
Preferably, the invention provides a detection method of respiratory viruses based on targeted sequencing, which comprises the following steps:
s1, synthesizing a plasmid of a virus;
s2, carrying out first-round PCR amplification by using the plasmid obtained in the step S1 as a template and utilizing a forward primer F1 and a reverse primer R1 to obtain a first-round PCR amplification product;
s3, carrying out second-round PCR amplification by using the first-round PCR amplification product obtained in the step S2 as a template and utilizing a forward primer F2 and a reverse primer R2 to obtain a second-round PCR amplification product;
s4, carrying out high-throughput sequencing on the second round of PCR amplified product obtained in the step S3, and identifying the respiratory viruses in the sample to be tested according to the sequencing result.
In some embodiments of the invention, in step S4, prior to high throughput sequencing of the second round of PCR amplification products obtained in S3, further steps of library quality control are included, including, but not limited to, determination of library concentration using QPCR, and determination of library fragment size by Agilent 2100.
Preferably, the high throughput sequencing method is Illumina sequencing;
further preferably, the sequencing platform used is selected from the Illumina MiSeq sequencing platform or Novaseq sequencing platform, and the on-machine sequencing is performed according to the steps of the specification.
Preferably, after the data is taken off-line, the biological information analysis comprises the following steps:
(1) Removing low quality and over short sequences using FastQC;
(2) Comparing the filtered residual sequence with a virus target sequence;
(3) Counting and accurately comparing the numbers of reads of the corresponding targets;
(4) Analyzing SMB sequences corresponding to the same reads, and if the SMB sequences are the same, considering that the SMB sequences are derived from the same parent chain template;
(5) And counting the number of different reads corresponding to different SMBs respectively, namely the initial number of a certain detection target.
Specifically, the cut off value of the identified viral target sequence should be an accurate alignment of the number of reads greater than 3 and SMB greater than 1.
Specifically, the respiratory virus detection method is a method based on non-diagnostic and non-therapeutic purposes.
The beneficial effects of the invention include:
(1) The invention can realize that each original template nucleic acid only corresponds to one SMB label, and has high detection accuracy;
(2) The primer combination and the method adopted by the invention can detect trace nucleic acid in a sample, and have high detection sensitivity;
(3) Compared with the mNGS method, the method only carries out multiplex PCR sequencing on the target virus in the detection range, has no pollution to the human genome, and has low sequencing data amount and lower detection cost;
(4) The detection method of the invention can detect multiple viruses for the same sample, and can detect multiple samples simultaneously.
Drawings
FIG. 1 is a graph of the results of the 100pg initial Agilent Bioanalyer 2100 assay.
Fig. 2 is a graph of the detection result of 10pg at the beginning Agilent Bioanalyer 2100.
FIG. 3 is a graph of the results of the initial Agilent Bioanalyer 2100 test of FIG. 1 pg.
Detailed Description
The present invention will be described in further detail with reference to the following examples, which are not intended to limit the invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, but the experimental methods in which specific conditions are not specified in the examples are generally carried out under conventional conditions, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.
Example 1 primers for detection of respiratory viruses
1. The present example is designed for two amplification primers, namely, forward (F) and reverse (R), for human respiratory syncytial virus, human rhinovirus, influenza b virus, influenza a virus, adenovirus, human bocavirus, human parainfluenza virus type 1, human parainfluenza virus type 2, human parainfluenza virus type 3, and human coronavirus, as shown in table 1 below:
TABLE 1 viral amplification primers
Example 2 detection of respiratory viruses
The experimental steps are as follows:
the specific steps for detecting respiratory viruses are as follows:
(1) Biosynthesis of plasmids of the corresponding viruses from the Optimaceae family;
(2) The first round of amplification was performed using the synthesized plasmid DNA Mix as template:
in the first round of PCR amplification, the primer sequence was ligated to the ligation sequences Read 1, SMB and Read 2, which were ligated end to end in the 5'-3' direction. The base composition of the linker sequence is as follows (5 '-3'):
Read 1: CTACACGACGCTCTTCCGATCT（SEQ ID NO:21）；
Read 2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC（SEQ ID NO:22）；
forward primer F1 consists of three parts: read 1, a single-molecule recognition tag sequence SMB and a target gene specific primer F are connected end to end in the 5'-3' direction.
The sequence base composition of F1 combined is as follows (5 '-3'):
F1：CTACACGACGCTCTTCCGATCT（SEQ ID NO:21）+SMB+Primer F；
wherein SMB is a single molecule identification tag, and the sequence is NNNNNNNN, wherein N represents any one of A, T, C, G.
Reverse primer R1 consists of two parts: the Read 2 and target gene specific primer R are connected end to end in the 5'-3' direction.
The base composition of the sequence of R1 combined is as follows (5 '-3'):
R1：GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC（SEQ ID NO:22） +Primer R；
(3) And carrying out a second round of PCR amplification by taking the first round of PCR amplification product as a template to obtain a library meeting the sequencing requirement.
The primers for the second round of PCR amplification include forward primer F2 and reverse primer R2.
The base sequence composition of forward primer F2 is as follows (5 '-3'):
F2：AATGATACGGCGACCACCGAGATCTACACTCTTTCC+CTACACGACGCTC（SEQ ID NO:23）；
reverse primer R2:
the sequence base composition of R2 is as follows (5 '-3'):
R2：CAAGCAGAAGACGGCATACGAGAT+Index+GTGACTGGAGTTCAGACGTGT（SEQ ID NO:24）；
wherein the sample recognizes the nucleotide sequence of the barcode sequence Index, and the nucleotide sequence of the Index is any Index suitable for an Illumina sequencer.
(4) Target gene multiplex PCR first round amplification
(1) Preparing a target gene multiplex PCR amplification system according to the following reaction system:
template plasmid DNA 2. Mu.L, 2X Phanta Flash Master Mix. Mu.L, upstream primer Mix (10. Mu.M) 2. Mu.L, downstream primer Mix (10. Mu.M) 2. Mu.L, RNase-free ddH 2 O was made up to 50. Mu.L.
(2) The target gene multiplex PCR amplification procedure was set up as follows:
pre-denaturation at 98 ℃ for 2 min, and circulation for 1 time; denaturation at 98℃for 10 sec, annealing at 58℃for 15 sec, elongation at 72℃for 30 sec, cycling 20 times; extending for 1 min at 72 ℃, and circulating for 1 time; preserving at 4 ℃.
(5) Target gene multiplex PCR first round amplification product purification
Purification of PCR amplified products was performed using Norflua magnetic beads according to the procedure described in the specification:
(1) taking out the magnetic beads of the North praise from the refrigerator at the temperature of 4 ℃ 30 min in advance, reversing and uniformly mixing, and standing to balance the temperature to the room temperature.
(2) After the magnetic beads of the Nuo-vozan are fully and evenly mixed, the magnetic beads of the 1X-Nuo-vozan are added into an EP tube with low adsorption of 0.2 and mL, all PCR products are transferred into the EP tube, and the mixture is evenly mixed by low-speed vortex oscillation and stands for 5 min at room temperature.
(3) The tube was placed on a magnetic rack for 2 min until the liquid was clear, and the supernatant was carefully aspirated with a pipette without aspirating the beads.
(4) 200. Mu.L of 80% ethanol was added thereto, and the mixture was allowed to stand for 30 sec, whereupon the supernatant was carefully pipetted off without pipetting the beads.
(5) 200. Mu.L of 80% ethanol was added, left to stand for 30 sec, and the supernatant was carefully pipetted off without any magnetic beads, and centrifuged briefly. Placing on a magnetic rack for 2 min, and sucking residual liquid at the bottom of the tube by using a 20 mu L pipette after the magnetic rack adsorbs the magnetic beads, without sucking the magnetic beads.
(6) Air-drying at room temperature for 2-5 min until the magnetic beads are not reflected, and taking care not to allow the magnetic beads to air-dry until cracks appear.
(7) Taking off the EP tube from the magnetic rack, adding 20 mu L of sterile water, uniformly mixing by low-speed vortex oscillation, standing at room temperature for 5 min, centrifuging briefly, placing the tube on the magnetic rack for 2 min until the liquid is clear, carefully sucking the supernatant, and taking care not to suck the magnetic beads. And transferred to a new 0.2 mL sterile EP tube.
(6) Target gene multiplex PCR second round amplification
PCR reaction system: the DNA product of the first round of PCR amplification, 2X Phanta Flash Master Mix. Mu.L, 2. Mu.L of the upstream primer (10. Mu.M), 2. Mu.L of the downstream primer (10. Mu.M), RNase-free ddH 2 O was made up to 50. Mu.L.
PCR amplification procedure: pre-denaturation at 98 ℃ for 2 min, and circulation for 1 time; denaturation at 98℃for 10 sec, annealing at 58℃for 15 sec, elongation at 72℃for 30 sec, cycle 6 times; extending for 1 min at 72 ℃, and circulating for 1 time; preserving at 4 ℃.
(7) Target gene multiplex PCR second round amplification product purification
The PCR amplified product was purified using nupraise magnetic beads and by double-screen purification:
(1) taking out the magnetic beads of the North praise from the refrigerator at the temperature of 4 ℃ 30 min in advance, reversing and uniformly mixing, and standing to balance the temperature to the room temperature.
(2) After the magnetic beads of the nuozheng are fully and uniformly mixed, 35 mu L of the magnetic beads of the nuozheng are added into a 0.2 mL low-adsorption EP tube, a certain PCR product is transferred into the EP tube, and the mixture is uniformly mixed by low-speed vortex oscillation and stands for 5 min at room temperature.
(3) The tube was placed on a magnetic rack for 2 min until the liquid was clear, and the supernatant was carefully pipetted into a new 0.2 mL low adsorption EP tube without sucking in the magnetic beads.
(4) 10 mu L of nuozhen magnetic beads are added into the 0.2 mL low-adsorption EP tube in the last step, and the mixture is uniformly mixed by low-speed vortex oscillation and stands for 5 min at room temperature.
(5) The tube was placed on a magnetic rack for 2 min until the liquid was clear, and the supernatant was carefully aspirated with a pipette without aspirating the beads.
(6) 200. Mu.L of 80% ethanol was added thereto, and the mixture was allowed to stand for 30 sec, whereupon the supernatant was carefully pipetted off without pipetting the beads.
(7) 200. Mu.L of 80% ethanol was added, left to stand for 30 sec, and the supernatant was carefully pipetted off without any magnetic beads, and centrifuged briefly. Placing on a magnetic rack for 2 min, and sucking residual liquid at the bottom of the tube by using a 20 mu L pipette after the magnetic rack adsorbs the magnetic beads, without sucking the magnetic beads.
(8) Air-drying at room temperature for 2-5 min until the magnetic beads are not reflected, and taking care not to allow the magnetic beads to air-dry until cracks appear.
(9) The EP tube was removed from the magnet holder, 16. Mu.L of sterile water was added, mixed well by low-speed vortex shaking, allowed to stand at room temperature for 5 min, centrifuged briefly, the tube was placed on the magnet holder for 2 min until the liquid was clear, the supernatant carefully aspirated, taking care not to aspirate magnetic beads, and transferred to a new 0.2 mL sterile EP tube.
(8) Library quality control
(1) Taking 1 mu L of the PCR amplified product after the second round of purification for QPCR quantitative detection;
the QPCR quantitative detection comprises the following steps:
absolute quantification is adopted, a standard substance is prepared, a system is prepared, an upper computer program is selected for detection, and the concentration of a library sample is calculated according to a constructed standard curve and a detection result.
The quantitative results are shown in Table 2:
TABLE 2 quantitative results of sample library QPCR
(2) 1 μl was used to determine library fragment size using Agilent Bioanalyer 2100, with the quality control fragment size being largely centered around 340-440 bp, as shown in FIGS. 1-3.
The experimental steps are as follows:
according to Agilent Bioanalyzer 2100, a chip is prepared, 1 mu L of sample to be measured is added, the sample is uniformly mixed in a uniformly mixing instrument for 1 min, a 2100 detector is opened, a page is opened by clicking software, the chip is placed in a chip groove, and after the chip is fixed, a cover is closed. A specific program is selected and the operation is started.
All libraries were mixed into a single vial in a certain ratio to give a total library with a final concentration of 3 or more nM.
The criteria for library quality control were:
1) The concentration is more than or equal to 3 nM (QPCR quantitative concentration);
2) The residual volume after library detection is more than or equal to 10 mu L;
3) The detection result shows that no obvious adapter dimer (peaks near 130 bp);
4) The detection results showed that the library main band was concentrated, single, and close to the reference size.
(9) High throughput sequencing
Performing on-machine sequencing on the obtained library by using an Illumina sequencing platform;
the on-machine sequencing comprises the following steps:
(1) denaturation (denaturation)
The above-prepared mixed library was denatured together with Illumina sequencing reagent Phix (for balancing bases).
(2) The Flow cell is placed in a small tube of saline solution, taken out, repeatedly rinsed with ultra pure water, and the saline solution is rinsed clean. And then carefully wiped clean with a piece of mirror wiping paper for later use.
(3) Opening Illumina experiment manager software, selecting a sequencer and other programs, putting various reagents, flow cells, buffers, waste liquid bottles and the like, and clicking Start Run after confirming that the error is not caused.
(10) Data analysis
The data analysis steps of the machine are as follows:
(1) removing low quality and over short sequences using FastQC;
(2) comparing the filtered residual sequence with a virus target sequence;
(3) counting and accurately comparing the numbers of reads of the corresponding targets;
(4) analyzing SMB sequences corresponding to the same reads, and if the SMB sequences are the same, considering that the SMB sequences are derived from the same parent chain template;
(5) counting the number of different reads corresponding to different SMBs respectively, namely the initial number of a certain detection target;
(6) the cut off value for identifying the viral target sequence should be greater than 3 for accurate alignment reads and greater than 1 for SMB.
Experimental results:
the experimental results are shown in table 3 below:
TABLE 3 example 1 sequencing result data statistics
The detection result shows that:
accuracy:
from the number of the detected reads, the number of the reads is different, and the number of the detected reads of the human parainfluenza virus type 3 is 14,263 at most; the number of reads detected by influenza B virus was the least, 3,584. However, from the view of the number of detected SMB, the number of detected molecular tags corresponding to 10 viruses is not greatly different, the number of detected SMB of human parainfluenza virus 3 and B is 3,613 and 2,196 respectively, because the input template amounts are basically consistent, the reads number represents all the numbers of amplified products, and the number of the SMB represents the reaction input template amount, so that the number of the SMB can represent more real template amount.
Comparative example 1
Comparative example 1 differs from example 1 above in that the primer combination is replaced with the reported primer combination for detecting respiratory viruses, and the other conditions are unchanged.
The primer sequences in comparative example 1 are shown in Table 4 below:
table 4 reported primers for detecting respiratory pathogens
Example 3
The sensitivity of the primer combination of example 1 and the primer combination of comparative example 1 was examined using the detection procedure in example 2.
Sensitivity:
in this example 3, different template initiation amounts of 100pg, 10pg and 1pg were set simultaneously to detect the sensitivity of the primer combinations of example 1 and comparative example 1, respectively.
The test results of example 1 are shown in table 5 below.
TABLE 5 statistics of primer combination sequencing results for example 1
The results of the experiment of comparative example 1 are shown in tables 6 to 7 below:
TABLE 6 quantitative results of library QPCR of comparative example 1
TABLE 7 statistics of sequencing results for comparative example 1 primer set
As can be seen from the sensitivity experiment result table, the pathogenic bacteria can detect more reads and SMB numbers by using the primer combination, so that the primer combination has the characteristics of better specificity and more sensitivity.
Finally, it should be noted that the above description is only for illustrating the technical solution of the present invention, and not for limiting the scope of the present invention, and that the simple modification and equivalent substitution of the technical solution of the present invention can be made by those skilled in the art without departing from the spirit and scope of the technical solution of the present invention.
Claims (10)
1. A primer combination for detecting respiratory viruses is characterized by comprising an upstream primer and a downstream primer of respiratory syncytial viruses respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2, an upstream primer and a downstream primer of rhinoviruses respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4, an upstream primer and a downstream primer of influenza B viruses respectively shown as SEQ ID NO. 5 and SEQ ID NO. 6, an upstream primer and a downstream primer of influenza A viruses respectively shown as SEQ ID NO. 7 and SEQ ID NO. 8, an upstream primer and a downstream primer of adenoviruses respectively shown as SEQ ID NO. 9 and SEQ ID NO. 10, an upstream primer and a downstream primer of human bocaviruses respectively shown as SEQ ID NO. 11 and SEQ ID NO. 12, an upstream primer and a downstream primer of human parainfluenza 1 viruses respectively shown as SEQ ID NO. 13 and SEQ ID NO. 14, an upstream primer and a downstream primer of human parainfluenza 2 respectively shown as SEQ ID NO. 15 and SEQ ID NO. 16, and an upstream primer and a downstream primer of human parainfluenza A viruses respectively shown as SEQ ID NO. 17 and SEQ ID NO. 20 respectively shown as SEQ ID NO. 19 and a downstream primer of human parainfluenza virus respectively shown as SEQ ID NO. 12.
2. Use of the primer combination of claim 1 for the preparation of a kit for detecting respiratory viruses.
3. A kit for detecting respiratory viruses, comprising the primer combination of claim 1.
4. The kit of claim 3, further comprising a first round of PCR amplification primers; the first round PCR amplification primer comprises a forward primer F1 and a reverse primer R1;
the forward primer F1 connects a nucleotide sequence Read 1 shown in SEQ ID NO. 21 and a single-molecule identification tag sequence SMB with the upstream primer in the 5'-3' direction;
the sequence of the single-molecule recognition tag sequence SMB is NNNNNNNN, wherein N represents any one of A, T, C, G.
5. The kit according to claim 4, wherein the reverse primer R1 is a primer comprising the nucleotide sequence Read 2 shown in SEQ ID NO. 22 and a downstream primer in the 5'-3' direction.
6. The kit of claim 3, further comprising a second round of PCR amplification primers comprising forward primer F2 and reverse primer R2; the nucleotide sequence of the forward primer F2 is shown as SEQ ID NO. 23, and the nucleotide sequence of the reverse primer R2 is shown as SEQ ID NO. 24.
7. A kit according to claim 3, wherein the concentration of the primer in the kit is 10 μm.
8. A kit according to claim 3, wherein the first round of PCR amplification procedure of the kit is: pre-denaturation at 98 ℃ for 2 min, and circulation for 1 time; denaturation at 98℃for 10 sec, annealing at 58℃for 15 sec, elongation at 72℃for 30 sec, cycling 20 times; extending for 1 min at 72 ℃, and circulating for 1 time.
9. A kit according to claim 3, wherein the second round of PCR amplification procedure of the kit is: pre-denaturation at 98 ℃ for 2 min, and circulation for 1 time; denaturation at 98℃for 10 sec, annealing at 58℃for 15 sec, elongation at 72℃for 30 sec, cycle 6 times; extending for 1 min at 72 ℃, and circulating for 1 time.
10. The kit of claim 3, wherein the respiratory viruses are respiratory syncytial virus, influenza a virus, influenza b virus, adenovirus, parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, bocavirus and coronavirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310547537.9A CN116287479B (en) | 2023-05-16 | 2023-05-16 | Primer combination for detecting respiratory viruses and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310547537.9A CN116287479B (en) | 2023-05-16 | 2023-05-16 | Primer combination for detecting respiratory viruses and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116287479A true CN116287479A (en) | 2023-06-23 |
| CN116287479B CN116287479B (en) | 2023-07-28 |
Family
ID=86803482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310547537.9A Active CN116287479B (en) | 2023-05-16 | 2023-05-16 | Primer combination for detecting respiratory viruses and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116287479B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112852937A (en) * | 2021-03-10 | 2021-05-28 | 美格医学检验所(广州)有限公司 | Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof |
| WO2022025823A1 (en) * | 2020-07-29 | 2022-02-03 | Lucence Life Sciences Pte. Ltd | Methods and kits for detecting and sequencing rna viruses |
| WO2022025825A1 (en) * | 2020-07-29 | 2022-02-03 | Lucence Life Sciences Pte. Ltd | Methods and kits for determining integrity of viral rna |
| CN115725784A (en) * | 2022-05-31 | 2023-03-03 | 深圳联合医学科技有限公司 | Kit and method for detecting pathogens related to respiratory tract infection |
| CN115992294A (en) * | 2022-10-17 | 2023-04-21 | 杭州遂真生物技术有限公司 | Composition for detecting nucleic acid of multiple respiratory pathogens and integrated kit |
| CN116064927A (en) * | 2022-07-06 | 2023-05-05 | 北京博晖创新生物技术集团股份有限公司 | Primer probe composition for respiratory tract pathogen detection and application thereof |
-
2023
- 2023-05-16 CN CN202310547537.9A patent/CN116287479B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022025823A1 (en) * | 2020-07-29 | 2022-02-03 | Lucence Life Sciences Pte. Ltd | Methods and kits for detecting and sequencing rna viruses |
| WO2022025825A1 (en) * | 2020-07-29 | 2022-02-03 | Lucence Life Sciences Pte. Ltd | Methods and kits for determining integrity of viral rna |
| CN112852937A (en) * | 2021-03-10 | 2021-05-28 | 美格医学检验所(广州)有限公司 | Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof |
| CN115725784A (en) * | 2022-05-31 | 2023-03-03 | 深圳联合医学科技有限公司 | Kit and method for detecting pathogens related to respiratory tract infection |
| CN116064927A (en) * | 2022-07-06 | 2023-05-05 | 北京博晖创新生物技术集团股份有限公司 | Primer probe composition for respiratory tract pathogen detection and application thereof |
| CN115992294A (en) * | 2022-10-17 | 2023-04-21 | 杭州遂真生物技术有限公司 | Composition for detecting nucleic acid of multiple respiratory pathogens and integrated kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116287479B (en) | 2023-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112831604B (en) | Pathogenic microorganism detection primer group, kit and method based on targeted sequencing | |
| CN112852937B (en) | Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof | |
| CN111269995B (en) | Primer group, kit and detection method for detecting pathogen | |
| CN116287357A (en) | Respiratory tract pathogenic bacteria detection kit based on targeted amplicon sequencing | |
| CN113528709A (en) | Fluorescent quantitative PCR detection method capable of covering 13-type adenovirus and kit | |
| CN113025761A (en) | Multi-amplification matched high-throughput sequencing method and kit for pathogenic microorganism identification | |
| CN114075607B (en) | On-site visualization kit for detecting listeria monocytogenes based on SHERLOCK and application | |
| CN111910017A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting respiratory pathogens, method and application | |
| CN110438260B (en) | African swine fever virus nucleic acid test strip detection kit | |
| CN111893215A (en) | Multiplex-time PCR kit for detecting coronavirus, method and application | |
| CN110938711A (en) | Real-time fluorescent RAA primer, probe and kit for detecting avian infectious laryngotracheitis virus and using method of real-time fluorescent RAA primer, probe and kit | |
| CN116287479B (en) | Primer combination for detecting respiratory viruses and application thereof | |
| CN115873992B (en) | Primer combination for detecting blood flow infection pathogen and application thereof | |
| CN116144811B (en) | Multiplex primer set, method and kit for detecting cerebrospinal fluid pathogen | |
| JP2019110810A (en) | Primer sets for specific amplification of nucleic acids derived from strawberry pathogenic viruses and methods for detecting strawberry pathogenic viruses | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN111575410A (en) | LAMP detection kit for porcine pseudorabies virus | |
| CN111647685A (en) | Primer group, probe group and kit for detecting COVID-19 virus and application thereof | |
| CN111500768B (en) | Primer probe for identifying novel coronavirus and application of primer probe in dual-digital PCR | |
| CN112063757A (en) | Primer and kit for detecting African swine fever virus and application of primer and kit | |
| CN111850099A (en) | RPA kit, primers, probe and method for detecting varicella virus | |
| JP6853523B2 (en) | PCR using helicase | |
| CN111349718A (en) | Primer group for pathogenic nucleic acid amplification, pathogenic nucleic acid detection library construction method and pathogenic detection method | |
| CN108384866A (en) | A kind of shigella sonnei specific nucleotide PCR detection kit | |
| CN112575122B (en) | Dual PCR primer set for rapidly detecting duck type 2 adenovirus and duck circovirus, and detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |