CN116286979A

CN116286979A - Plasmid and cell for expressing reverse transcriptase and RNA sequence and application thereof

Info

Publication number: CN116286979A
Application number: CN202310209658.2A
Authority: CN
Inventors: 叶茂; 张毅彬; 言惠文
Original assignee: Changsha Zhongjian Technology Co ltd
Current assignee: Changsha Zhongjian Technology Co ltd
Priority date: 2023-03-07
Filing date: 2023-03-07
Publication date: 2023-06-23

Abstract

The invention discloses a plasmid and a cell for expressing reverse transcriptase and RNA sequences and application thereof, wherein the expression plasmid constructed with the reverse transcriptase sequences and target nucleic acid aptamer coding sequences is transfected into eukaryotic cells, and target DNA nucleic acid aptamers can be continuously produced in the cells to produce functional DNA nucleic acid aptamers. The invention provides a novel method and tool for synthesizing and producing DNA aptamer, and has wide application prospect.

Description

Plasmid and cell for expressing reverse transcriptase and RNA sequence and application thereof

Technical Field

The invention belongs to the technical field of biomedicine, and relates to plasmids and cells for expressing a nucleic acid aptamer and application thereof.

Background

The aptamer is ssDNA or RNA oligonucleotide, can be selectively combined with target molecules, and is selected from a library through the evolution of a SELEX system. ssDNA aptamer is a single-stranded DNA that binds to a cell membrane surface or intracellular molecule, and thus can regulate intracellular processes.

At present, the synthesis of the aptamer mainly depends on chemical solid phase synthesis, however, the high cost of large-scale synthesis and the low success rate of synthesis of long single-stranded DNA aptamer limit the application of the aptamer. Because the cell and other biological carriers can be cultured relatively cheaply and can be self-replicated, the method is an ideal production system, and is similar to the cell for replicating the self-chromosomal DNA and the virus-replicated nucleic acid, the cell has the biological property of synthesizing the DNA in large quantities, so that the cell is utilized for producing the ssDNA and the ssDNA nucleic acid aptamer in batches, and the method can greatly reduce the synthesis cost.

Disclosure of Invention

The primary object of the present invention is to develop a plasmid capable of expressing reverse transcriptase and RNA sequence in cells, wherein the DNA sequence of the expression cassette segment contains the gene sequence of reverse transcriptase and the DNA aptamer coding sequence.

Further, the DNA sequence of the expression cassette segment contains four sequences linked in sequence: a gene sequence of reverse transcriptase, a stem-loop structural sequence, a DNA aptamer coding sequence and a reverse transcriptase primer binding region sequence.

The expression frame region end in the recombination site of the plasmid in the invention sequentially comprises a gene sequence of reverse transcriptase (RT, reverse transcriptase), a stem-loop structure Sequence (SL), a target nucleic acid aptamer coding sequence (SOA, coding sequence of the DNA aptamer) and a reverse transcriptase primer binding region (PBS, primer binding site) from 5 'to 3', and different nucleic acid aptamer coding sequences can be constructed into the plasmid sequence in the nucleic acid aptamer coding sequence section (SOA section) so as to express and generate different nucleic acid aptamers.

It is a second object of the present invention to provide a cell comprising the above plasmid.

Further, the cell is a eukaryotic cell that continuously expresses reverse transcriptase and an RNA sequence. DNA nucleic acid aptamers are continually produced and expressed in cells.

The process of generating mRNA by transcription and ssDNA by reverse transcription is shown in figure 3, when a plasmid vector mediates the transcription process of a cell to a plasmid through EF1 alpha promoter sequence, reverse transcriptase, stem loop sequence, target DNA aptamer coding sequence and reverse transcriptase primer binding site can be sequentially transcribed to generate corresponding mRNA sequence, the ribosome starts the translation process to the mRNA through the processes of recognition of the 5' -end cap structure of the ribosome and the mRNA, peptide segment sequence for coding reverse transcriptase is generated, and the translation process is stopped after the reverse transcriptase sequence is translated. At the same time, tRNA can be paired with PBS region at 3' end of mRNA, and then the generated reverse transcriptase can be led to reverse transcription process from 3' end to 5' end of mRNA, so that the RNA sequence of SOA region on mRNA can be reverse transcribed into ssDNA, and said reverse transcription process can be blocked by SL sequence, and RNase H activity of reverse transcriptase can result in mRNA degradation so as to produce ssDNA aptamer.

After the plasmid is transfected into eukaryotic cells by means of a transfection reagent or a lentiviral vector, the stably transfected cell lines can be screened by puro resistance genes and puromycin, or positive cell populations with EGFP green fluorescence can be sorted by flow cytometry, so that cell lines which continuously express reverse transcriptase and ssDNA nucleic acid aptamers can be obtained.

A third object of the present invention is to provide the use of said plasmid for the preparation of DNA aptamer.

A fourth object of the invention is to provide the use of said cells for the preparation of DNA aptamer.

The conventional ssDNA aptamer plays a role in recognition by a method of combining cell membrane surface proteins, so that the cell interior is difficult to access to recognize cell interior protein targets, and the conventional ssDNA aptamer is prepared by a chemical synthesis method, so that a more economical and large-scale synthesis and production method mode is lacked. In the invention, through a plasmid vector for encoding reverse transcriptase, mRNA with a reverse complementary nucleic acid aptamer sequence transcribed from the plasmid can be reversely transcribed into forward ssDNA, the ssDNA aptamer is generated in cytoplasm, a stably transfected cell strain can be screened out through a puromycin screening system, and the ssDNA aptamer can be continuously generated as a mode for producing the ssDNA aptamer by utilizing a biological system. Meanwhile, if the target of the aptamer expressed in the cell is positioned in cytoplasm, the aptamer can be targeted to bind with the protein target, wherein certain aptamers also have the capability of regulating and controlling the activity of target protein, further influence the downstream signal path of the protein, finally regulate and control the biological activity of the cell, and can be used as a novel means to provide a treatment method for tumors and other human diseases.

A fifth object of the present invention is to provide the use of said plasmid for the preparation of a DNA aptamer preparation that binds specifically to a protein target in cells.

A sixth object of the invention is to provide the use of said cells for the preparation of a DNA aptamer preparation for intracellular binding of a specific recognition protein target.

The invention is characterized in that:

a plasmid vector with a reverse transcriptase gene sequence, a stem-loop structure sequence, a target nucleic acid aptamer coding sequence and a reverse transcriptase primer binding region is constructed, the plasmid vector can be transfected into eukaryotic cells in a transfection reagent or lentivirus infection mode, after the cells transcribe plasmids, all DNA sequences at the ends of the plasmid expression frame region can be transcribed into corresponding mRNA sequences, then in the translation process, a ribosome translates the segment of mRNA encoding reverse transcriptase into reverse transcriptase protein, the reverse transcriptase protein starts reverse transcription on the 3' -end of mRNA under the guidance of mRNA pairing of tRNA and PBS regions in the cells, RNA bases of the nucleic acid aptamer region in the reverse transcriptase protein are reversely transcribed into ssDNA, and the reverse transcription process is stopped due to the repression of the stem-loop sequence, so that ssDNA nucleic acid aptamers are formed.

The aptamer is a nucleic acid molecular probe with antibody-like recognition function, has the characteristics of small molecular weight, good thermal stability, easy chemical modification, low immunogenicity, wide target types and the like, can target the enzyme activity key site of protease or the interaction site of ligand-protein receptor, and can inhibit or activate the activity of protease or block the interaction of protein receptor and ligand, thereby regulating the activity of the protein and downstream protein signal path and finally influencing the cell proliferation, period and other phenotypes. The plasmid can express reverse transcriptase, and the RNA sequence of the corresponding aptamer in mRNA is subjected to reverse transcription by the reverse transcriptase to obtain the ssDNA aptamer with binding or regulatory protein activity.

In summary, the ssDNA aptamer expression system based on the reverse transcription technology can be used for continuously producing ssDNA aptamers in eukaryotic cells, and the expressed aptamers have the capability of specifically recognizing target proteins, and can further regulate the biological activity of the cells by regulating the activity of the target proteins through certain aptamers.

Drawings

FIG. 1 is a full-length map of a plasmid according to the present invention;

FIG. 2 is a schematic diagram of a plasmid expression cassette segment;

FIG. 3 is a schematic diagram of plasmid transcription translation to reverse transcriptase and reverse transcription to produce ssDNA;

FIG. 4 is a schematic representation of the construction of a plasmid expression cassette segment and the construction of the expression cassette segment into a plasmid and agarose electrophoresis verification;

FIG. 5 shows a plasmid map and agarose electrophoresis verification after endonuclease cleavage of the plasmid;

FIG. 6 shows EGFP fluorescence signals observed using an immunofluorescence microscope to detect levels of transfection of plasmids expressing XQ2 and Ra1, respectively, after transfection of the plasmids into HEK293 cells using a transfection reagent;

FIG. 7 shows the detection of reverse transcriptase mRNA expression in HEK293 cells following transfection of plasmids using PCR and agarose gel electrophoresis;

FIG. 8 shows the production and expression levels of the nucleic acid aptamers XQ2 and Ra1 in HEK293 cells after transfection of 2 plasmids, respectively, using PCR and agarose gel electrophoresis detection;

FIG. 9 is a graph showing the persistence level of ssDNA nucleic acid aptamers generated in HEK293 cells using plasmid vectors in comparison to ssDNA nucleic acid aptamers synthesized in vitro by transfection;

FIG. 10 is a graph showing the detection of binding of Ra1 to RAS protein in HEK293 cells transfected with plasmids harboring Ra1 nucleic acid aptamers using CHIP assay;

FIG. 11 is a graph showing the binding specificity of Ra1 to RAS protein in HEK293 cells transfected with plasmids harboring an Ra1 aptamer using CHIP assay;

FIG. 12 is a graph showing comparative analysis of Ra1 aptamer synthesized in vitro by transfection and RAS protein downstream signaling pathway protein activity after transfection of Ra 1-expressing plasmids using WB technique;

FIG. 13 is a graph showing cell cycle arrest in HEK293 cells transfected with Ra1 expressing plasmids using flow cytometry;

FIG. 14 shows the proliferation potency of HEK293 cells transfected with Ra 1-expressing plasmids using the CCK8 method;

FIG. 15 is a graph showing the activity of RAS protein downstream signaling pathway protein in H1299, A549 cells infected with Ra 1-expressing lentivirus using WB technique;

FIG. 16 shows the proliferation potency of H1299 and A549 cells infected with Ra 1-expressing lentiviruses using the CCK8 method.

Detailed Description

The following examples are intended to further illustrate the invention, but not to limit it.

The pUC19 plasmid (commercial available: yun Zhou organism) is preferred in the present invention, but the present invention is not limited to this plasmid, and a vector capable of smoothly expressing a reverse transcriptase and a DNA aptamer coding sequence in a cell may be used.

The preferred gene sequences of the reverse transcriptase (RT, reverse transcriptase) of the invention are:

5’-ATGGGACCAATGGGGCAGCCCCTGCAAGTGTTGACCCTAAATATAGAAGATGAGCATCGGCTACATGAGACCTCAAAAGAGCCAGATGTTTCTCTAGGGTCCACATGGCTGTCTGATTTTCCTCAGGCCTGGGCGGAAACCGGGGGCATGGGACTGGCAGTTCGCCAAGCTCCTCTGATCATACCTCTGAAAGCAACCTCTACCCCCGTGTCCATAAAACAATACCCCATGTCACAAGAAGCCAGACTGGGGATCAAGCCCCACATACAGAGACTGTTGGACCAGGGAATACTGGTACCCTGCCAGTCCCCCTGGAACACGCCCCTGCTACCCGTTAAGAAACCAGGGACTAATGATTATAGGCCTGTCCAGGATCTGAGAGAAGTCAACAAGCGGGTGGAAGACATCCACCCCACCGTGCCCAACCCTTACAACCTCTTGAGCGGGCTCCCACCGTCCCACCAGTGGTACACTGTGCTTGATTTAAAGGATGCCTTTTTCTGCCTGAGACTCCACCCCACCAGTCAGCCTCTCTTCGCCTTTGAGTGGAGAGATCCAGAGATGGGAATCTCAGGACAATTGACCTGGACCAGACTCCCACAGGGTTTCAAAAACAGTCCCACCCTGTTTGATGAGGCACTGCACAGAGACCTAGCAGACTTCCGGATCCAGCACCCAGACTTGATCCTGCTACAGTACGTGGATGACTTACTGCTGGCCGCCACTTCTGAGCTAGACTGCCAACAAGGTACTCGGGCCCTGTTACAAACCCTAGGGAACCTCGGGTATCGGGCCTCGGCCAAGAAAGCCCAAATTTGCCAGAAACAGGTCAAGTATCTGGGGTATCTTCTAAAAGAGGGTCAGAGATGGCTGACTGAGGCCAGAAAAGAGACTGTGATGGGGCAGCCTACTCCGAAGACCCCTCGACAACTAAGGGAGTTCCTAGGGACGGCAGGCTTCTGTCGCCTCTGGATCCCTGGGTTTGCAGAAATGGCAGCCCCCTTGTACCCTCTCACCAAAACGGGGACTCTGTTTAATTGGGGCCCAGACCAACAAAAGGCCTATCAAGAAATCAAGCAAGCTCTTCTAACTGCCCCAGCCCTGGGGTTGCCAGATTTGACTAAGCCCTTTGAACTCTTTGTCGACGAGAAGCAGGGCTACGCCAAAGGTGTCCTAACGCAAAAACTGGGACCTTGGCGTCGGCCGGTGGCCTACCTGTCCAAAAAGCTAGACCCAGTAGCAGCTGGGTGGCCCCCTTGCCTACGGATGGTAGCAGCCATTGCCGTACTGACAAAGGATGCAGGCAAGCTAACCATGGGACAGCCACTAGTCATTCTGGCCCCCCATGCAGTAGAGGCACTAGTCAAACAACCCCCCGACCGCTGGCTTTCCAACGCCCGGATGACTCACTATCAGGCCTTGCTTTTGGACACGGACCGGGTCCAGTTCGGACCGGTGGTAGCCCTGAACCCGGCTACGCTGCTCCCACTGCCTGAGGAAGGGCTGCAACACAACTGCCTTGATATCCTGGCCGAAGCCCACGGAACCCGACCCGACCTAACGGACCAGCCGCTCCCAGACGCCGACCACACCTGGTACACGGATGGAAGCAGTCTCTTACAAGAGGGACAGCGTAAGGCGGGAGCTGCGGTGACCACCGAGACCGAGGTAATCTGGGCTAAAGCCCTGCCAGCCGGGACATCCGCTCAGCGGGCTGAACTGATAGCACTCACCCAGGCCCTAAAGATGGCAGAAGGTAAGAAGCTAAATGTTTATACTGATAGCCGTTATGCTTTTGCTACTGCCCATATCCATGGAGAAATATACAGAAGGCGTGGGTTGCTCACATCAGAAGGCAAAGAGATCAAAAATAAAGACGAGATCTTGGCCCTACTAAAAGCCCTCTTTCTGCCCAAAAGACTTAGCATAATCCATTGTCCAGGACATCAAAAGGGACACAGCGCCGAGGCTAGAGGCAACCGGATGGCTGACCAAGCGGCCCGAAAGGCAGCCATCACAGAGACTCCAGACACCTCTACCCTCCTCATAGAAAATTCATCACCCTACACCTCAGAACATTTTCATTACACAGTGACTGATATAAAGGACCTAACCAAGTTGGGGGCCATTTATGATAAAACAAAGAAGTATTGGGTCTACCAAGGAAAACCTGTGATGCCTGACCAGTTTACTTTTGAATTATTAGACTTTCTTCATCAGCTGACTCACCTCAGCTTCTCAAAAATGAAGGCTCTCCTAGAGAGAAGCCACAGTCCCTACTACATGCTGAACCGGGATCGAACACTCAAAAATATCACTGAGACCTGCAAAGCTTGTGCACAAGTCTAA-3’(SEQ ID NO.1)。

moloney murine leukemia virus (Moloney Murine Leukemia Virus) contains a reverse transcriptase (M-MLV Reverse Transcriptase) which has the enzymatic activity of synthesizing ssDNA on RNA and DNA hybridization templates, so that we use this property to construct the sequence of Moloney murine leukemia virus reverse transcriptase in plasmids, allowing eukaryotic cells to express this enzyme and continuously reverse transcribe the RNA sequence encoding the aptamer in the mRNA transcribed from the plasmid into ssDNA aptamer, we use this method to express the aptamer continuously in cells.

However, the present invention is not limited to the specific sequence of the above-mentioned reverse transcriptase, and all sequences which can smoothly reverse transcribe mRNA may be used.

The preferred stem-loop structural Sequences (SL) of the invention are:

5'-GGTCGGCGGCCTTGAAGAGCGGCCGCACTCACGATAGAGTGGGAGATGGGCGCGAGAAAGTGCGGCCGCTCTTCAAGGCCGCCGACC-3' (SEQ ID NO. 2), but is not limited to this particular sequence.

In the invention, the following aptamer coding sequences (SOA, codingsequence of the DNA aptamer) are taken as examples to verify the functions:

1. aptamer XQ-2:5'-ACCGACCGTGCTGGACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGCGAGCCTGGCG-3' (SEQ ID NO. 3)

XQ2 coding sequence: 5'-CGCCAGGCTCGCTCATAGTAACCCTACCATCTGAGTATCTGGCCAGCAGCCCCTAACCCTATGAGTCCAGCACGGTCGGT-3' (SEQ ID NO. 4)

2. Aptamer Ra1:5'-GGGAGCTCAGAATAAACGCTCAATCGTCGGATCGACGCGGTTTAGTGAGTGTGCGTGGTTCGACATGAGGCCCGGATC-3' (SEQ ID NO. 5)

Ra1 coding sequence: 5'-GATCCGGGCCTCATGTCGAACCACGCACACTCACTAAACCGCGTCGATCCGACGATTGAGCGTTTATTCTGAGCTCCC-3'; (SEQ ID NO. 6)

Other nucleic acid aptamers can also be prepared using the expression system of the invention.

Preferred reverse transcriptase primer binding regions (PBS, primer binding site) of the invention are: 5'-TGGGGGCTCGTCCGGGAT-3' (SEQ ID NO. 7), but is not limited to this sequence, and can be any sequence that can bind smoothly to a reverse transcriptase primer.

Preferred eukaryotic cells of the invention are HEK293 and lung cancer cells H1299, A549, but are not limited to such cells.

Example 1 construction of plasmid expression cassette segment sequences and verification

The expression cassette sequences were divided into fragments 1-3 3 by the commission company and synthesized (fig. 4A), the length of each fragment was verified by agarose gel electrophoresis (fig. 4B), and then assembled into complete expression cassette sequences by Golden gate cloning in sequence, wherein EcoRI and XmaI cleavage sites were used for cleavage and construction of the aptamer coding sequence of interest. Plasmid construction was completed by cloning the promoters and expression cassettes carried by pDown and pUC into the final vector pUC19 by LR reaction (fig. 4C).

Example 2 endonucleases the constructed plasmid was digested and verified by agarose electrophoresis.

The plasmid contained 2 AgeI and 3 ApaLI cleavage sites, and restriction enzymes were used for cleavage. The ep tube was charged with reaction buffer, distilled water, plasmid, endonuclease ApaLI and AgeI, reacted at 37℃for 2 hours and heated at 85℃for 15 seconds. After completion of the cleavage reaction, the reaction product was subjected to agarose gel electrophoresis to detect the corresponding DNA band. 5 clones were selected for cleavage verification, and the results are shown in FIG. 5, and clone No. 1 was correctly cleaved.

Example 3 detection of plasmid transfection efficiency

Cell source: HEK293 cells used in this experiment were from the cell bank of the Shanghai department of science.

The coding sequences of the aptamer XQ2 and Ra1 are inserted into the SOA region of the expression vector, and the XQ2 expression plasmid pla-XQ2 and the Ra1 expression plasmid pla-Ra1 are constructed. HEK293 cells were inoculated in 12 well plates to 80% density, DNA-LipoMax complexes were prepared according to the LipoMax reagent Specification recommended system, and 1ug vector blank vector, pla-XQ2, and pla-Ra1 plasmids were transfected into the cells, respectively. After 24 hours, the cell imager was used to observe, and the obvious EGFP fluorescence was detected and photographed under a 4-fold mirror, and the results are shown in FIG. 6, in which the blank vector, the pla-XQ2 plasmid, and the pla-Ra1 plasmid all had higher transfection efficiency.

EXAMPLE 4 reverse transcription PCR method for detecting mRNA expression level of reverse transcriptase

HEK293 cells are inoculated into a 12-well plate to 80% density, a DNA-LipoMax complex is prepared according to a LipoMax reagent instruction manual recommended system, 1ug of blank control vector, pla-XQ2 and pla-Ra1 plasmids are respectively transfected into the cells, and RNA is extracted by an RNA extraction kit after 24 hours. Primer sequence: RT mRNA-F:5'-GGAACCCGACCCGACCTA-3' (SEQ ID NO. 8), RT mRNA-R:5'-TACCTCGGTCTCGGTGGT-3' (SEQ ID NO. 9).

The RNA was reverse transcribed to give cDNA, which was subjected to PCR using the above primers, and agarose gel electrophoresis of the PCR product to detect the corresponding DNA bands, and as a result, mRNA of reverse transcriptase was expressed in the blank vector, pla-XQ2, and pla-Ra1 plasmids as shown in FIG. 7.

Example 5 detection of nucleic acid aptamer expressed in cells after plasmid transfection

Preferably, the aptamer XQ2 and Ra1 are selected, HEK293 cells are inoculated in a 12-well plate to 80% density, expression vectors and plasmids with the 2 aptamer coding sequences are respectively transfected, DNA-lipoMax complex is prepared according to a lipoMax reagent instruction recommendation system, and 1ug of blank vector, pla-XQ2 and pla-Ra1 plasmids are respectively transfected into the cells. After 24 hours, RNA and ssDNA in the cells were extracted by TRIzol method, and RNA was digested with RNaseA to obtain ssDNA, followed by PCR and agarose gel electrophoresis with the corresponding primers. The primers were as follows:

XQ2-F:5’-GTCCTAAGGTAGCAGCTAGC-ACCGACCGTGCTGGACT-3’(SEQ ID NO.10)，

XQ2-R:5’-GGATAACAGGGTAATATCAG-CGCCAGGCTCGCTCAT-3’(SEQ ID NO.11)，

Ra1-F:5’-GTCCTAAGGTAGCAGCTAGC-GGGAGCTCAGAATAAAC-3’(SEQ ID NO.12)，

Ra1-R:5’-GGATAACAGGGTAATATCAG-GATCCGGGCCTCATG-3’(SEQ ID NO.13)。

the results of (the non-thickened portion is flanking sequence, the thickened portion is mating sequence, the PCR amplification product is 120bp and 118 bp) are shown in FIG. 8, the pla-XQ2 can express DNA aptamer XQ2, and the pla-Ra1 plasmid can express DNA aptamer Ra1.

Example 6 detection of expression persistence of plasmid-expressing aptamer and in vitro transfected aptamer

HEK293 cells were seeded in 4 12-well plates, 2 of which were transfected with in vitro synthesized XQ2 and Ra1, respectively, and the other 2 were transfected with plasmids expressing XQ2 and Ra1, respectively. According to Pepmute ^TM Preparing a transfection system according to the specification, transfecting the in vitro synthesized aptamer according to the final concentration of 200nM, and preparing DN according to the recommended system of LipoMax reagent specificationA-LipoMax complex, 1ugpla-XQ2 and pla-Ra1 plasmids were transfected into cells, respectively. Cell ssDNA was extracted on

days

1, 2, 3 after transfection, while cell genomic DNA was extracted with the kit. Subsequently, 1uLssDNA solution was used as a template for PCR with the corresponding nucleic acid aptamer primers. Taking 1uLssDNA solution as a template to carry out fluorescence quantitative PCR by using corresponding nucleic acid aptamer primers, simultaneously taking 1ul genome DNA solution as a template to carry out fluorescence quantitative PCR by using primers of housekeeping gene ACTIN, and taking ACTIN as an internal reference gene to carry out relative quantification on the expression quantity of the nucleic acid aptamer. The PCR products were subjected to agarose gel electrophoresis imaging, and the fluorescence quantitative results were counted, as shown in FIG. 9, and the aptamer content of the aptamer synthesized in vitro and transfected into the cells was drastically reduced within three days, and the aptamer content of the plasmid expression was sustained and remained stable within three days.

Example 7 chromatin immunoprecipitation technique to detect binding of RAS protein to expressed Ra1

HEK293 cells were seeded into 4 dishes to a density of 80%, and DNA-LipoMax complexes were prepared according to the LipoMax reagent Specification recommendations, each dish transfected with 8ug of aptamer expression plasmid pla-Ra1. After 24 hours, cells were fixed with formaldehyde, protein-DNA complexes in the crosslinked cells were lysed by RIPA lysate, the supernatant was centrifuged and split into two groups, one group immunoprecipitated with RAS antibody and Protein A/G agarose beads and one group immunoprecipitated with isotype control antibody IgG and Protein A/G agarose beads. The immunoprecipitates were subjected to protease digestion and DNA purification to obtain DNA solutions. PCR was performed using 5ul of DNA solution as a template and primers for the aptamer Ra1, and the PCR product was subjected to agarose gel electrophoresis and imaged, and the results are shown in FIG. 10. Ra1 was found in immunoprecipitates of RAS antibodies, whereas Ra1 was absent in immunoprecipitates of isotype control IgG antibodies, indicating that RAS proteins were able to bind plasmid-expressed Ra1 aptamers.

Example 8 chromatin immunoprecipitation technique to detect the specificity of binding of RAS proteins to expressed Ra1

HEK293 cells were seeded into A, B two groups of 4 dishes each to 80% density, group a transfected with the expression XQ2 plasmid and group B transfected with the expression Ra1 plasmid. The cell is fixed by formaldehyde, then the Protein is extracted, the A group Protein is divided into two parts, one part is immunoprecipitated by RAS antibody and Protein A/G agarose beads, the other part is immunoprecipitated by isotype control antibody IgG and Protein A/G agarose beads, and the immunoprecipitated matter is digested by protease and DNA is purified to obtain DNA solution. Group B proteins were treated similarly. The group A DNA solution was subjected to PCR with XQ2 primer, the group B DNA solution was subjected to PCR with Ra1 primer, and the PCR product was subjected to agarose gel electrophoresis and imaged, and the results are shown in FIG. 11. Group a RAS proteins were unable to bind plasmid-expressed XQ2, and group B RAS proteins were able to bind plasmid-expressed Ra1, indicating that RAS proteins specifically bind to expressed Ra1.

Example 9 comparison of Activity of RAS protein downstream Signal pathway in transfected Ra 1-expressing plasmid and transfected Ra 1-post-cell synthesized in vitro

HEK293 cells were seeded in 3 12-well plates, three of which were transfected with in vitro synthesized DNA library, XQ2 and Ra1, respectively, and the other 3 wells were transfected with expression vector, plasmid expressing XQ2 and Ra1, respectively. According to Pepmute ^TM The instructions are prepared into a transfection system, the in vitro synthesized DNA is transfected according to the final concentration of 200nM, the DNA-LipoMax complex is prepared according to the recommended system of LipoMax reagent instructions, and 1ug of blank control vector, pla-XQ2 and pla-Ra1 plasmids are respectively transfected into cells. Total cellular protein was extracted on

days

1, 2, and 3 post-transfection with RIPA lysates containing protease inhibitors and phosphatase inhibitors. SDS-PAGE electrophoresis and transfer of cell total protein, incubation of corresponding protein bands with GAPDH antibody, AKT antibody, phosphorylated AKT antibody, ERK1/2 antibody and phosphorylated ERK1/2 antibody, and development with HRP secondary antibody and ECL luminescence kit. As a result, as shown in FIG. 12, the in vitro synthesized Ra1 was able to inhibit RAS protein downstream signaling pathway activity on the first day, down-regulate the phosphorylation levels of AKT and ERK1/2, and the inhibitory effect was significantly decreased on the second and third days, while the Ra 1-expressing plasmid was able to down-regulate the phosphorylation levels of AKT and ERK1/2 in both the third day, indicating that the plasmid-expressing aptamer was able to continuously inhibit RAS protein downstream signaling pathway activity.

Example 10 detection of cell cycle changes in HEK293 cells transfected with Ra 1-expressing plasmids

HEK293 cells were seeded in 12-well plates to 80% density and transfected with control vehicle, XQ2 expression plasmid, ra1 expression plasmid, respectively. After 24 hours, cells were digested with pancreatin to single cell suspension, fixed with 70% ethanol, stained with propidium iodide staining solution, and the cell DNA content was determined by detecting fluorescence with a flow cytometer at an excitation wavelength of 488 nM. The cell cycle was analyzed in such a manner that the fluorescence intensity of the G0/G1 phase cells was 2N, the fluorescence intensity of the G2/M phase cells was 4N, and the fluorescence intensity of the S phase cells was 2N-4N. The statistical results are shown in fig. 13. The cell proportion in the G2/M phase is obviously increased after transfection of the plasmid expressing Ra1, which indicates that the plasmid expressing Ra1 can block the cell cycle of HEK293 cells in the G2/M phase.

Example 11 detection of changes in proliferation potency of HEK293 cells transfected with Ra 1-expressing plasmid

HEK293 cells were seeded in 12-well plates to 80% density, and the control vehicle, XQ2 expression plasmid, ra1 expression plasmid were transfected separately, and after 24 hours cells were digested with pancreatin to single cell suspensions, seeded in 96-well plates at a density of 2000 cells per well, and 4 plates were plated each time. After 4 hours, a plate was taken and incubated with 100uL of fresh medium containing 10% by volume CCK-8 for 0.5-4 hours until the color changed to orange, and the microplate reader was read with 450nm fluorescence without CCK-8 as background. 24 One plate was stained for CCK-8 after 48, 72 hours and incubated in an incubator at 37 ℃ for the same time and read by an microplate reader. The background was subtracted from the fluorescence value per well and the statistics were performed, and the results are shown in FIG. 14. After transfection of Ra1 expressing plasmids other than the control vector or XQ2 expressing plasmid, OD450 of HEK293 cells decreased significantly, indicating that Ra1 expressed by the plasmid inhibited proliferation capacity of HEK293 cells.

Example 12 detection of Activity of RAS protein downstream Signaling pathway in H1299, A549 cells after infection with Ra 1-expressing lentiviruses

The expression cassette segments on the XQ 2-expressing plasmid and the Ra 1-expressing plasmid were constructed into the lentivirus-purpose plasmid pLV-EF 1. Alpha. -IRES-EGFP (purchased from vast plasmid platform) and packaged into lentiviruses. H1299, a549 cells were seeded in 12-well plates to 50% density. The control lentivirus, XQ 2-expressing lentivirus, and Ra 1-expressing lentivirus were each added to the cells and screened by puromycin addition on day 3 post infection. The seventh day after infection, total cellular protein was extracted with RIPA lysate containing protease inhibitor and phosphatase inhibitor. SDS-PAGE electrophoresis and transfer of cell total protein, incubation of corresponding protein bands with GAPDH antibody, AKT antibody, phosphorylated AKT antibody, ERK1/2 antibody and phosphorylated ERK1/2 antibody, and development with HRP secondary antibody and ECL luminescence kit. The results are shown in FIG. 15. Activity of RAS protein downstream signaling pathway was inhibited in H1299, a549 cells after infection with Ra 1-expressing lentivirus, and levels of phosphorylated AKT, phosphorylated ERK1/2 were decreased.

Example 13 detection of changes in proliferation potency of H1299, A549 cells after infection with Ra 1-expressing lentiviruses

The expression cassette segments on the XQ2 expression plasmid and the Ra1 expression plasmid are constructed into plasmids of lentivirus purpose and packaged into lentiviruses. H1299, a549 cells were seeded in 12-well plates to 50% density. The control lentivirus, XQ 2-expressing lentivirus, and Ra 1-expressing lentivirus were each added to the cells and screened by puromycin addition on day 3 post infection. The screened cells were digested with pancreatin to single cell suspension, inoculated into 96-well plates at a density of 800 cells per well, and 8 plates were plated each time. After 4 hours, a plate was taken and incubated with 100uL of fresh medium containing 10% by volume CCK-8 for 0.5-4 hours until the color changed to orange, and the microplate reader was read with 450nm fluorescence without CCK-8 as background. Plates were taken daily for the next 7 days for CCK-8 staining, incubated in an incubator at 37℃for the same time, and read by an microplate reader. The background was subtracted from the fluorescence value per well and the statistics were performed. As a result, as shown in FIG. 16, the proliferation ability of H1299 and A549 cells was decreased after infection with the Ra 1-expressing lentivirus.

Claims

1. A plasmid for expressing reverse transcriptase and RNA sequences, characterized in that the DNA sequence of the expression cassette segment comprises the gene sequence of reverse transcriptase, the DNA aptamer coding sequence.

2. The plasmid of claim 1, wherein the DNA sequence of the expression cassette segment comprises a gene sequence for reverse transcriptase, a stem-loop structural sequence, a DNA aptamer coding sequence, and a reverse transcriptase primer binding region sequence.

3. A cell comprising the plasmid of claim 1 or 2.

4. The cell of claim 3, wherein the cell is a eukaryotic cell that continuously expresses reverse transcriptase and RNA sequences.

5. The cell of claim 3, wherein the DNA aptamer is produced and expressed continuously in the cell.

6. Use of the plasmid according to claim 1 or 2 for the preparation of DNA nucleic acid aptamers.

7. Use of a cell according to any one of claims 3-5 for the preparation of a DNA aptamer.

8. Use of the plasmid of claim 1 or 2 for the preparation of a DNA aptamer preparation that specifically binds to a protein target in a cell.

9. Use of a cell according to any one of claims 3-5 for the preparation of a DNA aptamer preparation that specifically binds to a protein target in a cell.