CN116287449A

CN116287449A - Kit for rapid typing detection of human papilloma virus nucleic acid

Info

Publication number: CN116287449A
Application number: CN202310090300.2A
Authority: CN
Inventors: 黄柏成; 党露; 王鑫杰; 郭玲; 曾梓菡
Original assignee: Zhejiang Lab
Current assignee: Zhejiang Lab
Priority date: 2023-01-12
Filing date: 2023-01-12
Publication date: 2023-06-23

Abstract

The invention relates to the technical field of biology, in particular to a kit for rapid genotyping detection of human papillomavirus nucleic acid. The invention realizes high-sensitivity, high-specificity and rapid visual detection of 6 subtype HPV (HPV 6, HPV11, HPV16, HPV18, HPV31 and HPV 33) nucleic acid by utilizing Cpf1 specific recognition nucleic acid combined immunoassay chromatography technology. The L1 gene with high conservation of HPV is used as a detection target sequence. The invention relates to a nucleic acid rapid detection tool based on Cpf1, which can realize the nucleic acid isothermal amplification and Cpf1 detection flow of a one-step method, comprises an immunochromatographic strip and can realize convenient and rapid result interpretation. The method can realize the identification of different subtypes of HPV based on designed sequence differential crRNA, and provides an accurate, rapid and simple HPV typing detection method for basic laboratories and production lines.

Description

Kit for rapid typing detection of human papilloma virus nucleic acid

Technical Field

The invention relates to the technical field of biology, in particular to a kit for rapid genotyping detection of human papillomavirus nucleic acid.

Background

Cervical cancer is the fourth most common malignant tumor of women worldwide, and is the only cancer which can be found and prevented early at present. The high-risk subtype of human papillomavirus (human papillomavirus, HPV) causes the vast majority of cervical cancers. HPV is a double-stranded DNA virus, the genome encodes 6 early genes (E1, E2, E4, E5, E6 and E7) and two late genes (L1 and L2). HPV L1 gene sequences differing by more than 10% are considered subtype strains. Of the over 200 HPV genotypes, HPV alpha viruses contain about 40 genotypes, primarily infect genital mucosa and are sexually transmitted, including HPV-6 and HPV-11, which can cause benign symptoms, as well as 13 types of high-risk HPV (HPV-16, HPV-18, HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-51, HPV-52, HPV-56, HPV-58, HPV-59 and HPV-68) which can be oncogenic or potentially oncogenic. HPV-16 priming accounts for about 50% -60% of cervical cancers, HPV-18 accounts for about 20%, so early-time batched HPV vaccines multi-target HPV-16 and HPV-18, but recently batched vaccines can target the five most common high risk types (HPV-31, HPV-33, HPV-45, HPV-52 and HPV-58) in cervical cancers, and the two most common low risk types (HPV-6 and HPV-11) in genital warts.

HPV subtype is more, and the common nucleic acid detection technology in pathogen diagnosis realizes multi-subtype detection and genotyping detection. The multi-subtype detection includes: common PCR methods, reverse line blot analysis, hybrid capture, these assays are used only to detect HPV and cannot distinguish between specific genotypes. Genotyping assays included: linear array HPV genotyping test, PCR-based Amplicor HPV kit, DNA array-based method, PCR-based fluorescent bead array multiplex genotyping, real-time quantitative PCR, which require a long time to complete detection and are unfavorable for clinical application.

CRISPR-Cas is an adaptive immune system of bacteria, and Cas proteins target degradation of foreign nucleic acids by RNA-guided nucleases. Among them, cas enzyme CRISPR-Cas12a (Cpf 1) can specifically recognize the spacer adjacent motif (PAM) rich in Thymine (T) nucleotides, thereby catalyzing their own guided CRISPR RNA (crRNA) maturation. When Cpf1 protein cleaves double stranded DNA (dsDNA) in a sequence specific manner, strong non-specific single stranded DNA (ssDNA) trans-cleavage activity is induced.

Colloidal gold immunoassay is a high-efficiency technical scheme for clinical rapid detection. When the colloidal gold particle-labeled antibody is bound to the corresponding antigen, the colored immunoreactants can be visualized. The colloidal gold has short detection action time, long-term stability under wide climatic conditions and relatively low cost. The CRISPR trans-reporter gene method and the colloidal gold technology are combined, so that the CRISPR trans-reporter gene method can be widely applied to clinical first-line use of untrained personnel.

Disclosure of Invention

Based on this, the applicant developed a rapid and accurate HPV detection method in detecting clinical samples. HPV dsDNA is first extracted from the sample to be detected, then a recombinase polymerase isothermal amplification (RPA) and Cpf1 reaction (Cpf 1-crRNA complex binds to and cleaves target HPV dsDNA, trans-cleavage of ssDNA is activated, and a fluorescent reporter coupled to ssDNA generates a fluorescent signal upon cleavage) are performed in a one-step detection system. The novel method for targeting the CRISPR trans-reporter gene by the DNA endonuclease can effectively support the rapid and accurate diagnosis of cervical cancer (HPV subtype identification).

The invention aims to provide a one-step Cpf1 kit for HPV nucleic acid typing detection and a detection method thereof, wherein the kit has high sensitivity, strong specificity and quick visualization.

In order to achieve the aim, the invention provides a target for rapid genotyping detection of human papillomavirus nucleic acid, wherein the target is a target combination consisting of six sequences, and the nucleotide sequence of the target combination is shown in SEQ ID NO. 19-24.

The invention also provides a primer combination for rapid genotyping detection of human papillomavirus nucleic acid, which comprises the following steps:

HPV6 specific primers with nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO.2,

HPV11 specific primers with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.4,

HPV16 specific primers with nucleotide sequences shown as SEQ ID NO.5 and SEQ ID NO.6,

HPV31 specific primers with nucleotide sequences shown as SEQ ID NO.9 and SEQ ID NO.10,

HPV33 specific primers with nucleotide sequences shown in SEQ ID NO.11 and SEQ ID NO. 12.

The invention also provides a crRNA combination for rapid genotyping detection of human papillomavirus nucleic acids, the crRNA combination comprising:

HPV 6-specific crRNA with the sequence shown in SEQ ID NO.13,

HPV 11-specific crRNA with the sequence shown in SEQ ID NO.14,

HPV16 specific crRNA with the sequence shown in SEQ ID NO.15,

HPV 18-specific crRNA with the sequence shown in SEQ ID NO.16,

HPV 31-specific crRNA with the sequence shown in SEQ ID NO.17,

HPV 33-specific crRNA with the sequence shown in SEQ ID NO. 18.

Preferably, the preparation method of the specific crRNA comprises: for the L1 genes of the 6 subtype HPV strains, a targeting sequence comprising Cpf1 recognition sequence (PAM) TTTN is searched for, and crRNA is designed. After the design is completed, oligonucleotide (oligo) is synthesized by a chemical method to obtain target crRNA, and then crRNA with optimal reactivity is obtained through Cpfl detection and used for method establishment and kit construction.

The invention also provides a kit for rapid genotyping detection of human papilloma virus nucleic acid, which comprises an isothermal amplification system, a Cpf1 detection system, an enzyme-labeled instrument fluorescence detection system or an immune colloidal gold test strip detection system;

the isothermal amplification system comprises the primer combination as isothermal amplification primer,

the Cpfl detection system comprises the crRNA combination,

and the enzyme-labeled instrument fluorescent detection system or the immune colloidal gold test strip detection system is used for detecting Cpf1 detection reaction products generated by the Cpf1 detection system.

Specifically, the Cpf1 detection system further comprises Cpf1 protein and a ssDNA reporting system, wherein the ssDNA reporting system comprises ssDNA FQ reporter for fluorescence detection of an enzyme-labeled instrument and/or ssDNA DB reporter for detection of an immune colloidal gold test strip.

Wherein ssDNA FQ reporter is ssDNA labeled with 6-carboxyfluorescein (6-FAM) and fluorescence quencher (BHQ 1), and the labeling products are as follows: the ratio of the FAM/TTTATT/3 BHQ1/, which is named ssDNA FQ reporter/56 FAM/TTTATT/3 BHQ1/; ssDNA DB reporter is ssDNA labeled with Digoxin (Digoxin) and Biotin (Biotin), and the labeling products are as follows: 5 Dig/TTTATT/3 Bio/, named ssDNA DB reporter/5 Dig/TTTATT/3 Bio/;

the immune colloidal gold test strip comprises a sample pad, a binding pad, a nitrocellulose membrane, a water absorption pad and a PVC back lining; the PVC back lining is sequentially adhered with a sample pad, a bonding pad, a nitrocellulose membrane and a water absorption pad; the conjugate of the mouse anti-digoxin antibody marked by colloidal gold is coated on the binding pad; the nitrocellulose membrane is respectively coated with a quality control line composed of streptavidin and a detection line composed of rabbit anti-mouse IgG antibody.

The Cpf1 kit provided by the invention can be used for fluorescence detection by an enzyme-labeled instrument or immune colloidal gold test strip. The DNA (ssDNA) reporter system in the Cpf1 assay system was ssDNA FQ reporter when detected using a microplate reader and ssDNA DB reporter when detected using an immune colloidal gold strip.

Upon fluorescent detection using a microplate reader, the Cpf1 protein following HPV specific nucleic acid activation will cleave ssDNA FQ reporter labeled with a fluorophore and a quencher, thereby releasing the activated fluorophore, which can be detected using a microplate reader. Correspondingly, when no specific nucleic acid exists in the sample to be detected, no fluorescence reading exists.

When an immune colloidal gold test strip is used for detection, after Cpfl is cut and a sample to be detected is added into the colloidal gold test strip, the colloidal gold-labeled murine anti-digoxin antibody can be combined with a digoxin-labeled ssDNA reporting system, and the compound moves from a quality control line to a detection line along with the direction of liquid flow; on the quality control line, streptavidin is saturated to capture a ssDNA report system marked with biotin mark period, so that a band is displayed; only when Cpfl detects HPV-specific sequences will the digoxin-labeled and biotin ssDNA reporter system be cleaved, resulting in the capture of the digoxin-labeled ssDNA fragment by the detection line for color development.

The invention also provides a detection method for rapid typing of human papillomavirus nucleic acid, which comprises the following steps:

(1) Preparing human papillomavirus nucleic acid;

(2) Isothermal amplification by a one-step method and Cpf1 detection: amplifying the human papillomavirus nucleic acid obtained in the step (1) in an RPA isothermal amplification system by utilizing the primer combination, automatically detecting Cpf1 by the amplified product, and reacting to obtain a Cpfl detection product;

(3) And (3) performing enzyme-labeled instrument fluorescence detection or immune colloidal gold test strip detection on the Cpf1 detection product.

The amplification conditions were 39℃for 10 minutes; the Cpf1 assay conditions were 37℃for 15 minutes.

One-step isothermal amplification-Cpf 1 detection was achieved by two connected reaction chambers. Firstly, adding a sample to be detected into an isothermal amplification reaction chamber, automatically sucking isothermal amplification products into a Cpfl detection reaction chamber after the reaction is finished, and finally adding all Cpf1 detection reaction products into an immune colloidal gold test strip system to finish detection.

Specifically, the rapid HPV nucleic acid detection method comprises the following steps:

s1: preparation of specific crrnas. Designing crrnas comprising the Cpf1 recognition sequence TTTN for 6 subtypes of HPV (HPV 6, HPV11, HPV16, HPV18, HPV31, HPV 33), constructing a vector, and performing in vitro transcription to obtain the crrnas;

s2: nucleic acid release. Releasing nucleic acid in the sample to be tested by using a nucleic acid quick release reagent;

s3: isothermal amplification of nucleic acid and Cpf1 detection by a one-step method. The S2 step sample was amplified in RPA system using isothermal amplification primers (reaction at 39 ℃ C. For 10 min) and HPV-specific nucleic acid sequences were recognized by Cpf1, allowing the activated Cpf1 cleavage probes (reaction at 37 ℃ C. For 15 min).

S4: and adding the reaction product into a colloidal gold test strip, and judging the detection result after 10 minutes at room temperature.

Compared with the prior art, the invention has the beneficial effects that:

(1) The invention realizes high-sensitivity, high-specificity and rapid visual detection of 6 subtype HPV nucleic acids by utilizing Cpf1 specific recognition nucleic acid combined immunity flow detection chromatography technology. The L1 gene with high conservation of HPV is used as a detection target sequence.

(2) The invention relates to a nucleic acid rapid detection tool based on Cpf1, which can realize the nucleic acid isothermal amplification and Cpf1 detection flow of a one-step method, comprises an immunochromatographic strip and can realize convenient and rapid result interpretation.

(3) The method can realize the identification of different subtypes of HPV based on designed sequence differential crRNA, and provides an accurate, rapid and simple HPV typing detection method for basic laboratories and production lines.

Drawings

FIG. 1 is a schematic diagram of a rapid HPV nucleic acid detection method.

FIG. 2 is a graph showing the results of fluorescence detection of HPV target gene detection and subtype discrimination in plasmid samples.

FIG. 3 is a bar graph showing the fluorescence detection results of HPV target gene detection and subtype discrimination in plasmid samples.

FIG. 4 is a schematic diagram showing the detection results of immune colloidal gold test strips for HPV target gene detection and subtype discrimination in plasmid samples.

FIG. 5 is a bar graph of fluorescence detection results for HPV target gene detection and subtype discrimination in cell samples.

FIG. 6 is a schematic diagram showing the detection results of an immune colloidal gold test strip for HPV target gene detection and subtype discrimination in cervical swab samples.

FIG. 7 is a bar graph showing the fluorescence detection results of HPV target gene detection and subtype discrimination in anal swab samples.

FIG. 8 is a schematic diagram of the detection results of immune colloidal gold test strips for HPV target gene detection and subtype discrimination in serum samples.

FIG. 9 is a pUC57 plasmid map.

Detailed Description

The general technical schematic diagram of the invention is shown in fig. 1, and comprises the following 4 parts: preparation of specific crRNA, nucleic acid release, isothermal nucleic acid amplification and Cpf1 detection, and test strip typing detection.

The HPV nucleic acid rapid detection method comprises the following steps:

S4: and adding the reaction product into an immune colloidal gold test strip, and judging the detection result after 10 minutes at room temperature.

Example 1

A kit for rapid typing of human papillomavirus nucleic acid and a detection method thereof:

(1) Preparation of specific crRNA

Referring to L1 gene fragments (gene sequences shown as SEQ ID NO. 19-24) of 6 subtype HPV strains (HPV 6, HPV11, HPV16, HPV18, HPV31 and HPV 33) in NCBI database, a targeting sequence containing Cpf1 recognition sequence (PAM) TTTN is searched, and subtype-specific crRNA with the length of 44bp is designed. After the design was completed, oligonucleotides (oligo) were synthesized by the Nanjing Jinsri company by a pure synthetic method, the sequences of which are shown in SEQ ID No.13 to SEQ ID No.18, and specific information of which are shown in Table 1.

(2) Sample preparation

And releasing the nucleic acid in the sample to be tested by using the nucleic acid quick release reagent.

(3) One-step nucleic acid isothermal amplification and Cpf1 detection

Pre-amplifying single stranded RNA (ssRNA) viral nucleic acid using reverse transcription isothermal amplification (RT-RPA) to perform a Cpf1 detection reaction;

the RT-RPA amplification primers RT-RPA-F (forward primer) and RT-RPA-R (reverse primer) were designed and synthesized according to the isothermal amplification reaction requirements, and the obtained sequence information is shown in Table 1.

One-step isothermal amplification-Cpf 1 detection was achieved by two connected reaction chambers.

The isothermal amplification reaction chamber volume was 50 μl, comprising: 25.0. Mu.L of buffer, 3.0. Mu.L of RPA upstream primer (shown as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 and SEQ ID NO.11 each, 0.5. Mu.L), 3.0. Mu.L of RPA downstream primer (shown as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.12 each, 0.5. Mu.L each), 6.5. Mu.L of RNase-free water and 2.5. Mu.L of magnesium acetate.

The Cpf1 detection reaction chamber volume is 50. Mu.L, including: 17.8. Mu.L RNase-free water, 5.0. Mu.L buffer, 2.0. Mu.L LbCPf1 protein, 3.0. Mu.L crRNA (0.5. Mu.L each with the sequence shown in SEQ ID NO.13 to SEQ ID NO. 18), 0.2. Mu.L RNase inhibitor, 2.0. Mu. L ssDNA FQ reporter or ssDNA DB reporter, 20.0. Mu.L isothermal amplification product. Wherein ssDNA FQ reporter is ssDNA labeled with 6-carboxyfluorescein (6-FAM) and fluorescence quencher (BHQ 1), the labeling products are as follows: 5/6 FAM/TTTATT/3 BHQ1/, named ssDNA FQ reporter/56 FAM/TTTATT/3 BHQ1/; upon fluorescent detection using a microplate reader, the Cpf1 protein following HPV specific nucleic acid activation will cleave ssDNA FQ reporter labeled with a fluorophore and a quencher, thereby releasing the activated fluorophore, which can be detected using a microplate reader. Correspondingly, when no specific nucleic acid exists in the sample to be detected, no fluorescence reading exists.

ssDNA DB reporter is ssDNA labeled with Digoxin (Digoxin) and Biotin (Biotin), the labeling products are as follows: 5 Dig/TTTATT/3 Bio/, named ssDNA DB reporter/5 Dig/TTTATT/3 Bio/; when the immune colloidal gold test strip is used for detection, after a sample to be detected is added into the colloidal gold test strip after Cpf1 is cut, the colloidal gold-labeled murine anti-digoxin antibody can be combined with a digoxin-labeled ssDNA reporting system, and the compound moves from a quality control line to a detection line along with the direction of liquid flow; on the quality control line, streptavidin is saturated to capture a ssDNA report system marked with biotin mark period, so that a band is displayed; only when Cpfl detects HPV-specific sequences will the digoxin-labeled and biotin ssDNA reporter system be cleaved, resulting in the capture of the digoxin-labeled ssDNA fragment by the detection line for color development.

10.0. Mu.L of the sample to be detected was added to the isothermal amplification reaction chamber and incubated at 39℃for 10 minutes. And then, automatically sucking 20 mu L of the reaction solution into a Cpfl reaction cavity through a control point of a reaction plate, regulating the temperature to 37 ℃ for reaction for 15 minutes, and using the reaction product for enzyme-labeled instrument fluorescence detection or immune colloidal gold test strip detection.

TABLE 1

Sequence name	Sequence (5 '-3')	Description of the invention
			SEQ ID NO.1	catgacattatgtgcatccgtaactacatc	HPV6 RPA upstream primer
SEQ ID NO.2	atataggccattacttcagcagacaatgta	HPV6 RPA downstream primer
			SEQ ID NO.3	acaatggtatttgctggggaaaccacttgt	HPV11 RPA upstream primer
SEQ ID NO.4	tccacatggcgcatgtattccttataatct	HPV11 RPA downstream primer
			SEQ ID NO.5	tacaacgagcacagggccacaataatggca	HPV16 RPA upstream primer
SEQ ID NO.6	cccatgtcgtaggtactccttaaagttagt	HPV16 RPA downstream primer
			SEQ ID NO.7	tcataacaatggtgtttgctggcataatca	HPV18 RPA upstream primer
SEQ ID NO.8	catcatattgcccaggtacaggagactgtg	HPV18 RPA downstream primer
			SEQ ID NO.9	cacaataatggtatttgttggggcaatcag	HPV31 RPA upstream primer
SEQ ID NO.10	atcaaattcctcaccatgtcttaaatactc	HPV31 RPA downstream primer
			SEQ ID NO.11	caatcaggtatttgttactgtggtagatac	HPV33 RPA upstream primer
SEQ ID NO.12	tcataacttctgcagttaaggtaactttgc	HPV33 RPA downstream primer
			SEQ ID NO.13	uaauuucuacuaaguguagauuaaucagaauugguguaugugga	HPV6-crRNA
SEQ ID NO.14	uaauuucuacuaaguguagaugacacagaugcacauagugucau	HPV11-crRNA
			SEQ ID NO.15	uaauuucuacuaaguguagauuauguaguuucugaaguagauau	HPV16-crRNA
SEQ ID NO.16	uaauuucuacuaaguguagauacaauaugugcuucuacacaguc	HPV18-crRNA
			SEQ ID NO.17	uaauuucuacuaaguguagauaauguaguaucacuguuugcaau	HPV31-crRNA
SEQ ID NO.18	uaauuucuacuaaguguagauaagaauauauaagacauguugaa	HPV33-crRNA

Example 2: HPV target gene detection and subtype discrimination in plasmid

1.1 sample preparation

In this case, the sequences of the L1 target gene fragments of HPV subtypes (HPV 6, HPV11, HPV16, HPV18, HPV31 and HPV 33) are shown in SEQ ID NO.19 to SEQ ID NO.24, and are synthesized by Nanjing Jinsrui company and constructed on pUC57 vectors (the maps of which are shown in FIG. 9), and are named plasmids pUC57-MP-P1 to pUC57-MP-P6. Based on the original concentrations of plasmid samples P1-P6, plasmid samples were diluted to 1000 copies/. Mu.L using RNase-free water, and 10. Mu.L of each sample was used for one-step isothermal amplification-Cpfl detection.

1.2 one-step isothermal amplification-Cpf 1 detection reaction

10.0. Mu.L of the "1.1 sample preparation" step sample was added to the isothermal amplification reaction chamber and incubated at 39℃for 10 minutes. Then automatically sucking 20 mu L of the Cpf1 reaction cavity to the Cpf1 reaction cavity through a control point of the reaction plate, and regulating the temperature to 37 ℃ for reaction for 15 minutes to obtain a Cpf1 reaction product; wherein the isothermal amplification reaction chamber and the Cpf1 detection reaction chamber are the isothermal amplification reaction chamber and the Cpf1 detection reaction chamber of step (3) in example 1.

1.3 fluorescence detection by enzyme-labeled instrument

A full wavelength microplate reader was used to measure the fluorescence value of the product in the "1.2 one-step isothermal amplification-Cpf 1 reaction" step, where the excitation wavelength was 485nm and the emission wavelength was 520nm. As a result, as shown in FIGS. 2 and 3, for each HPV subtype-specific crRNA, only the reaction unit to which the corresponding template was added was visible as fluorescence, and none of the others was.

1.4 immune colloidal gold test paper strip detection

If the immune colloidal gold result is detected, all the products in the step of isothermal amplification-Cpfl reaction by a 1.2 one-step method are added to an immune colloidal gold test strip sample adding point, incubated for 10 minutes at room temperature, and the detection result is shown in a visual observation result, wherein the detection result is schematically shown in figure 4, and on the premise that a quality control line is established, positive strips are only visible for each HPV subtype specific crRNA only by adding the test strip corresponding to an HPV template, and no visible strips are found for the rest templates.

Example 3: HPV target gene detection and subtype differentiation in cell samples

1.1 sample preparation

Samples C1-C6 of HPV positive cells of each subtype were collected by centrifugation, pretreated nucleic acid was obtained using a rapid nucleic acid release agent, and 10. Mu.L was used for one-step isothermal amplification-Cpf 1 detection.

1.2 one-step isothermal amplification-Cpf 1 reaction

10. Mu.L of the "1.1 sample preparation" step sample was added to the isothermal amplification reaction chamber and incubated at 39℃for 10 minutes. Then automatically sucking 20 mu L of the Cpf1 reaction cavity to the Cpf1 reaction cavity through a control point of the reaction plate, and regulating the temperature to 37 ℃ for reaction for 15 minutes to obtain a Cpf1 reaction product; wherein the isothermal amplification reaction chamber and the Cpf1 detection reaction chamber are the isothermal amplification reaction chamber and the Cpf1 detection reaction chamber of step (3) in example 1.

1.3 fluorescence detection by enzyme-labeled instrument

The product of the "1.2 one-step isothermal amplification-Cpf 1 reaction" step was used for fluorescence assay (FIG. 5), with only the reaction units added with the corresponding templates for each HPV subtype-specific crRNA being visible and none of the others.

Example 4: HPV target gene detection and subtype discrimination in cervical swab sample

1.1 sample preparation

Using each subtype HPV positive cervical swab sample CS1-CS6, the swab was placed in a 1.5mL tube containing 0.5mL PBS, thoroughly mixed and centrifuged again, 200 μl of supernatant was taken, pretreated nucleic acid was obtained using a rapid nucleic acid release agent, and 10 μl was taken for one-step isothermal amplification-Cpf 1 detection.

1.2 one-step isothermal amplification-Cpf 1 reaction

1.3 detection of immune colloidal gold test strip

All products in the step of isothermal amplification-Cpf 1 reaction by a 1.2 one-step method are added to an immune colloidal gold test strip sample adding point, incubated for 10 minutes at room temperature, and the detection result is shown in a schematic diagram of figure 6, and positive strips are visible only when the test strip corresponding to an HPV template is added to each HPV subtype specific crRNA on the premise that a quality control line is established, and no strips are visible for the rest templates.

Example 5: HPV target gene detection and subtype discrimination in anal swab sample

1.1 nucleic acid preparation

Using HPV positive anal swab samples AS1-AS6 of each subtype, placing the swab in a 1.5mL tube containing 0.5mL PBS, thoroughly mixing, centrifuging again, taking 200 μl of supernatant, using a rapid nucleic acid releasing agent to obtain pretreated nucleic acid, taking 10 μl for one-step isothermal amplification-Cpf 1 detection.

1.2 one-step isothermal amplification-Cpf 1 reaction

10. Mu.L of the "1.1 sample preparation" step sample was added to the isothermal amplification reaction chamber and incubated at 39℃for 10 minutes. Then automatically sucking 20 mu L of the Cpf1 reaction cavity to the Cpf1 reaction cavity through a control point of the reaction plate, and regulating the temperature to 37 ℃ for reaction for 15 minutes to obtain a Cpf1 reaction product; wherein the isothermal amplification reaction chamber and the Cpf1 detection reaction chamber are the isothermal amplification reaction chamber and the Cpfl detection reaction chamber of step (3) in example 1.

1.3 fluorescence detection by enzyme-labeled instrument

The product of the "1.2 one-step isothermal amplification-Cpf 1 reaction" step was used for fluorescence assay (FIG. 7), with only the reaction units added with the corresponding templates for each HPV subtype-specific crRNA being visible and none of the others.

Example 6: HPV target gene detection and subtype discrimination in serum samples

1.1 nucleic acid preparation

Using HPV positive blood samples B1-B6 of each subtype, after serum precipitation, 200. Mu.l of serum was aspirated and placed in a 1.5ml EP tube, and pretreated nucleic acid was obtained using a rapid nucleic acid release agent, taking 10. Mu.l for one-step isothermal amplification-Cpf 1 detection.

1.2 one-step isothermal amplification-Cpf 1 reaction

1.3 detection of immune colloidal gold test strip

All products in the step of isothermal amplification-Cpf 1 reaction by a 1.2 one-step method are added to an immune colloidal gold test strip sample adding point, incubated for 10 minutes at room temperature, and the detection result is shown in a schematic diagram of figure 8, and positive strips are visible only when the test strip corresponding to an HPV template is added to each HPV subtype specific crRNA on the premise that a quality control line is established, and no strips are visible for the rest templates.

Claims

1. The target for the rapid genotyping detection of the human papillomavirus nucleic acid is characterized by being a target combination consisting of six sequences, wherein the nucleotide sequence of the target combination is shown as SEQ ID NO. 19-SEQ ID NO. 24.

2. A primer combination for rapid genotyping detection of human papillomavirus nucleic acids, comprising:

3. A crRNA combination for rapid genotyping detection of human papillomavirus nucleic acids, the crRNA combination comprising:

HPV 6-specific crRNA with the sequence shown in SEQ ID NO.13,

HPV 11-specific crRNA with the sequence shown in SEQ ID NO.14,

HPV16 specific crRNA with the sequence shown in SEQ ID NO.15,

HPV 18-specific crRNA with the sequence shown in SEQ ID NO.16,

HPV 31-specific crRNA with the sequence shown in SEQ ID NO.17,

HPV 33-specific crRNA with the sequence shown in SEQ ID NO. 18.

4. The kit for the rapid genotyping detection of the human papilloma virus nucleic acid is characterized by comprising an isothermal amplification system, a Cpf1 detection system, an enzyme-labeled instrument fluorescence detection system or an immune colloidal gold test strip detection system;

the isothermal amplification system comprising the primer combination according to claim 2 as isothermal amplification primer,

the Cpf1 assay system comprising the crRNA combination of claim 3,

5. The kit of claim 4, wherein the Cpfl detection system further comprises a Cpfl protein, a ssDNA reporter system comprising ssDNA FQ reporter for enzyme-labeled instrument fluorescence detection and/or ssDNA DB reporter for immune colloidal gold strip detection.

6. The kit of claim 5, wherein the ssDNA FQ reporter,5 'end-labeled fluorescent group is 6-FAM and the 3' end-labeled quenching group is BHQ1 for fluorescence detection by an enzyme-labeled instrument; ssDNA DB reporter for fluorescence detection of the enzyme-labeled instrument, wherein the fluorescent group marked at the 5 'end is digoxin, and the quenching group marked at the 3' end is biotin.

7. A detection method for rapid typing of human papillomavirus nucleic acid, comprising the steps of:

(1) Preparing human papillomavirus nucleic acid;

(2) Isothermal amplification by a one-step method and Cpf1 detection: amplifying the human papillomavirus nucleic acid obtained in the step (1) in an RPA isothermal amplification system by using the primer combination in the claim 2, automatically detecting Cpf1 by the amplified product, and reacting to obtain a Cpf1 detection product;

8. The method according to claim 7, wherein the amplification conditions are 39℃for 10 minutes; the Cpf1 assay conditions were 37℃for 15 minutes.