CN116286930A

CN116286930A - Genetically engineered bacterium for producing steroid drug precursor and application thereof

Info

Publication number: CN116286930A
Application number: CN202211559077.3A
Authority: CN
Inventors: 顾向忠; 袁辰阳; 叶如飞
Original assignee: Jiangsu Jiaerke Pharmaceutical Group Co ltd
Current assignee: Jiangsu Jiaerke Pharmaceutical Group Co ltd
Priority date: 2022-12-06
Filing date: 2022-12-06
Publication date: 2023-06-23

Abstract

The invention discloses a genetic engineering bacterium for producing steroid drug precursors and application thereof. Use of a deletion of genes including genes encoding a hydroxyacyl-coa dehydrogenase and/or a 3-sterone-9 a-hydroxylase a subunit in modulating the yield of a steroid producing precursor in a mycobacterium or modifying a mycobacterium that produces a steroid precursor. The 3-sterone-9 alpha-hydroxylase A and the hydroxyacyl-CoA dehydrogenase have important regulation and control effects in the process of converting mycobacterium into sterol. Meanwhile, the invention also constructs a genetic engineering bacterium for producing the steroid precursor, and the genetic engineering bacterium is inoculated into a culture medium taking sterol as a substrate for fermentation, so that the steroid precursor 21-hydroxy-20-methyl pregna-1, 4-diene-3-ketone with high purity and high yield can be obtained, and the genetic engineering bacterium can be used as a raw material for synthesizing steroid medicines such as prednisolone, prednisolone acetate and the like, thereby having potential and wide application value in industry.

Description

Genetically engineered bacterium for producing steroid drug precursor and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and in particular relates to a genetic engineering bacterium for producing steroid drug precursors and application thereof.

Background

Steroid drugs are widely used, including various medical applications such as anti-inflammatory and antiallergic treatments. The steroid medicines have larger market scale at present, become second most class medicines next to antibiotics, and have better market prospect. Two main synthetic routes of steroid medicines are provided, one is to take diosgenin as a raw material, generate intermediate dehydropregnenolone acetate through chemical synthesis, and then obtain medicines such as progesterone, hydrocortisone and the like through subsequent reactions; the chemical synthesis is mainly adopted in the route, but the reaction route is long, the yield is low, the environment is polluted, and the production cost is high. The other route is that the phytosterol is taken as a raw material, and is converted into different steroid precursors, such as steroid precursors of androstane-4-alkene-3, 17-dione (AD), 1, 4-androstadiene-3, 17-dione (ADD), 9 alpha hydroxyl androstane-4-alkene-3, 17-dione (9 alpha-OH-AD) and the like by utilizing the metabolism of microorganisms, and then the target steroid medicine is prepared by chemical synthesis. The raw materials of the route have stable sources, short reaction route, high yield, low production cost and more environmental protection, so the route is gradually the main flow process for producing steroid precursors at present. However, most steroid precursors converted by microorganisms in the steroid medicine industry are C19 steroids, and the development of the C22 steroids is limited by the lack of 21-hydroxy-20-methyl pregn-4-en-3-one (4-HP) and other steroid precursors, so that the development of the steroid medicine industry is limited.

Microorganisms such as mycobacteria have the ability to metabolize natural sterols such as sterols, and thus a variety of important steroid precursors can be obtained by controlling the activities of various enzymes during degradation of sterols by microorganisms. However, since sterol degradation is a multi-step reaction process involving multiple enzymes, and the mechanism of side chain metabolism is not well understood, only a few engineering strains capable of producing AD, ADD, 9 alpha-OH-AD, 4-HP, testosterone and other steroid precursors are constructed at present, and the requirements of the industry can not be met.

21-hydroxy-20-methyl pregna-1, 4-diene-3-ketone, the English name is 21-hydroxy-20-methyl-pregna-1,4-dien-3-one (1, 4-HP for short), which is a novel C22 steroid precursor. Because the C1-C2 position of the 1,4-HP is double bond, and the C17 side chain maintains the side chain structure similar to that of corticoids, compared with the traditional C19 steroid precursors (ADD, 9 alpha-OH-AD and the like), the 1,4-HP is more suitable to be used as the steroid precursors for synthesizing corticoid steroid drugs such as prednisolone and the like. Therefore, the development of 1,4-HP producing strain is of great significance in promoting the innovation of traditional steroid drug producing system. However, the yield, purity and conversion rate of the strain for producing 1,4-HP are not satisfactory, and more byproducts exist in the production process, which makes the subsequent separation and purification difficult.

Therefore, it is an urgent need in the steroid medicine industry to obtain a good strain that can convert sterols to steroid precursors, especially 1,4-HP, with high efficiency and specificity.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, an object of the present invention is to provide a genetically engineered bacterium for producing steroid drug precursors and use thereof, in order to solve the problems of the prior art.

In order to achieve the above purpose, the present invention adopts the following technical scheme.

The invention provides in a first aspect the use of a gene encoding a hydroxyacyl-coa dehydrogenase and/or a gene encoding a 3-sterone-9α -hydroxylase a subunit in modulating the yield of or engineering a mycobacterium of a steroid producing precursor. It has been unexpectedly found by research that knocking out the gene encoding the hydroxyacyl-coa dehydrogenase and/or the 3-sterone-9α -hydroxylase a subunit increases yield of mycobacterial steroid-producing precursors, in particular 21-hydroxy-20-methylpregna-1, 4-dien-3-one (1, 4-HP).

According to the technical scheme of the invention, the gene for encoding the A subunit of the 3-sterone-9 alpha-hydroxylase is at least one of the following A1) -A4);

a1 The gene is kshA1; the nucleotide sequence of kshA1 comprises a sequence shown in SEQ ID NO. 1;

A2 The gene is kshA2; the nucleotide sequence of kshA2 comprises the sequence shown in SEQ ID NO. 2;

a3 The gene is kshA3; the nucleotide sequence of kshA3 comprises a sequence shown as SEQ ID NO. 3;

a4 A nucleotide sequence which has 60% or more homology with the nucleotide sequence defined by the sequence shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3 and codes for the A subunit of the 3-sterone-9 alpha-hydroxylase.

According to the technical scheme of the invention, the gene for encoding the hydroxy acyl-CoA dehydrogenase is B1) or B2) as follows;

b1 The gene is hsd4A; the nucleotide sequence of hsd4A comprises the sequence shown in SEQ ID NO. 4;

b2 A nucleotide having 60% or more homology with the nucleotide sequence defined by the sequence shown in SEQ ID No.4 and encoding the hydroxyacyl-CoA dehydrogenase.

According to the technical scheme of the invention, the gene also comprises a coding 3-sterone-delta ¹ -one or more of the genes for dehydrogenase, NADH oxidase and/or peroxidase. Overexpression of the coding-sterone-delta ¹ Genes for dehydrogenases, NADH oxidases and/or peroxidases increase the yield of steroid-producing precursors of Mycobacteria.

Preferably, the said encoding 3-sterone-delta ¹ The genes for dehydrogenases are C1) or C2) as follows;

c1 The coding gene is kstd; the nucleotide sequence of kstd comprises a sequence shown as SEQ ID NO. 5;

c2 A nucleotide sequence defined by the sequence shown in SEQ ID No.5 has 60% or more homology with the nucleotide sequence shown in SEQ ID No.5 and encodes 3-sterone-delta as shown in the specification ¹ -nucleotides of a dehydrogenase.

Preferably, the 3-sterone-delta ¹ -the dehydrogenase is derived from actinomycetes.

More preferably, the actinomycetes are selected from one or more of rhodococcus, nocardia and mycobacterium. In a preferred embodiment, the 3-sterone- Δ ¹ The dehydrogenase is derived from Mycobacterium neoaurum DSM 44074.

Preferably, the overexpressing 3-sterone- Δ1-dehydrogenase is performed by inserting a gene encoding 3-sterone- Δ1-dehydrogenase into plasmid A and then introducing the gene into the genetically engineered bacterium.

More preferably, the plasmid A is selected from pMV306hsp.

Preferably, the gene encoding NADH oxidase is at least one of the following D1) -D2);

d1 A) the coding gene is nox; the nucleotide sequence of the nox comprises a sequence shown as SEQ ID NO. 6;

d2 A nucleotide sequence having 60% or more homology with the nucleotide sequence defined by the sequence shown in SEQ ID No.6 and encoding the NADH oxidase.

Preferably, the NADH oxidase is derived from Bacillus.

More preferably, the NADH oxidase is derived from Bacillus subtilis Bacillussubtilis ATCC 6051a.

Preferably, the overexpression of NADH oxidase is performed by inserting a gene encoding the NADH oxidase into a plasmid B and then introducing the gene into the genetically engineered bacterium.

More preferably, the plasmid B is selected from pMV306hsp.

Preferably, the gene encoding peroxidase is at least one of the following E1) -E2);

e1 The coding gene is kate; the nucleotide sequence of kate comprises a sequence shown as SEQ ID NO. 6;

e2 A nucleotide sequence having 60% or more homology with the nucleotide sequence defined by the sequence shown in SEQ ID No.6 and encoding the peroxidase.

Preferably, the peroxidase is derived from actinomycetes.

More preferably, the actinomycetes are selected from one or more of rhodococcus, nocardia and mycobacterium. In a certain preferred embodiment, the peroxidase is derived from Mycobacterium neoaurum DSM 44074.

According to the technical scheme of the invention, the steroid precursor is 21-hydroxy-20-methyl pregna-1, 4-diene-3-ketone.

According to the technical scheme of the invention, the mycobacterium is selected to be new golden mycobacterium. Specifically Mycobacterium neoaurum DSM 44074.

The present invention has been found by accident that after knocking out the gene encoding 3-sterone-9 alpha-hydroxylase in mycobacteria, phytosterols can be metabolized into 1, 4-Androstenedione (ADD), androstenedione (AD), 21-hydroxy-20-methyl pregna-1, 4-dien-3-one (1, 4-HP) and 21-hydroxy-20-methyl pregna-4-en-3-one (4-HP), but the purity of 1,4-HP is only 8.95%. After the gene encoding the hydroxyacyl-CoA dehydrogenase is continuously knocked out, the purity of the 1,4-HP produced by converting the plant sterol by the strain is improved to 89.7%, and the yield of the 1,4-HP can reach 0.59g/L; performing anaplement function verification by anaplementing the hydroxyacyl-coa dehydrogenase into mycobacterium which knocks out the hydroxyacyl-coa dehydrogenase and the 3-sterone-9α -hydroxylase, and finding that anaplerotic strain of the hydroxyacyl-coa dehydrogenase can metabolize phytosterols into ADD, AD, 1,4-HP and 4-HP, wherein the purity of 1,4-HP is 9.02%; it is comprehensively described that 3-sterone-9 alpha-hydroxylase and hydroxyacyl-CoA dehydrogenase have important regulation and control effects in the process of converting mycobacteria into sterols, 3-sterone-9 alpha-hydroxylase and hydroxyacyl-CoA dehydrogenase are key genes for generating steroid precursors, especially 1,4-HP, for mycobacteria, and 3-sterone-9 alpha-hydroxylase genes and hydroxyacyl-CoA dehydrogenase genes are mutually coordinated, so that the purity of 1,4-HP is greatly improved.

Further, the inventors found that 3-sterone-delta was overexpressed in mycobacteria knocked out of 3-sterone-9 alpha-hydroxylase and hydroxyacyl-CoA dehydrogenase ¹ After the dehydrogenase, the purity of the plant sterol produced by the transformation of the strain is improved to 95.2%, and the accumulation of the byproduct 4-HP is further inhibited.

Further, the inventors found that knocking out 3-sterone-9α -hydroxylase and hydroxyacyl-CoA dehydrogenase and overexpressing 3-sterone- Δ ¹ The overexpression of NADH oxidase and/or peroxidase genes in the strain of dehydrogenase genes can further increase the ability of the strain to convert phytosterols and the conversion rate of 1,4-HP can be further increased.

In a second aspect of the present invention, there is provided a steroid precursor-producing genetically engineered bacterium obtained by knocking out genes encoding 3-sterone-9 a-hydroxylase and hydroxyacyl-coa dehydrogenase in mycobacterium.

The third aspect of the present invention provides the use of a genetically engineered bacterium as described above for the preparation of 21-hydroxy-20-methyl pregna-1, 4-dien-3-one.

In a fourth aspect of the present invention, there is provided a process for the preparation of 21-hydroxy-20-methylpregna-1, 4-dien-3-one comprising the steps of: genetically engineered bacteria as described above convert sterols to 21-hydroxy-20-methylpregna-1, 4-dien-3-one.

According to the technical scheme of the invention, the genetically engineered bacterium is used for fermenting a culture medium containing sterols to obtain the 21-hydroxy-20-methyl pregna-1, 4-dien-3-one.

Preferably, the sterols are selected from one or both of cholesterol or phytosterols.

More preferably, the sterol is a phytosterol. The plant sterol is selected from one or more of beta-sitosterol, campesterol and stigmasterol. Preferably, the plant sterol is a mixture of β -sitosterol, campesterol and stigmasterol. Specifically, the mass ratio of the beta-sitosterol, campesterol and stigmasterol is 45:37:18.

preferably, the temperature of the fermentation is 25-40 ℃.

More preferably, the fermentation temperature may be 25 to 32 ℃, 29 to 37 ℃, or 36 to 40 ℃. In a certain preferred embodiment, 30 ℃.

Preferably, the fermentation time is 70-200 hours. More preferably 120 to 200 hours. In a certain preferred embodiment, 168h.

Preferably, the pH of the fermentation is between 6 and 8.

More preferably, the pH of the fermentation may be from 6 to 7.1, or from 6.8 to 7.5, and even more preferably from 7 to 8, or from 7.4 to 8. In a preferred embodiment, 7.5.

Preferably, the genetically engineered bacteria are inoculated into a seed culture medium for culture to obtain a seed culture solution; and then inoculating the seed culture solution into a culture medium containing sterols for fermentation to obtain the 21-hydroxy-20-methyl pregna-1, 4-dien-3-one.

More preferably, the seed medium comprises 0.6g/L dipotassium hydrogen phosphate, 5.4g/L sodium nitrate, 6g/L glucose and 15g/L yeast extract; the pH of the seed medium was 7.5. Further preferably, the temperature of the culture is 30 ℃. Further preferably, the time of the cultivation is 48 hours.

Preferably, the fermentation medium containing sterols comprises 5-25 g/L carbon source, 5-20 g/L nitrogen source, 0-1 g/L magnesium sulfate, 0-1 g/L ammonium nitrate, 0-5 g/L citric acid, 0-5 ml/L emulsifier and 1-10 g/L sterols.

Further preferably, the carbon source is selected from one or more of glucose, glycerol and citric acid.

Further preferably, the nitrogen source is selected from one or more of corn steep liquor, yeast extract, and diammonium phosphate.

More preferably, the emulsifier comprises tween-80 and hydroxypropyl beta-cyclodextrin.

Further preferably, the volume-mass ratio of the tween-80 to the sterol is (1-3) mL:1g. In a preferred embodiment 2mL:1g.

Further preferably, the mass ratio of the hydroxypropyl beta-cyclodextrin to the sterol is (0.5-2): 1. in a preferred embodiment 15:1.

preferably, the fermentation medium is 20g/L glucose, 12g/L diammonium phosphate, 2g/L dipotassium phosphate, 0.5g/L magnesium sulfate, 0.5g/L sodium nitrate, 3g/L citric acid, 2mL Tween-80, 1.5g/L hydroxypropyl-beta-cyclodextrin and 1g/L phytosterol; the pH of the fermentation medium was 7.5.

Further preferably, the temperature of the fermentation is 30 ℃.

Further preferably, the time of the cultivation is 168 hours.

Preferably, the inoculation amount of the genetically engineered bacterium is 0.05 to 0.15v/v% based on the total volume of the sterol-containing medium.

Preferably, the inoculation amount can be 0.05-0.09 v/v%, 0.08-0.12 v/v%, or 0.09-0.15 v/v%. In a preferred embodiment, 0.10v/v%.

In a fifth aspect the invention provides the use of 21-hydroxy-20-methylpregna-1, 4-dien-3-one as a starting material in the preparation of a steroid.

According to the technical scheme of the invention, the steroid medicine is selected from one or more of prednisolone and prednisolone acetate.

The genetically engineered bacterium of the invention can be used for fermenting sterol, can selectively degrade side chains of sterol, reduces the generation of byproduct 21-hydroxy-20-methyl pregna-4-en-3-one (4-HP), improves the production efficiency and quality of 21-hydroxy-20-methyl pregna-1, 4-diene-3-one (1, 4-HP), and is easy to separate and purify. The 1,4-HP obtained by fermenting sterol by the genetically engineered bacterium can be used as a raw material to prepare corticosteroid steroid medicines such as prednisolone, prednisolone acetate and the like.

Compared with the prior art, the invention has the following beneficial effects:

1) The genetically engineered bacterium disclosed by the invention can ferment sterol, inhibit the generation of a byproduct 21-hydroxy-20-methyl pregna-4-en-3-one (4-HP), and promote the generation of 21-hydroxy-20-methyl pregna-1, 4-diene-3-one (1, 4-HP).

2) The genetically engineered bacterium of the invention is used for fermenting sterol, and fermenting the phytosterol to generate 21-hydroxy-20-methyl pregna-1, 4-diene-3-ketone, wherein the conversion rate of converting the phytosterol into 21-hydroxy-20-methyl pregna-1, 4-diene-3-ketone is up to more than 82%, and the purity of the 21-hydroxy-20-methyl pregna-1, 4-diene-3-ketone is up to more than 95%.

Drawings

FIG. 1 shows a schematic diagram of the production of 1,4-HP by fermenting phytosterols with genetically engineered bacteria of the present invention.

FIG. 2 is a graph showing the time-dependent changes in the yield of a product obtained by fermenting phytosterol with the genetically engineered bacterium obtained in example 1 of the present application.

FIG. 3 is a graph showing the time-dependent changes in the 1,4-HP yield obtained by fermenting phytosterol with the genetically engineered bacterium obtained in example 2 of the present application.

FIG. 4 is a liquid phase analysis chart of the genetically engineered bacterium fermented plant sterol products obtained in example 1, example 2, and example 3 in this application example.

FIG. 5 is a graph showing the time-dependent changes in the 1,4-HP yield obtained by fermenting phytosterol with the genetically engineered bacterium obtained in example 4 of the present application.

FIG. 6 is a graph showing the time-dependent changes in the 1,4-HP yield obtained by fermenting plant sterols at different concentrations with the genetically engineered bacterium obtained in example 5 of the present application.

Detailed Description

Further advantages and effects of the present invention will become apparent to those skilled in the art from the disclosure of the present invention, which is described by the following specific examples.

Before the embodiments of the invention are explained in further detail, it is to be understood that the invention is not limited in its scope to the particular embodiments described below; it is also to be understood that the terminology used in the examples of the invention is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the invention. The test methods in the following examples, in which specific conditions are not noted, are generally conducted under conventional conditions or under conditions recommended by the respective manufacturers.

Where numerical ranges are provided in the examples, it is understood that unless otherwise stated herein, both endpoints of each numerical range and any number between the two endpoints are significant both in the numerical range. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, materials used in the embodiments, any methods, devices, and materials of the prior art similar or equivalent to those described in the embodiments of the present invention may be used to practice the present invention according to the knowledge of one skilled in the art and the description of the present invention.

The invention metabolizes phytosterol into 1, 4-Androstenedione (ADD), androstenedione (AD), 1,4-HP and 21-hydroxy-20-methyl pregna-4-en-3-one (4-HP) by knocking out genes encoding 3-sterone-9 alpha-hydroxylase in mycobacterium.

As a more preferred embodiment, the genetically engineered bacterium is obtained by knocking out 3 genes kshA1, kshA2, kshA3 encoding 3-sterone-9. Alpha. -hydroxylase A subunits and hsd4A encoding a hydroxyacyl-CoA dehydrogenase.

As a more preferred embodiment, the genetically engineered bacterium simultaneously overexpresses 3-sterone-. DELTA.by knocking out 3 genes kshA1, kshA2, kshA3 encoding 3-sterone-. DELTA.9. Alpha. -hydroxylase A subunits and hsd4A encoding a hydroxyacyl-CoA dehydrogenase gene ¹ The gene kstd of dehydrogenase is obtained.

As a more preferred embodiment, the genetically engineered bacterium simultaneously overexpresses 3-sterone-. DELTA.by knocking out 3 genes kshA1, kshA2, kshA3 encoding 3-sterone-. DELTA.9. Alpha. -hydroxylase A subunits and hsd4A encoding a hydroxyacyl-CoA dehydrogenase gene ¹ The gene kstd for dehydrogenase, the gene nox encoding NADH oxidase.

As a more preferred embodiment, the genetically engineered bacterium simultaneously overexpresses 3-sterone-delta by encoding 3 genes kshA1, kshA2, kshA3 knocked out of the A subunit of 3-sterone-9 alpha-hydroxylase and gene hsd4A encoding hydroxyacyl-CoA dehydrogenase ¹ The gene kstd for dehydrogenase, the gene nox for NADH oxidase, the gene kate for peroxidase.

The wild type Mycobacterium neogolden DSM 44074 described in the examples below is a non-pathogenic bacterium, has clear genetic background, short passage time, easy culture and low raw material for culture medium, and is described in the literature "A new species of rapidly growing, scotochromogenic mycobacteria, mycobacterium neoaurum Tsukamura n.sp. (Japanese), M Tsukamura, 1972". The public is available from the German collection of microorganisms and cell cultures DSMZ (DSM No.:44074,Type strain) and the biological material is used only for repeated experiments in connection with the invention and is not available for other uses.

The pCR-Hyg plasmid was purchased from Addgene Corp (# 158708).

The pMV306-hsp plasmid was purchased from Addgene company (# 26155).

The pSBY1_FnCpf1cg plasmid was purchased from Addgene Corp (# 104622).

Example 1

In this example, the wild Mycobacterium aurum Neoaurum DSM 44074 (abbreviated as DSM 44074) is used as an initial strain, CRISPR-Cas12a gene editing technology is adopted, and genes kshA1, kshA2 and kshA3 encoding 3-sterone-9 alpha-hydroxylase A subunits in the initial strain are knocked out, so that the 3-sterone-9 alpha-hydroxylase is inactivated, and the genetically engineered bacterium delta kshA is obtained. The nucleotide sequences of the genes kshA1, kshA2 and kshA3 for encoding the subunit A of the 3-sterone-9 alpha-hydroxylase are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively.

The sequence shown in SEQ ID NO.1 is as follows:

GTGACTACCGAGACAGCCGGCATTCGCGAGATCGACACCGGCGACCTGCCAG

ACCGCTATGCGCGCGGTTGGCACTGCCTGGGACCGGTGAAGGACTACCTCGACGG

CAAGCCGCACGGGGTGGAGATCTTCGGGACCATGCTCGTCGTCTTCGCCGATTCG

GAAGGCGAACTCAAAGTTCTCGATGGCTATTGCCGGCATATGGGCGGCAACCTCGC

CCAGGGCTCGATCAAGGGCGACACCGTGGCCTGCCCGTTCCACGACTGGCGCTGG

GGCGGCGACGGCAAGTGCAAGCTCGTCCCCTACGCCAAGCGCACACCGCGCCTG

GCCCGCACCCGGGCCTGGCACACCGATGTGCGCGGCGGGCTGCTGTTCGTCTGGC

ATGACCACGAGGGCAACCCACCGCAGCCCGAGGTGCGGATCCCGGAGATCCCCGA

GTTCGCCAGCGACGACTGGACCGATTGGCGGTGGAACACGATGCTCATCGAGGGC

TCCAACTGCCGCGAGATCATCGACAACGTCACAGACATGGCGCACTTCTTCTACAT

CCACTACGGGTTGCCGACGTACTTCAAGAATGTCTTCGAGGGCCACATCGCCAGCC

AGTACCTGCACAACGTCGGCCGTCCGGATGTCAACGACCTCGGCACCACCTACGG

TGAGGCGCACCTGGATTCCGAGGCGTCCTACTTCGGTCCGTCGTTCATGATCAACT

GGCTGCACAACAACTACGGCGGGTTCAAGGCCGAGTCCATCCTGATCAACTGCCA

TTACCCGGTCAGCCAGAACTCCTTCGTGCTGCAGTGGGGCGTCATCGTCGAAAAG

CCCAAGGGGCTCGACGAGAAGACCACCGACAAGCTCGCCCGCGTCTTCACCGAG

GGTGTTTCCAAGGGGTTCCTGCAGGATGTCGAGATCTGGAAGCACAAGACCCGGA

TCGACAACCCGCTGCTGGTCGAGGAGGACGGCGCCGTCTATCAGATGCGCCGCTG

GTATCAGCAGTTCTACGTCGACGTCGCCGACGTGACCCCCGATATGACCGACCGCT

TCGAGATGGAGGTCGACACCACCATCGCCAACGAGAAGTGGCATGTCGAGGTCGA

GGAAAACCTGAAGCTGCAGCAGGACGCCGCCGAGCGCGATGCCGCCGAACAGGG

TGAGCCGCAAAAAGAACCGGCTCAGCCGAGCTGA

the sequence shown in SEQ ID NO.2 is as follows:

ATGACCGATATCCGCGAGATCGACGCCGGCGCCGCGATGACGAGGTTCGCCCGTGGCTGGCACTGCCTCGGGCTGGCCGAGACCTTCCGCGACGGGCGACCGCACGGTATCGAGGCGTTCGGTTCCAAGCTGGTGGTCTTCGCTGATGCCGCCGGGGCCCTGCACGTGCTCGACGCGTACTGCAGGCATATGGGCGGTGACCTCTCCCGCGGCTCGATCAAGGACGACACGCTGGCCTGTCCGTTCCACGACTGGCGCTGGCGTGCCGACGGTAGATGCGCGCTGGTGCCCTACGCCAAGCGGACCCCGCGGCTGGCGCGCACCCGCGCCTGGGAGACCCGCGAGGTCAACGGGCAGCTGCTGATCTGGCACGATCCCGAGGGCTCGACGCCGCCCGCGGAGCTGCTGCCGCCGACCATCGAGGGCTATCCCGAGGGGCAATGGTCGCCGTGGCAGTGGAACTCGGTAGTGATCGAGGGTTCGCACTGTCGCGAAATCGTGGACAACAACGTCGACATGGCGCATTTCTTCTACATCCACCACGCCTATCCGACGTACTTCAAGAACGTCATCGAGGGGCACACCGCAAGTCAGTTCATGGAGTCCAAACCCCGACCGGATTACATCGCCGACCCCGAAAAGATCTGGGAAGGAACGTATCTGCGATCGGAGGCCACCTACTTCGGTCCTGCGTACATGATCAACTGGTTGCACAACGACCTGGCGCCAGGATTCACCGTGGAGGTGGCGCTGATCAACTGCCACTACCCGGTGTCCCATGATTCGTTCGTCCTGCAGTGGGGTGTGGCGGTGCAACAGATGCCCGGCCTGTCCGCCGACAAGGCCGCCAAGCTGGCCGGCGCGATGAGCCGGTCCTTCGGCGAGGGGTTCATGGAGGATGTCGAGATCTGGCGGCACAAGACCAGGATCGAGAACCCGCTGCTCACCGAGGAGGACGGTGCGGTCTATCAACACCGCCGCTGGTACGAGCAGTTCTACGTCGACTCCGCCGATGTCACCACCGATATGACCGACCGGTTCGAGCTGGAGATCGACACCACCCACGCCTATGGGATCTGGGCCGAGGAGGTGGCCGAGAATCTGGCCGGGCTGGCGCAGGCCGGTCGCGGTTCGACTGCGTAA

the sequence shown in SEQ ID NO.3 is as follows:

ATGACATCGTTGCAGCCCGACGGTGCCGGGGACGTTCGTCAGATCGAAGCGC

AGGCAGCGCCCAGCAGGTTTGCCCGTGGCTGGCACTGCCTGGGCCTGACCCGTGA

GCTCGGCGACGGTACCCCGCACTCCATCAATGCCTTCGGAACCAAGCTCGTCGTCT

TCCGTGGTGAGGACGGCAAGCTCAACGTCCTCGACGCCTACTGCCGGCACATGGG

CGGTGATCTGTCCGACGGTGAGGTCAAAGGCAACGAGATCGCCTGCCCGTTCCAT

GATTGGCGTTGGGGTGGTGACGGCCGCTGCAAGCAGATTCCGTACAGTCGGCGTG

TACCCAAGCTGGCGCGTACCGCGGCGTGGCCGACCATGGAACAAGACGGCATGCT

CTTTCTGTGGAATGACCCGGAGAAGAAGGCGCCGCCGGCCGATGTCACCATCCCC

TCGATCGAGGGAGTTGGGGGTGACACGTGGACCGACTGGCACTGGTACACCACGG

TCGTCGATACCAATTGCCGCGAGATCATCGACAACATCGTCGATATGGCGCACTTCT

TCTATATTCACGGCGGCTTGCCGACCGGCTTCAAGAACATCTTCGAGGGGCACATC

GCGACGCAGTACTACGAAAGCGTCGGCAGGCCTGATCTCGGATCGGGCGAGGGCG

CCAAAATTCTCGGAACCACCTCCGTGGCTTCTTATTACGGACCGTCCTTCATGATCG

ATGATCTGACATACCACTATGAGCACGGTGACCAGCGCACGGTCTTGTTGAACTGT

CACTATCCGATCGACGAGAACTCCTTCGTCCTGCAATACGGGATAACCGTCGAGAA

GTCAGAAGCCGTGCCGGAAGACGTTGCCACGCAGATGGCGGTCGCGCTTGGCGAC

TTCGTGAAGATGGGTTTCGAGCAAGACGTGCACATTTGGCGTCGCAAGGCGCGCA

TCGACAACCCGTTGTTGTGCGAGGAGGACGGTCCGGTCTACCAGTTGCGACGGTG

GTACGAGCAGTTCTATGTCGATGCCGCGGACGTCACACCGGATATGGTCGACCGGT

TCGAATTCGAGATCGACACCACCCGCCCACGTGAGGCGTGGATGAAAGAGGTCGA

GGAGAATATCGCTGCCAAGCGGTTGCCCAGGCTGGTGGGCCTGACCAAGTGA

PCR amplification is carried out by taking the genome of an initial strain Mycobacterium neoaurum DSM 44074 as a template, and the kshA1, the kshA2 and the kshA3 are continuously combined and knocked out according to the following construction method to obtain the genetically engineered bacterium delta kshA.

The following construction of the engineered strain ΔkshA1 was carried out using kshA1 as an example, and included the following steps:

1.1 selection of Mycobacterium neoaurum DSM 44074 monoclonal cells in 10mL of medium, 30℃for 48 hours, 1mL of seed in 50mL of medium at 30℃for 6 hours. The cells were collected by centrifugation at 7000rpm at 4℃for 7min, resuspended in 10% glycerol, washed by centrifugation at 4℃and 7000rpm for 7min, and after three repetitions, the washed cells were resuspended in 2mL of 10% glycerol to give Mycobacterium neoaurum DSM 44074 competent cells.

1.2 transfer of pSBY1_Fncpf1cg plasmid into Mycobacterium neoaurum DSM 44074 competent cells in step 1.1, culture at 30℃for 4h, plating on kanamycin resistant plates (50. Mu.g/mL), culturing for 72h, and picking up monoclonal to obtain Mycobacterium neoaurum DSM 44074 competent cells expressing dCS 12 a.

1.3 selecting 25 bases downstream of TTTN on kshA1 gene as crRNA (see SEQ ID No.8 for details), using pCR-Hyg plasmid as template, amplifying with A1-Pam-F/R primer (see SEQ ID No.9 and 10 for details) to obtain amplified fragment, transferring the amplified fragment into E.coli DH5 alpha competent cells after homologous recombination connection, culturing at 37 ℃ for 1h, coating on hygromycin resistance LB plate, and picking up monoclonal after 24 h.

1.4 the single clone of step 1.3 was amplified with pCR-Hyg-F/R primers (see SEQ ID Nos. 11 and 12 for details) and the resulting fragments were sequenced. After the correct monoclonal is sequenced, the monoclonal is transferred into 3mL of LB culture medium for 24h and plasmid is extracted, thus obtaining recombinant plasmid pCR-Hyg-KshA1.

1.5 then 100ng of the recombinant plasmid pCR-Hyg-KshA1 obtained in step 1.4 was transferred into the Mycobacterium neoaurum DSM 44074 competent cells expressing dCS 12a in step 1.2, cultured at 30℃for 4 hours, spread on kanamycin (50. Mu.g/mL), hygromycin resistance plates (100. Mu.g/mL), cultured for 72 hours, amplified with A1-F/R (see SEQ ID Nos. 13 and 14 for details) primers to give fragments of a size not consistent with that of wild type kstd1, and after confirming deletion of the fragments, kshA1 inactivated strain was obtained.

1.6 the kshA1 inactivated strain obtained in step 1.5 was cultured and passaged at 37℃to obtain an engineered strain ΔkshA1 free of resistance plasmids.

1.7 taking kshA2 and kshA3 as templates in sequence, repeating the steps 2) to 6) with reference to the preparation method of competent cells in the step 1.1, and continuously knocking out the kshA2 and the kshA3 on the modified strain delta kshA1 in the step 1.6 to obtain the genetically engineered bacterium named delta kshA.

For kshA1:

crRNA-kshA1：5’CAAGGGGTTCCTGCAGGATGTCGAG 3’(SEQ ID No.8)

A1-Pam-F：5’CAAGGGGTTCCTGCAGGATGTCGAGGTCTAAGAACTTTAAATAATT TCTACTGTTGTAGATATCGACTGCCAGGCATCAAA 3’(SEQ ID No.9)

A1-Pam-R：5’CTCGACATCCTGCAGGAACCCCTTGGTCTAAGAACTTTAAATAATT TCTACTGTTGTAGATATCGACTGCCAGGCATCAAA 3’(SEQ ID No.10)

pCR-Hyg-F：5’CGCCAGCAACGCGGCCTTTT 3’(SEQ ID No.11)

pCR-Hyg-R：5’GACCTCTATTCACAGGGTACGGG 3’(SEQ ID No.12)

A1-F：5’GACCTGCCAGACCGCTATGC 3’(SEQ ID No.13)

A1-R：5’CCGCTCGTCATGCGTGGTCA 3’(SEQ ID No.14)

for kshA2:

crRNA-kshA2：5’GACTCCATGAACTGACTTGCGGTGT 3’(SEQ ID No.15)

A2-Pam-F：5’GACTCCATGAACTGACTTGCGGTGTGTCTAAGAACTTTAAATAATTT CTACTGTTGTAGATATCGACTGCCAGGCATCAAA 3’(SEQ ID No.16)

A2-Pam-R：5’ACACCGCAAGTCAGTTCATGGAGTCATCTACAACAGTAGAAATTAT TTAAAGTTCTTAGACCCGTTTTTGCCTAAATCAGC 3’(SEQ ID No.17)

A2-F：5’GTGCTAGGCAGATCTGATGA 3’(SEQ ID No.18)

A2-R：5’TGCATGCCCCGTTACGCAGT 3’(SEQ ID No.19)

for kshA3:

crRNA-kshA3：5’ACCTCACCGTCGGACAGATCACCGC 3’(SEQ ID No.20)

A3-Pam-F：5’ACCTCACCGTCGGACAGATCACCGCGTCTAAGAACTTTAAATAATTT CTACTGTTGTAGATATCGACTGCCAGGCATCAAA 3’(SEQ ID No.21)

A3-Pam-R：5’GCGGTGATCTGTCCGACGGTGAGGTATCTACAACAGTAGAAATTAT TTAAAGTTCTTAGACCCGTTTTTGCCTAAATCAGC 3’(SEQ ID No.22)

A3-F：5’ATGACATCGTTGCAGCCCGA 3’(SEQ ID No.23)

A3-R：5’TCACTTGGTCAGGCCCACCA 3’(SEQ ID No.24)

example 2

In this example, wild Mycobacterium aurum Neoaum DSM 44074 is used as an initial strain, CRISPR-Cas12a gene editing technology is adopted to knock out genes kshA1, kshA2 and kshA3 encoding 3-sterone-9 alpha-hydroxylase A subunits in the initial strain so as to inactivate 3-sterone-9 alpha-hydroxylase, and meanwhile, the encoding gene hsd4A of hydroxyacyl-CoA dehydrogenase in the initial strain is knocked out so as to inactivate hydroxyacyl-CoA dehydrogenase, thus obtaining genetically engineered bacterium ΔkshA Δhsd4A. The method specifically comprises the following steps:

the nucleotide sequence of the encoding gene hsd4A of the hydroxylase CoA dehydrogenase is shown as SEQ ID NO. 4.

The sequence shown in SEQ ID NO.4 is as follows:

ATGAACGACAACCCGATCGACCTGTCCGGAAAGGTTGCCGTCGTCACCGGCG

CGGCCGCCGGCCTGGGCCGGGCCGAGGCGATAGGCCTGGCGCGGGCCGGCGCGA

CGGTCGTGGTCAACGACATGGCCGGCGCGCTGGACAACTCCGACGTGCTGGCCGA

GATCGAAGCGGTCGGGTCCAAGGGCGTCGCGGTCGCCGGTGATATCAGCGCGCGC

AGCACCGCCGACGAACTCGTCGAGACAGCCGACCGGCTCGGGGGACTGGGCATC

GTGGTGAACAACGCCGGCATCACCCGGGACAAGATGCTGTTCAACATGTCCGACG

AGGACTGGGACGCGGTGATCGCCGTGCATCTGCGCGGACACTTCCTGTTGACGCG

CAATGCTGCGGCGTACTGGAAGGCGAAGGCCAAGGAGACCGCCGACGGACGGGT

GTACGGACGGATCGTCAACACCTCCTCGGAGGCCGGGATCGCCGGACCGGTGGGT

CAAGCCAATTACGGTGCCGCCAAGGCCGGTATCACGGCGTTGACGCTGTCGGCGG

CGCGCGGGTTGAGCAGGTACGGGGTGCGGGCCAATGCCATCGCACCGCGGGCCCG

CACCGCCATGACCGCCGGCGTGTTCGGTGATGCACCGGAGCTGGCGGACGGACAG

GTCGATGCCCTCTCGCCGGAGCATGTCGTCACGCTCGTCACCTACCTGTCCTCCCC

GGCGTCCGAGGATGTCAACGGGCAGCTGTTCATCGTGTACGGACCGACGGTCACC

CTGGTTGCGGCGCCGGTTGCCGCCCACCGGTTCGATGCCGCCGGTGATGCCTGGG

ACCCCGCGGCGTTGAGCGACACGCTCGGTGACTTCTTTGCTAAAAGGGATCCGAA

TATTGGGTTCTCCGCAACTGAGCTCATGGGTTCTTGA

PCR amplification was performed using the genome of the starting strain Mycobacterium neoaurum DSM 44074 as a template, and a strain inactivated hsd4A was constructed as follows to obtain a genetically engineered strain ΔkshA Δhsd4A. The method comprises the following steps:

2.1 transfer pSBY1_FncPf1cg plasmid into the genetically engineered bacterium ΔkshA obtained by the construction of example 1, culture at 30℃for 4 hours, spread on kanamycin resistance plate (50. Mu.g/mL), culture for 72 hours, and then pick up monoclonal to obtain ΔkshA expressing dCS 12 a.

2.2 selecting 25 bases downstream of TTTN on hsd4A gene as crRNA (SEQ ID NO. 25), using pCR-Hyg plasmid as template, amplifying with Hsd A-Pam-F/R primer (see SEQ ID NO.26 and 27 for details), transferring the obtained amplified fragment into E.coli DH5 alpha competent cells after homologous recombination connection, culturing at 37 ℃ for 1h, coating on hygromycin resistance plate, and picking up monoclonal after 24 h.

2.3 amplification with pCR-F/R primers (see SEQ ID Nos. 11 and 12 for details) and sequencing of the resulting fragments. The monoclonal with correct sequence was transferred into 3mL LB medium for 24h and plasmid was extracted to obtain recombinant plasmid pCR-Hyg-Hsd A.

2.4 100ng of the recombinant plasmid pCR-Hyg-Hsd A of step 2.3 of this example was then transferred into ΔkshA of step 2.1 of this example to express dCAS12a, incubated at 30℃for 4h, spread on kanamycin-resistant plates, incubated for 72h, amplified with Hsd A-F/R primers (see SEQ ID Nos. 28 and 29 for details) to give fragments of a size inconsistent with that of wild type hsd4A, sequenced, and after confirmation of deletion of the fragments, hsd 4A-inactivated strains were obtained.

2.5 culturing and passaging the hsd4A inactivated strain obtained in step 2.4 of the present example at 37℃to obtain a genetically engineered bacterium having no resistant property, designated as ΔkshAΔhsd4A.

For hsd4A:

crRNA-hsd4A：5’CGGACAGGTCGATCGGGTTGTCGTT 3’(SEQ ID NO.25)

Hsd4A-Pam-F：5’CGGACAGGTCGATCGGGTTGTCGTTGTCTAAGAACTTTAAATA ATTTCTACTGTTGTAGATATCGACTGCCAGGCATCAAA 3’(SEQ ID No.26)

Hsd4A-Pam-R：5’AACGACAACCCGATCGACCTGTCCGATCTACAACAGTAGAAA TTATTTAAAGTTCTTAGACCCGTTTTTGCCTAAATCAGC 3’(SEQ ID No.27)

Hsd4A-F：5’CGGCCCTGATCCGTAGAGAC 3’(SEQ ID No.28)

Hsd4A-R：5’GCCGGTGTGACGGATGTCAT 3’(SEQ ID No.29)

example 3

In this example, a hydroxyacyl-CoA dehydrogenase overexpressing plasmid was constructed, and electrotransformed into the ΔkshAΔhsd4A strain obtained in example 2 to obtain a strain in which 3-sterone-9α -hydroxylase and hydroxyacyl-CoA dehydrogenase were knocked out and supplemented back with hydroxyacyl-CoA dehydrogenase, and the strain was designated as a genetically engineered bacterium ΔkshAΔhsd4A+hsd4A.

3.1 construction of the hydroxyacyl-CoA dehydrogenase overexpressing plasmid

The nucleotide sequence of the gene hsd4A encoding the hydroxyacyl-CoA dehydrogenase is shown in SEQ ID NO. 4.

The circular plasmid was linearized with the specific enzyme NdeI at the NdeI restriction site on the pMV306hsp plasmid to give a linearized pMV306hsp plasmid.

The new Mycobacterium aurum Neoarum DSM 44074 strain is used as an original strain, and a pMV306hsp-Hsd A-F/R primer (see SEQ ID No.30 and 31 for details) is used for PCR amplification to obtain a target gene segment hsd4A.

According to the procedure in ClonExpress Ultra One Step Cloning Kit kit (commercial product), the amplified gene fragment of interest hsd4A was ligated into the linearized pMV306hsp plasmid to give a recombinant product.

Transferring the recombinant product into DH5 alpha competent cells to construct DH5 alpha cells containing pMV306hsp-Hsd4A plasmid.

pMV306hsp-Hsd4A-F：TAAGAAGGAGATATACATATGAACGACAACCCGATCGA(SEQ ID No.30)

pMV306hsp-Hsd4A-R：GATGAATTCGGATCCTCAAGAACCCATGAGCTCAGTTG(SEQ ID No.31)

3.2 construction of genetically engineered bacteria ΔkshA Δhsd4A+hsd4A

The pMV306hsp-Hsd A plasmid was extracted from DH 5. Alpha. Cells containing the pMV306hsp-Hsd A plasmid according to the method of the plasmid extraction kit, and then electrotransformed into competent cells of the ΔkshA Δhsd4A strain of example 2 (competent cell preparation method referred to step 1.1 of example 1) to obtain a genetically engineered bacterium in which 3-sterone-9. Alpha. -hydroxylase and hydroxyacyl-CoA dehydrogenase are inactivated and the hydroxyacyl-CoA dehydrogenase is supplemented, designated ΔkshA Δhsd4A+hsd4A.

Example 4

In this example, 3-sterone-delta was constructed ¹ Electric transformation of dehydrogenase overexpressing plasmid into the ΔkshAΔhsd4A Strain obtained in example 2 to obtain 3-sterone-9α -hydroxylase and hydroxyacyl-CoA dehydrogenase knockdown and 3-sterone- Δ ¹ The strain over-expressed by dehydrogenase is named as genetic engineering bacterium delta kshA delta hsd4A+kstd.

4.1 construction of 3-sterone-delta ¹ Dehydrogenase overexpression plasmid

3-sterone-delta ¹ The nucleotide sequence of the coding gene kstd of the dehydrogenase is shown in SEQ ID NO. 5.

The sequence shown in SEQ ID NO.5 is as follows:

GTGTTCTACATGACTGAACAGGACTACAGTGTCTTTGACGTAGTAGTGGTAGG

GAGCGGTGCTGCCGGCATGGTCGCCGCCCTCACCGCCGCTCACCAGGGACTCTCG

ACAGTAGTCGTTGAGAAGGCTCCGCACTATGGCGGTTCCACGGCGCGATCCGGCG

GTGGCGTGTGGATTCCCAACAACGAGGTTCTTCAGCGTGACGGGGTCAAAGACAC

CGCCGCGGAGGCACGGAAGTACCTGCACGCCATCATCGGCGATGTGGTGCCTGCC

GAGAAGATCGACACCTACCTGGACCGCAGTCCGGAGATGTTGTCGTTCGTGCTGA

AGAACTCGCCGCTGAAGCTGTGCTGGGTTCCCGGCTACTCCGACTACTACCCGGA

GACGCCGGGCGGTAAGGCCACCGGCCGCTCGGTCGAGCCGAAGCCGTTCAACGC

CAAGAAGCTCGGTCCCGACGAGAAGGGGCTCGAACCGCCGTACGGCAAGGTGCC

GCTGAACATGGTGGTACTGCAACAGGACTATGTCCGGCTCAACCAGCTCAAGCGT

CACCCGCGCGGCGTGCTACGCAGCATCAAGGTGGGTGTGCGATCGGTGTGGGCCA

ACGCCACCGGCAAGAACCTGGTCGGCATGGGCCGGGCGCTCATCGCGCCGCTGCG

CATCGGTCTGCAGAAGGCCGGGGTGCCGGTGCTGCTGAACACCGCGCTGACCGAC

CTGTACATCGAGGACGGGGTGGTGCGCGGAATCTACGTTCGCGAGGCCGGTGCCC

CCGAGTCTGCCGAGCCGAAGCTGATCCGGGCCCGCAGGGGCGTGATCCTCGGTTC

GGGCGGTTTCGAACACAACCAGGAGATGCGCACCAAGTACCAGCGCCAGCCCATC

ACCACCGAGTGGACCGTCGGTGCCGTCGCCAACACCGGTGACGGCATCCTGGCAG

CCGAAAAGCTGGGTGCGGCACTGGAACTCATGGAGGACGCGTGGTGGGGTCCGA

CCGTCCCGCTGGAGGGCGCCCCGTGGTTCGCCCTTTCCGAGCGCAACTCCCCCGG

GTCGATCATCGTCAACATGAACGGTAAGCGGTTCATGAACGAATCGATGCCCTACG

TGGAGGCCTGCCACCACATGTACGGCGGTCAGTACGGCCAGGGCGCCGGGCCGGG

CGAGAACGTGCCCGCCTGGATGATCTTCGACCAGCAGTACCGCGATCGCTATATCT

TTGCGGGATTGCAACCCGGACAACGCATCCCGAAGAAGTGGATGGAATCGGGCAT

CATCGTCAAGGCCGATAGCCTGGCCGAGCTGGCCGAGAAGACCGGTGTGGCCGCC

GACGCGCTGAAGGCCACCATCGAACGGTTCAACGGTTTCGCACGGTCCGGCGTCG

ACGAGGACTTCCACCGCGGCGAGAGCGCCTACGACCGCTACTACGGTGATCCGAC

GAACAAGCCGAACCCGAACCTCGGCGAGATCAAACACGGCCCGTTCTACGCCGCG

AAGATGGTGCCCGGTGACCTGGGCACCAAGGGTGGCATCCGCACCGACGTGCACG

GCCGGGCGCTGCGCGATGACAATTCGGTGATCGAAGGCCTCTATGCGGCAGGCAA

TGTCAGCTCGCCGGTGATGGGTCACACCTATCCCGGCCCGGGTGGCACAATCGGG

CCCGCCATGACCTTCGGCTACCTCGCCGCATTGCATCTCGCTGGAAAGGCCTGA

The target gene fragment KstD was obtained by PCR amplification using Mycobacterium neogold Neoarum DSM 44074 strain as a template and pMV306hsp-KstD-F/R primers (see SEQ ID Nos. 32 and 33 for details).

According to the procedure in ClonExpress Ultra One Step Cloning Kit kit (commercial product), the amplified gene fragment of interest, kstd, was ligated into the linearized pMV306hsp plasmid to give a recombinant product.

Transferring the recombinant product into DH5 alpha competent cells to construct DH5 alpha cells containing the pMV306hsp-KstD plasmid.

pMV306hsp-KstD-F：TAAGAAGGAGATATACATATGTTCTACATGACTGCCCAGGA(SEQ ID No.32)

pMV306hsp-KstD-R：GATGAATTCGGATCCTCAGGCCTTTCCAGCGAGA(SEQ ID No.33)

4.2 construction of genetically engineered bacterium ΔkshA Δhsd4A+kstd

The pMV306hsp-KstD plasmid was extracted from DH 5. Alpha. Cells containing the pMV306hsp-KstD plasmid according to the method of plasmid extraction kit, and then electrotransformed into competent cells of the ΔkshA Δhsd4A strain of example 2 (competent cell production method referred to step 1.1 of example 1) to obtain 3-sterone-9. Alpha. -hydroxylase and hydroxyacyl-CoA dehydrogenase inactivated and 3-sterone- ΔH ¹ Genetically engineered bacteria overexpressing dehydrogenase, designated ΔkshA Δhsd4A+kstd.

Example 5

In this example, NADH oxidase overexpression plasmid was constructed, and electrotransformed into the genetically engineered bacterium ΔkshA Δhsd4A+kstd obtained in example 2 to obtain 3-sterone-9. Alpha. -hydroxylase and hydroxyacyl-CoA dehydrogenase knockdown and 3-sterone- Δkstd ¹ The strain over-expressed by dehydrogenase and NADH oxidase is named as genetic engineering bacteria delta kshA delta hsd4A+kstd+nox.

5.1 construction of NADH oxidase overexpression plasmid

The nucleotide sequence of the coding gene nox of NADH oxidase is shown in SEQ ID NO. 6.

The sequence shown in SEQ ID NO.6 is as follows:

ATGACGAATACTCTGGATGTTTTAAAAGCACGTGCATCTGTAAAGGAATATGAT

ACAAATGCCCCGATCTCTAAGGAGGAGCTGACTGAGCTATTAGACCTTGCCACTAA

AGCGCCTTCTGCTTGGAACCTTCAGCATTGGCATTTTACAGTATTCCACAGCGATG

AATCAAAAGCGGAGCTTCTTCCTGTAGCGTATAATCAAAAACAAATCGTTGAGTCT

TCTGCTGTTGTTGCCATTTTAGGCGATTTAAAGGCAAATGAAAACGGTGAAGAAGT

TTATGCTGAATTAGCAAGCCAAGGCTATATTACGGATGAAATCAAACAAACATTGCT

CGGCCAAATCAACGGTGCTTACCAAAGCGAGCAATTCGCACGTGATTCCGCTTTCT

TAAATGCTTCTTTAGCTGCTATGCAGCTTATGATTGCCGCAAAAGCAAAAGGTTATG

ACACTTGCGCAATCGGCGGATTTAACAAAGAGCAGTTCCAAAAGCAATTTGATATC

AGTGAGCGCTATGTTCCGGTTATGCTTATTTCAATCGGCAAAGCAGTGAAGCCTGC

GCATCAAAGCAACCGTCTGCCGCTTTCAAAAGTATCAACTTGGCTGTAA

plasmid pMV261 is used as a template, hsp60-Hyg-F, hsp-Hyg-R (see SEQ ID NO.34 and 35 for details) is used as a template, hygromycin (Hyg) resistance gene is amplified by using plasmid pCR-Hyg as a template, and a target fragment is obtained after DpnI digestion treatment and cleaning. The sequence of pMV261 plasmid except kanamycin resistance fragment was amplified with pMV261-Hyg-F/R (see SE Q ID No.36 and 37 for details) using plasmid pMV261 as a template, and after DpnI digestion treatment and cleaning, the pMV261 plasmid sequence containing no kanamycin resistance fragment was obtained. The hygromycin resistance gene fragment was ligated with pMV261 which does not contain kanamycin resistance, transferred into E.coli and verified to give plasmid pM V261-Hyg.

The circular plasmid was linearized with the specific enzyme HindIII at the HindIII restriction site on the pMV261-Hyg plasmid to give a linearized pMV261-Hyg plasmid.

The target gene fragment Nox is obtained by PCR amplification with a Bacillus subtilis Bacillus subtilis ATCC 6051a strain as a template and pMV261-Nox-F/R primers (see SEQ ID Nos. 38 and 39 for details).

According to the procedure in ClonExpress Ultra One Step Cloning Kit kit (commercial product), the amplified target gene fragment nox was ligated into linearized pMV261-Hyg plasmid to give recombinant product.

Transferring the recombinant product into DH5 alpha competent cells to construct DH5 alpha cells containing pMV261-Hyg-nox plasmid.

hsp60-Hyg-F：5’-AGAGGTGACCACAACGCGCC-3’(SEQ ID NO.34)

hsp60-Hyg-R：5’-TCAGGCGCCGGGGGCGGTGT-3’(SEQ ID NO.35)

pMV261-Hyg-F：5’-GGCGCGTTGTGGTCACCTCTAACACCCCTTGTATTACTGT-3’

(SEQ ID NO.36)

pMV261-Hyg-R：5’-ACACCGCCCCCGGCGCCTGATCAGAATTGGTTAATTGGTT-3’(SEQ ID NO.37)

pMV261-Nox-F：5’-ATTAAGAAGGAGATATACATATGGACTTCACGCCGAAGCC-3’(SEQ ID No.38)

pMV261-Nox-R：5’-TTATCGATGAATTCGGATCCTCACCGGGTCACCCTCGGCA-3’(SEQ ID No.39)

5.2 construction of NADH oxidase, peroxidase Kate overexpression plasmid

The nucleotide sequence of the coding gene kate of peroxidase is shown in SEQ ID NO. 7.

The sequence shown in SEQ ID NO.7 is as follows:

ATGCGCGAGAGGAACACCCCGGTGACCGACACCCAGCCCAAACCCACCACC

ACCGATGCCGGAATCCCCGTACCCAGCGACGAGCATTCCCTGACCATCGGTCCGAA

CGGACCGATCCTGCTCCAGGACCACTACCTCATCGAGCAGATGGCCAACTTCAACC

GCGAACGCATCCCGGAGCGCCAACCCCATGCCAAGGGCGGTGGCGCGTTCGGCCA

CTTCGAGGTCACCAACGATGTCAGCGCCTACACCAAGGCCGCGTTTCTGCAACCC

GGGGTGAAGACCGAGACGCTGGCCCGGTTCTCGACCGTCGCGGGCGAGCGCGGC

AGCCCGGACACCTGGCGCGACCCGCGCGGGTTCGCCGTGAAGTTCTATACCCAAG

ACGGCAACTTCGACATGGTCGGCAACAACACACCGGTGTTCTTCATCCGCGATCC

ACTCAAGTTCCAGCACTTCATCCGGTCCCAGAAGCGGCGCGCCGCCAACAACCTG

CGCGACCACGACATGCAGTGGGACTTCTGGACCTTGTCACCGGAATCCGCGCATC

AGGTGACCTGGTTGATGGGTGACCGCGGTATCCCGCGCACCTGGCGGCACATGAA

CGGGTACTCCAGCCACACCTACAGCTGGATCAACGCCGATGGCGAGATCTTCTGG

GTCAAATACCATTTCAAGTCCGATCAGGGCATCGAGTTCTACACCCAGGACGAGGG

CGACGAGATGGCCGGTAAGGACGGCGACGCCCACCAGCGCGACCTGTTCGATGCG

ATCGAACGCGGCGAGTTCCCCAGCTGGACACTCAAGATGCAGATCATGCCGTTCG

AGGACGCCAAGGACTATCGGTTCAACCCGTTCGACCTGACCAAGGTGTGGCCACA

CTCCGACTATCCCCTGATCGACGTCGGCAGGTTGACCCTGAACCGCAACGTCACCG

ACTACCACACGGAGATGGAGCAAGCGGCCTTCGAACCCAACAATGCGGTGCCCGG

CACCGGATTGAGTCCGGACAAGATGCTGCTCGCGCGGGACTTCGCCTATGCCGATG

CCCACCGGCACCGGCTCGGGGTGAACTACAAGCAGATCCCGGTGAACTCGCCGAA

GACCGAGGTGCACAGCTACTCCAAGGACGGCGCGATGCGGGTCACCAACGTCACC

GACCCGGTGTATGCGCCGAACTCCTACGGCGGTCCGGCAGCCGATCCGGCCCGCA

CGGCCGAACCGCTCTGGCATGCCGACGGCGATATGGTGCGGGCGGCGTACAGCCT

GCACGCCGAGGACGACGACTGGGGTCAGGCCGGGACGCTCGTGCGCGATGTGCT

CGATGACGCGGCGCGCGATCGGCTGGTGACCAATATCGCCGGGCATCTGTCCGACG

GGGTGTCCGAGCCGGTGCTGCAACGCGCGTTCGAATATTGGCGCAATGTCGACAA

GGACCTGGGCGACCGCGTCGAGGCGGCAGTCAAGTAG

the circular plasmid was linearized with the specific enzyme BamHI at the BamHI restriction site on the pMV261-Hyg-nox plasmid to give a linearized pMV261-Hyg-nox plasmid.

The target gene fragment kate was obtained by PCR amplification using Mycobacterium vaccae strain Neoaurum DSM 44074 as a template and pMV261-Hyg-nox-kate-F/R primers (see SEQ ID Nos. 40 and 41 for details).

According to the procedure in ClonExpress Ultra One Step Cloning Kit kit (commercial product), the amplified target gene fragment kate was ligated with linearized pMV261-Hyg-nox plasmid to give a recombinant product.

Transferring the recombinant product into DH5 alpha competent cells to construct DH5 alpha cells containing pMV261-Hyg-nox-kate plasmid.

pMV306hsp-Hsd4A-F：5’-CAGCTGCAGAATTCGAAGCTTGGATCGTCGGCACCGT CA-3’(SEQ ID No.40)

pMV306hsp-Hsd4A-R：5’-TTATCGATGAATTCGGATCCTCAAGAACCCATGAGC TCAG-3’(SEQ ID No.41)

5.3 construction of genetically engineered bacterium ΔkshA Δhsd4A+kstd+nox+kate

The pMV261-Hyg-nox-kate plasmid was extracted from DH 5. Alpha. Cells containing the pMV261-Hyg-no x-kate plasmid according to the method of plasmid extraction kit, and then electrotransferred into competent cells of the ΔkshA. DELTA.hsd4A strain of example 2 (competent cell production method referred to step 1.1 of example 1), to obtain 3-sterone-9. Alpha. -hydroxylase and hydroxyacyl-CoA dehydrogenase inactivated and 3-sterone-. DELTA. ¹ Genetically engineered bacteria overexpressed by dehydrogenases, NADH oxidases, peroxidases, named ΔkshA Δhsd4A+kstd+nox+kate.

Application example

The culture medium containing phytosterol was inoculated with the wild-type Mycobacterium neogold DSM 44074, the genetically engineered bacteria ΔkshA obtained in example 1, the genetically engineered bacteria ΔkshA Δhsd4A obtained in example 2, the genetically engineered bacteria ΔkshA Δhsd4A+hsd4A obtained in example 3, the genetically engineered bacteria ΔkshA Δhsd4A+kstdd obtained in example 4, and the genetically engineered bacteria ΔkshA Δhsd4A+kstd + nox+kate obtained in example 5, respectively, and fermented. Comprises the following steps:

1) Inoculation and fermentation

The genetic engineering bacteria obtained in the examples 1-5 are taken to be respectively inoculated in 10mL of seed culture medium for culturing for 48 hours, and seed culture solution is obtained; then transferring the seed culture solution to a 250mL baffle conical flask with 10% inoculation amount, fermenting and culturing for 168 hours at the constant temperature of 30 ℃, collecting the fermentation liquid, wherein the rotating speed of the conical flask is 200 revolutions per minute, and the conical flask contains 30mL of fermentation culture medium. Meanwhile, a control group was established, which was different from examples 1 to 5 in that Mycobacterium neogold DSM 44074 was inoculated without inoculating genetically engineered bacteria, and the remaining fermentation conditions, inoculum size, and culture medium were the same.

The seed culture medium comprises the following components: dipotassium hydrogen phosphate 0.6g/L, sodium nitrate 5.4g/L, glucose 6g/L, yeast extract 15g/L, and pH 7.5.

The components of the fermentation medium are as follows: diammonium phosphate 12g/L, glucose 20g/L, dipotassium phosphate 2g/L, magnesium sulfate 0.5g/L, sodium nitrate 0.5g/L, citric acid 3g/L, ferric ammonium citrate 0.05g/L, tween-80 2ml/L, and 1g/L of phytosterol (including 45% beta-sitosterol, 37% campesterol and 18% stigmasterol) with a pH value of 7.5.

2) Determination of the Components in the fermentation liquor

2mL of fermentation liquid is taken during fermentation for 0h, 24h, 48h, 72h, 96h, 120h, 144h and 168h, each component in the fermentation liquid is measured by adopting a liquid chromatography method, the content of each component in the fermentation liquid is calculated, and the conversion rate of each substance is calculated. Liquid chromatography is described in "Production of 9, 21-dimethyl-20-methylpregna-4-en-3-one from phytosterols in Mycobacterium neoaurum by modifying multiple genes and imp roving the intracellular environment, chen-yangYuan et al Microbial Cell Factories,202120:229".

Conversion = actual yield/theoretical yield.

Liquid chromatography is used for measuring, an Agilent XDB-C18 chromatographic column is used for separating the components of the fermentation liquor, and an ultraviolet detector is used for detecting. The mobile phase is 80% aqueous methanol with a flow rate of 0.8mL/min.

The peak time of the related substances is as follows:

the peak time of 1, 4-Androstenedione (ADD), androstenedione (AD), 1,4-HP, and 21-hydroxy-20-methylpregna-4-en-3-one (4-HP) 1, 4-Androstenedione (ADD) was 4.8min.

The off-peak time of Androstenedione (AD) was 5.7min;

the peak time of 21-hydroxy-20-methylpregna-1, 4-dien-3-one (1, 4-HP) was 9.2min;

the peak time of 21-hydroxy-20-methylpregna-4-en-3-one (4-HP) was 14.2min;

the results of the yield and purity of the main product 1,4-HP and the yield of the byproduct 4-HP of the phytosterol fermented by Mycobacterium neogold and the genetically engineered bacteria of examples 1-4 are shown in Table 1.

The results of the fermentation of the main product 1,4-HP and the by-product 4-HP of plant sterols at different concentrations by Mycobacterium neogold and the genetically engineered bacteria of examples 4-5 are shown in Table 2.

TABLE 1 yield and purity of main product of novel Mycobacterium fermented phytosterol 1,4-HP and yield of by-product 4-HP

Remarks: the content of the phytosterol added into the culture medium is 1g/L.

TABLE 2 production of main product 1,4-HP and byproduct 4-HP of novel Mycobacterium fermented phytosterol

From Table 1, it can be seen that fermentation of plant sterols by the wild type Mycobacterium neolyticum Neoaurum DSM 44074 does not produce steroid metabolites which metabolize plant sterols into carbon dioxide and water.

As is clear from Table 1, the genetically engineered bacterium ΔkshA from which 3-sterone-9α -hydroxylase was knocked out in example 1 was able to convert phytosterols to yield 1,4-HP and 4-HP, but the yields were low.

As is clear from Table 1, when the genetically engineered bacterium ΔkshA Δhsd4A obtained in example 2, in which the 3-sterone-9α -hydroxylase and the hydroxyacyl-CoA dehydrogenase were inactivated, was used, phytosterols were metabolized into 1,4-HP and 4-HP; wherein, 1,4-HP is the main product, and the yield can reach 0.59g/L;

as is clear from Table 1, the genetically engineered bacteria ΔkshA Δhsd4A+hsd4A supplemented with the hydroxyacyl-CoA dehydrogenase in example 3 had lower yields of both 1,4-HP and 4-HP than the genetically engineered bacteria in example 1.

As is clear from Table 1, the 3-sterone-9α -hydroxylase and the hydroxyacyl-CoA dehydrogenase obtained in example 4 were used to inactivate 3-sterone- Δ simultaneously ¹ -genetically engineered bacteria ΔkshaΔhsd4a+kstd overexpressed by dehydrogenase metabolize phytosterols into 1,4-HP and 4-HP; wherein 1,4-HP is the main product with a yield of 0.64g/L; compared with the genetically engineered bacterium of the embodiment 2, the production of the byproduct 4-HP can be obviously reduced, and the yield of the 1,4-HP is improved to a certain extent.

As is clear from Table 2, the 3-sterone-9α -hydroxylase and the hydroxyacyl-CoA dehydrogenase obtained in example 5 were used to inactivate 3-sterone- Δ simultaneously ¹ The capacity of the genetically engineered bacteria delta kshA delta hsd4A+kstd+kate+nox over-expressed by dehydrogenase, NADH oxidase and peroxidase for converting high-concentration plant sterols is greatly improved compared with the capacity of delta kshA delta hsd4A+kstd, when the same concentration plant sterols are fermented, the 1,4-HP yield produced by delta kshA delta hsd4A+kstd+kate+nox is improved, and when 20g/L plant sterols are fermented, the 1,4-HP yield reaches 10.5g/L.

FIG. 2 is a graph showing the time-dependent changes in the yield of a product obtained by fermenting phytosterol with the genetically engineered bacterium obtained in example 1 of the present application. It can be seen from FIG. 2 that 1,4-HP can be extracted from the fermentation product, but that the ADD content of the fermentation product is much higher than that of 1,4-HP, and that there is a certain amount of AD, 4-HP. It follows that knockout of the 3-sterone-9α -hydroxylase A subunit gene allows the formation of 1,4-HP upon fermentation of phytosterols, but at a very low purity.

FIG. 3 is a graph showing the time-dependent changes in the 1,4-HP yield obtained by fermenting phytosterol with the genetically engineered bacterium obtained in example 2 of the present application. From FIG. 3, it can be seen that the 1,4-HP yield in the fermentation product is rapidly increased, and the purity is significantly improved. Therefore, the simultaneous knockout of the 3-sterone-9 alpha-hydroxylase A subunit gene and the hydroxyacyl-CoA dehydrogenase gene can greatly improve the purity of the formed 1,4-HP during the fermentation of the phytosterol.

FIG. 4 is a liquid phase analysis chart of the genetically engineered bacterium fermented plant sterol products obtained in example 1, example 2, and example 3 in this application example. From FIG. 4, it can be seen that the knock-out Hsd A in the KshA knock-out strain increased the yield of 1,4-HP produced by the fermented plant sterol of the strain, while the ability of the Hsd A strain to convert plant sterol to produce 1,4-HP was restored to be consistent with the KshA knock-out strain.

FIG. 5 is a graph showing the time-dependent changes in the 1,4-HP yield obtained by fermenting phytosterol with the genetically engineered bacterium obtained in example 4 of the present application. As is clear from FIG. 5, the genetically engineered bacterium of example 4 was inhibited from accumulating 4-HP by-products during the whole fermentation period, and the yield of 1,4-HP was significantly increased to 0.64g/L.

FIG. 6 is a graph showing the time-dependent changes in the 1,4-HP yield obtained by fermenting plant sterols at different concentrations with the genetically engineered bacterium obtained in example 5 of the present application. As is clear from FIG. 6, the productivity of 1,4-HP was greatly improved during the fermentation of high concentration plant sterols by the genetically engineered bacterium of example 5, and the yield of 1,4-HP reached 10.5g/L at 20g/L of plant sterols.

The invention discovers that after knocking out the gene encoding 3-sterone-9 alpha-hydroxylase in mycobacterium, phytosterol can be metabolized into ADD, AD, 1,4-HP and 4-HP, but the yield of 1,4-HP is lower; after the gene encoding the hydroxyacyl-CoA dehydrogenase is continuously knocked out, the phytosterol can be metabolized into 1,4-HP and 4-HP, and the yield of 9-OH-PDCE can reach 0.59g/L; performing a back-supplementation function verification by back-supplementing the hydroxyacyl-coa dehydrogenase into the mycobacterium from which the hydroxyacyl-coa dehydrogenase and the 3-sterone-9α -hydroxylase are knocked out, and finding that the back-supplementation of the hydroxyacyl-coa dehydrogenase metabolizes phytosterols into ADD, AD, 1,4-HP and 4-HP; it is comprehensively demonstrated that 3-sterone-9 alpha-hydroxylase and hydroxyacyl-CoA dehydrogenase have important regulatory roles in the process of converting mycobacteria into sterols, and that 3-sterone-9 alpha-hydroxylase and hydroxyacyl-CoA dehydrogenase are key genes for generating steroid precursors, in particular 1,4-HP, for mycobacteria.

The genetic engineering strain provided by the invention can selectively convert the phytosterol into 21-hydroxy-20-methyl pregna-1, 4-diene-3-ketone (1, 4-HP), and can reduce the generation of a byproduct 21-hydroxy-20-methyl pregna-4-ene-3-ketone (4-HP), and the yield of 1,4-HP can reach 10.5g/L. The genetically engineered bacterium improves the production efficiency and purity of the 1,4-HP, and is easy to separate and purify.

The genetically engineered bacterium provided by the invention can selectively degrade the side chain of sterol. The genetically engineered bacterium of the invention is used for fermenting sterol, which can reduce the generation of byproducts such as 4-HP, improve the production efficiency and quality of 1,4-HP, and facilitate the separation and purification of the products. The 1,4-HP obtained by fermenting sterol by the genetically engineered bacterium can be used as a raw material to prepare corticosteroid steroid medicines such as prednisolone, dexamethasone and betamethasone.

The above embodiments are merely illustrative of the principles of the present invention and its effectiveness, and are not intended to limit the invention. Modifications and variations may be made to the above-described embodiments by those skilled in the art without departing from the spirit and scope of the invention. Accordingly, it is intended that all equivalent modifications and variations of the invention be covered by the claims, which are within the ordinary skill of the art, be within the spirit and scope of the present disclosure.

Claims

1. Use of a gene for modulating the yield of a steroid precursor in a mycobacterium or for engineering a steroid precursor in a mycobacterium, characterized in that the gene comprises a gene encoding a hydroxyacyl-coa dehydrogenase and/or a gene encoding a 3-sterone-9 a-hydroxylase a subunit.

2. Use of a gene according to claim 1 for modulating yield of or engineering a mycobacterium of a steroid-producing precursor, comprising at least one of 1) -3) of:

1) The gene encoding the A subunit of 3-sterone-9 alpha-hydroxylase is at least one of the following A1) -A4);

a4 A nucleotide sequence having 60% or more homology to the nucleotide sequence defined by the sequence shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3 and encoding the A subunit of the 3-sterone-9. Alpha. -hydroxylase;

2) The gene encoding the hydroxyacyl-CoA dehydrogenase is B1) or B2) as follows;

B1 The gene is hsd4A; the nucleotide sequence of hsd4A comprises the sequence shown in SEQ ID NO. 4; b2 A nucleotide having 60% or more homology to the nucleotide sequence defined by the sequence shown in SEQ ID NO.4 and encoding the hydroxyacyl-CoA dehydrogenase;

3) The steroid precursor is selected from one or more of 1, 4-androstenedione, 21-hydroxy-20-methyl pregna-1, 4-dien-3-one, and 21-hydroxy-20-methyl pregna-4-en-3-one; preferably 21-hydroxy-20-methylpregna-1, 4-dien-3-one.

3. Use of a gene according to claim 1 for modulating the yield of or engineering a mycobacterial steroid precursor in a mycobacterium, wherein the gene further comprises a gene encoding 3-sterone-delta ¹ -one or more of the genes for dehydrogenase, NADH oxidase, peroxidase.

4. Use of a gene according to claim 3 for regulating the yield of or engineering a mycobacterium of a steroid-producing precursor, comprising 1-1), 1-2) and/or 1-3) of:

1-1) said 3-sterone-delta encoding ¹ The genes for dehydrogenases are C1) or C2) as follows;

C2 60% or more homology to the nucleotide sequence defined by the sequence shown in SEQ ID No.5 and encoding the 3-sterone-delta ¹ -nucleotides of a dehydrogenase;

1-2) the gene encoding NADH oxidase is at least one of the following D1) -D2);

1-3) the gene encoding peroxidase is at least one of the following E1) -E2);

e1 The coding gene is kate; the nucleotide sequence of kate comprises a sequence shown as SEQ ID NO. 7;

e2 A nucleotide sequence having 60% or more homology to the nucleotide sequence defined by the sequence shown in SEQ ID NO7 and encoding the peroxidase.

5. Use of the gene according to claim 4 for modulating the yield of or engineering a mycobacterium of a steroid producing precursor, wherein the hydroxyacyl-coa dehydrogenase, the peroxidase is derived from actinomycetes;

and/or, the NADH oxidase is derived from Bacillus.

6. Use of a gene according to any one of claims 1-5 for modulating the yield of a mycobacterial steroid precursor or for engineering a mycobacterial steroid precursor, wherein said mycobacteria is a new mycobacterium aurum; preferably Mycobacterium neogold DSM 44074.

7. A genetically engineered bacterium for producing a steroid drug precursor, wherein the genetically engineered bacterium is obtained by knocking out genes encoding 3-sterone-9 a-hydroxylase and/or hydroxyacyl-coa dehydrogenase in mycobacterium.

8. The steroid precursor producing genetically engineered bacterium of claim 7, further comprising over-expression encoding 3-sterone-delta ¹ -dehydrogenaseGenes for NADH oxidase and/or peroxidase.

9. The steroid precursor producing genetically engineered bacterium of claim 8, used to construct the vector that overexpresses the encoded 3-sterone-delta ¹ The shuttle plasmid used for the dehydrogenase gene is selected from the pMV306hsp plasmid.

10. The steroid prodrug producing genetically engineered bacterium of claim 8, wherein the shuttle plasmid employed for constructing the gene encoding NADH oxidase and/or the peroxidase is selected from pMV261 plasmid.

11. Use of a steroid precursor producing genetically engineered bacterium according to any one of claims 7-10 for the preparation of 21-hydroxy-20-methyl pregna-1, 4-dien-3-one.

12. A method for preparing 21-hydroxy-20-methyl pregna-1, 4-dien-3-one, which is characterized by comprising the following steps: the genetically engineered bacterium of any one of claims 7-10 converts sterols to 21-hydroxy-20-methyl pregna-1, 4-dien-3-one.

Use of 21-hydroxy-20-methylpregna-1, 4-dien-3-one as a starting material in the preparation of a steroid; preferably, the steroid is selected from one or more of prednisolone and prednisolone acetate.