CN116286573A - Construction and application of novel recombinant bacillus calmette-guerin strain - Google Patents

Abstract

The invention relates to the field of biotechnology, in particular to construction of a recombinant BCG vaccine strain and application thereof, wherein the construction and application of the recombinant BCG vaccine strain are characterized in that a BCG-0819 c gene of a wild type BCG strain is knocked out by improving a wild type BCG strain Pasteur1173P2, a BCG recombinant vaccine is constructed, and experiments of mice prove that the colonization capability of the BCG strain with the BCG-0819 c gene knocked out in the lung of the mice is greatly enhanced, so that higher immunogenicity can be continuously provided for a host, and the host can generate more antibodies to resist mycobacterium tuberculosis. The improved BCG recombinant vaccine strain can be used for preventing and controlling tuberculosis.

Description

Construction and application of novel recombinant bacillus calmette-guerin strain

[ field of technology ]

The invention relates to the technical field of biology, in particular to construction and application of a novel recombinant BCG strain.

[ background Art ]

Tuberculosis (TB) is a chronic infectious disease in which lesions mainly occur in lung tissues, trachea, bronchi and pleura, and is a second major lethal infectious disease, the main pathogenic bacteria of which are mycobacterium Tuberculosis. It is counted that about a quarter of the world's population is infected with mycobacterium tuberculosis, 5% -15% of which are prone to active tuberculosis. According to the latest 2022 global tuberculosis report issued by World Health Organization (WHO), 2021, 1060 ten thousand new tuberculosis patients worldwide. The method is mainly distributed in developing countries, the number of new patients with tuberculosis in China is 78 ten thousand (84.2 ten thousand in 2020), the estimated tuberculosis incidence is 55/10 ten thousand (59/10 ten thousand in 2020), and the 3 rd row of estimated tuberculosis incidence in China in 30 tuberculosis high-burden countries is next to Indonesia and India.

Worldwide, the lack of efficient tuberculosis vaccines and therapeutic drugs has made the prevention and efficient control of tuberculosis faced a number of obstacles. The emergence of multi-drug resistant strains and other related diseases such as co-infection of HIV with TB makes this situation more urgent and complex. Therefore, there is an urgent need to develop a safe and efficient novel vaccine against tuberculosis, which is resistant to mycobacterium tuberculosis from the source, and can greatly reduce the new cases of tuberculosis.

BCG vaccine (Mycobacterium bovis BCG, BCG) is a generic name of attenuated live bacteria family of mycobacterium bovis, is an attenuated bacterial strain obtained by serial in vitro passage of mycobacterium bovis, is a live bacterial vaccine prepared from suspension thereof, is the only vaccine approved for controlling human tuberculosis at present, and has different vaccination proposal conditions in different countries. The vaccine has functions of enhancing macrophage activity, enhancing macrophage capability of killing tumor cells, activating T lymphocyte, and enhancing organism cell immunity. Bcg has non-specific benefits for non-tuberculosis infections in newborns and the elderly, and provides immunotherapeutic benefits for certain malignancies.

At present, BCG is inoculated in the young children period and can only produce a certain protection effect in a limited time, so that the development of a novel efficient anti-tuberculosis vaccine is helpful for carrying out a long-time continuous protection effect on organisms. Methods of developing anti-tuberculosis vaccines in addition to the reconstitution of bcg, there are three different vaccine development methods: 1. developing a brand new tuberculosis vaccine; 2. novel recombinant vaccines derived from existing bcg; 3. booster vaccination was developed to boost existing bcg vaccination. However, it is most safe to retrofit existing vaccines to derive new recombinant vaccines. Currently, four recombinant bcg vaccines are under investigation to replace the parental bcg. The first is BCG-Zmp1, still in preclinical stages. The BCG-Zmp1 vaccine is an attenuated BCG vaccine, has the knockout mutation of zmp1 gene, encodes zinc metalloprotease Zmp1, and has high immunogenicity and higher safety compared with the traditional BCG vaccination, thus having better protection effect on mycobacterium tuberculosis. The second candidate vaccine for clinical trials was SapM: tnBCG, which was an insertion mutation of the sapM gene from the parent Mycobacterium bovis BCG strain. Compared with the parent BCG, the mice inoculated with the SapM: tnBCG showed a stronger immune response. The third clinical candidate vaccine is CysVac2, a recombinant bcg that expresses a fusion protein comprising the antigen Ag85B and a protein CysD expressed during persistent infection by mycobacterium tuberculosis. The injection site of the mice vaccinated with the CysVac2 vaccine causes a massive influx of innate immune cells, in particular neutrophils, macrophages. The last is the VPM1002 vaccine, which is a recombinant BCG vaccine strain using the hemolysin encoding gene (hly) of Listeria monocytogenes to replace the urease C gene in BCG. Compared with the BCG control group, VPM1002 vaccination has a remarkable protective effect, th1 reaction is remarkable, and bacterial load is reduced. Phase III trials of VPM1002 vaccination are currently underway in india. The immunogenicity of current BCG vaccine strains is insufficient to induce adequate protection in the host, and genetically engineered BCG strains are more immunogenic and capable of stimulating the production of more antibodies against pathogenic bacteria. The present invention describes a new strategy to improve the engraftment ability and immunogenicity of existing BCG vaccine strains.

[ invention ]

In view of the foregoing, it is desirable to provide a novel recombinant BCG vaccine strain construction and use thereof, which find a BCG recombinant vaccine strain constructed by knocking out BCG _0819c gene on wild-type BCG strain Pasteur1173P2 to enhance immunogenicity and apply it to a novel anti-tuberculosis vaccine. Based on the above, the invention provides a preparation method for constructing a BCG recombinant vaccine strain with BCG _0819c gene deletion and application of the BCG recombinant vaccine strain with BCG _0819c gene deletion in anti-tuberculosis vaccines.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

a novel recombinant BCG vaccine strain is obtained by knocking out BCG _0819c genes from a wild BCG strain Pasteur1173P2, and the BCG _0819c gene sequence is shown as a sequence table SEQ ID NO. 1. The wild strain Pasteur1173P2 of the present application is all: mycobacterium tuberculosis variant bovis BCG Pasteur1173P2, which is a well-known public strain available from Shanghai Mino Biotech Inc., the complete genomic sequence has been published by NCBI under accession number NC_008769.1.

The invention comprises a method for preparing a novel recombinant bacillus calmette-guerin strain, which is characterized by comprising the following steps:

(1) The upstream 1000bp fragment of the bcg _0819c gene was amplified with the Pasteur1173P2 strain as template and the bcg _0819c-up-PacI-F/bcg _0819c-up-SpeI-R primer pair; the primer sequence of the bcg _0819c-up-PacI-F is shown as SEQ ID NO. 2, and the primer sequence of the bcg _0819c-up-SpeI-R is shown as SEQ ID NO. 3; the 1000bp fragment sequence of the bcg _0819c gene upstream is shown as SEQ ID NO. 4;

(2) Using Pasteur1173P2 strain as template and BCG _0819c-dn-HindIII-F/BCG_0819c-dn-NheI-R primer pair to amplify BCG _0819c gene downstream 1000bp fragment; the primer sequence of the bcg _0819c-dn-HindIII-F is shown as SEQ ID NO. 5, and the primer sequence of the bcg _0819c-dn-NheI-R is shown as SEQ ID NO. 6; the 1000bp fragment sequence at the upstream of the bcg _0819c gene is shown as SEQ ID NO. 7;

(3) Respectively adopting corresponding restriction enzymes to carry out enzyme digestion on an upstream 1000bp fragment and a downstream 1000bp fragment of the bcg _0819c gene, and recovering the purified gene fragments; restriction enzymes of the 1000bp fragment upstream of the bcg _0819c gene are PacI and SpeI; restriction enzymes of 1000bp fragments downstream of the bcg _0819c gene are HindIII and NheI;

(4) The 1000bp fragment at the downstream of the recovered bcg _0819c gene is connected to a pMind-lacZ vector cut by HindIII and Nhe I, and is transformed into DH5 alpha competence, and the transformant is picked and verified to obtain a recombinant plasmid pMind-lacZ-bcg _0819c-dn1000;

(5) The plasmid pMind-lacZ-bcg _0819c-dn1000 is digested by Pac I and Spe I, and then the recovered 1000bp fragment at the upstream of bcg _0819c gene is connected and transformed into DH5 alpha competence, transformant is picked and verified, and recombinant plasmid pMind-lacZ-bcg _0819c-updn-2000 of knockout bcg _0819c gene is obtained;

(6) And (3) converting the plasmid pMind-lacZ-BCG _0819c-updn-2000 constructed in the step (5) into a wild-type BCG strain Pasteur1173P2 by an electrotransformation method, screening positive clones on a 7H10 flat plate containing OADC and hygromycin resistance, and identifying the positive clones through antibiotic verification and PCR verification to obtain the BCG recombinant strain.

The invention also comprises the application of the novel recombinant bacillus calmette-guerin strain in improving the residence time of the bacillus calmette-guerin in the lungs of animals.

The invention also comprises the application of the novel recombinant BCG strain in preparing tuberculosis vaccine.

The invention has the following beneficial effects:

compared with a wild type BCG strain, the BCG _0819c gene knockout recombinant BCG strain provided by the invention can obviously improve the residence time of the strain in the lung of a mouse, further continuously generate stimulation, maintain long-term immunogenicity, and be beneficial to the generation of stronger anti-tuberculosis infection capability of a host.

[ description of the drawings ]

FIG. 1 is a gene schematic diagram of the bcg _0819c gene knockout.

FIG. 2 is a diagram showing electrophoresis results of PCR products of wild-type BCG, BCG _0819c gene deletion mutant and blank, in which M is DL2000 marker; lanes 1-3 are graphs of the results of PCR amplification with BCG/pMV61, delta BCG _0819c/pMV261, blank as template, and BCG _0819c gene specific primer pairs (F1 and R1), respectively; lanes 4-6 are graphs showing the results of PCR amplification with specific primer pairs (F2 and R2) for hyg gene using BCG/pMV61, delta BCG _0819c/pMV261, and blank as templates, respectively.

FIG. 3 is a schematic diagram of the construction of bcg _0819c deletion mutants of BCG.

FIG. 4 is a graph showing the comparison of the immunogenicity of bcg _0819c deletion mutants and wild BCG strain Pasteur1173P 2.

[ detailed description ] of the invention

In order that the above objects, features and advantages of the invention will be readily understood, a more particular description of the invention will be rendered by reference to the appended drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. The invention may be embodied in many other forms than described herein and similarly modified by those skilled in the art without departing from the spirit or scope of the invention, which is therefore not limited to the specific embodiments disclosed below.

Example 1:

starting strain: pasteur1173P2, which is a well-known public strain available from Shanghai Minodynamic Co., ltd, is designated Mycobacterium tuberculosis variant bovis BCG Pasteur1173P2, and has been published by NCBI under accession number NC_008769.1.

The method comprises the following specific steps:

1. obtaining BCG wild-type competent cells

BCG wild-type strain (Pasteur 1173P 2) was inoculated into 5mL of fresh 7H9 medium with OADC added thereto, cultured at 37 ℃ and 150rpm, and activated. After culturing to log phase, transferring to 100mL of fresh 7H9 medium, culturing at 37deg.C and 150rpm to log phase (OD) ₆₀₀ About 0.8-1.0). Pre-cooling the thalli in advance, centrifuging for 5min at 4 ℃ and 6000r/min, discarding the supernatant, and collecting the thalli. And then the pre-cooled mixed solution of 10% glycerol and 0.05% Tween-80 is used for gently resuspending the thalli, then about 50mL of the mixed solution is added, the centrifugation is carried out at the temperature of 4 ℃ and the speed of 6000r/min for 5min, the steps are repeated for 3 times, and the culture medium and metabolic wastes generated by cell growth are fully removed. BCG wild-type (Pasteur 1173P 2) competent cells were finally obtained.

2. Construction and verification of a knockout vector for the bcg _0819c Gene

(1) Using Pasteur1173P2 strain as template, primer pair of bcg _0819c-up-PacI-F/bcg _0819c-up-SpeI-R (sequence shown in Table 1) on upstream of homology arm of bcg _0819c gene was designed by SnapGene software to amplify 1000bp fragment on upstream of bcg _0819c gene, the sequence of which is shown in Table 2 and SEQ ID NO: 4.

Table 1bcg_0819c gene upstream 1000bp amplification primer

Primer name	Primer sequence 5'-3'	Sequence listing
			bcg_0819c-up-PacI-F	ATCGTTAATTAACGAACGCCGACTTGCCACCCAGTTC	SEQ ID NO:2
bcg_0819c-up-SpeI-R	ATCGACTAGTCATATGTCCAAGCTATCGGATGGTCGC	SEQ ID NO:3

Table 2bcg_0819c gene upstream 1000bp fragment sequence

(2) Using Pasteur1173P2 strain as template, using Snap Gene software to design bcg _0819c-dn-HindIII-F/bcg _0819c-dn-NheI-R (sequence is shown in table 3) primer pair of bcg _0819c gene downstream of homologous arm to amplify bcg _0819c gene downstream 1000bp fragment; the sequence of the fragment is shown in Table 4 and SEQ ID NO. 7.

Table 3bcg_0819c gene downstream 1000bp amplification primer

Primer name	Primer sequence 5'-3'	Sequence listing
			bcg_0819c-dn-HindIII-F	ATATAAGCTTATGACCGTCCGCGTCGGTGACCC	SEQ ID NO:5
bcg_0819c-dn-NheI-R	ATATGCTAGCGGCCGATGCGATAGTCGTCCGGGTC	SEQ ID NO:6

TABLE 4bcg_0819c gene downstream 1000bp fragment sequence

(3) Detecting the amplified products of the steps (1) and (2) by agarose gel electrophoresis, purifying the amplified products by using a DNA purification kit after the sizes and the concentrations of the fragments meet the expectations, carrying out enzyme digestion on the purified fragments by using corresponding restriction enzymes, carrying out enzyme digestion at 37 ℃ for 4 hours, and then purifying the corresponding digested fragments by using a DNA recovery kit. Wherein, the restriction endonucleases of the 1000bp fragment upstream of the bcg _0819c gene are PacI and SpeI; restriction enzymes of the 1000bp fragment downstream of the bcg _0819c gene are HindIII and NheI.

(4) The 1000bp downstream fragment from the recovered bcg _0819c gene was ligated to the pMind-lacZ vector digested with HindIII and Nhe I overnight at 16℃after which the ligation product was transformed into DH 5. Alpha. Competence. The transformants were picked up the next day after incubation at 37℃for 1 day, the plasmids were extracted after activation, PCR and plasmid size verification were performed on the recombinant plasmids, successful ligation of the bcg _0819c downstream arm fragment was confirmed, and the correctly cloned recombinant plasmids were purified and named pMind-lacZ-bcg _0819c-dn1000.

(5) The recombinant plasmid pMind-lacZ-bcg _0819c-dn1000 of the step (4) is digested by PacI and SpeI, and the recovered upstream 1000bp fragment of bcg _0819c gene is connected and transformed into DH5 alpha competence, and the transformant is picked on the next day. The successful connection of the upstream arm segment of bcg _0819c is confirmed by adopting a PCR verification and plasmid size verification mode, and finally, the recombinant plasmid with correct cloning is purified and cloned, and the recombinant plasmid is named as pMind-lacZ-bcg _0819c-updn-2000; the bcg _0819c knockout recombinant plasmid is obtained successfully.

Example 2:

construction and validation of bcg _0819c Gene-deleted Strain.

The plasmid pMind-lacZ-BCG _0819c-updn-2000 constructed in step (5) of example 1 was transformed into the wild-type BCG strain (Pasteur 1173P 2) by electrotransformation, as follows:

the constructed knockout vector (pMind-lacZ-bcg _0819c-updn-2000) is irradiated for about 2 minutes under an ultraviolet lamp, so that the recombinant plasmid is subjected to ultraviolet injury, the recombination efficiency of the plasmid is improved by utilizing a bacterial repair system, and the knockout strain can be better obtained. Adding 5 mu L of knock-out recombinant plasmid (pMind-lacZ-BCG _0819c-updn-2000) subjected to ultraviolet irradiation into the competence of the wild type (Pasteur 1173P 2) of the BCG, incubating on ice for 1min, adding a mixture of the competence and the plasmid into a precooled electric rotating cup, standing on ice for 1min, then wiping off water stains on the electric rotating cup, and electrically transferring the recombinant plasmid into the competence of the wild type (Pasteur 1173P 2) of the BCG by adopting 2500V voltage; after electrotransfer the mixture was transferred to a 1.5mL sterile centrifuge tube, 800. Mu.L of fresh 7H9 medium was added and resuscitated on a shaker at 37℃and 150rpm for 24H. After resuscitating, a part of the supernatant was removed by centrifugation at 8000rpm for 2min, and about 100. Mu.L of the supernatant was left for resuspension of the cells, which were uniformly spread on a 7H10 screening plate containing hygromycin and X-gal (both at a concentration of 50. Mu.g/mL) with 10% OADC added thereto, and cultured upside down at 37℃for 21 days to pick up white single colonies.

White single colonies were picked on screening plates and grown to mid-log in 7H9 medium containing hygromycin, followed by antibiotic verification and PCR verification of successful construction of the bcg _0819c knockout strain.

Molecular level verification of the knockout strain: 3mL of bacterial solutions of wild type and knockout type strains are respectively taken, bacterial genome DNA is extracted after bacterial cells are collected. PCR amplification was performed with primers specific for bcg _0819c gene and hyg gene (hygromycin gene for selection marker), respectively (primers are shown in tables 5 to 6), and agarose gel electrophoresis detection was performed on the PCR products: specifically, as shown in fig. 3, M is DL2000 marker; lanes 1-3 are graphs showing the results of PCR amplification with BCG/pMV61 (wild type) and Delta BCG _0819c/pMV261 (BCG _0819c deletion mutant), blank as template, and BCG _0819c gene specific primer pairs (F1 and R1); lanes 4 to 6 are graphs showing the results of PCR amplification with BCG/pMV61 (wild type) and Delta BCG _0819c/pMV261 (BCG _0819c deletion mutant) as templates, and hyg gene-specific primer pairs (F2 and R2), respectively, and as seen in FIG. 3, BCG/pMV61 (wild type) has an amplification product in lane 1, no amplification product in lane 4, and the size of the product is 664bp, indicating that the wild type contains a gene BCG _0819c fragment; whereas Delta bcg _0819c/pMV261 (bcg _0819c deletion mutant) had no amplification product in lane 2, amplification product in lane 5, and the size of the product was 1025bp, indicating that the bcg _0819c gene was knocked out successfully in Delta bcg _0819c/pMV261 (bcg _0819c deletion mutant), the strain had no gene bcg _0819c fragment of interest.

Therefore, we selected a strain capable of amplifying hyg gene fragment but incapable of amplifying the target gene bcg _0819c fragment as a double crossover strain, and formally named as Δ bcg _0819c/pMV261 as a strain from which bcg _0819c was successfully knocked out.

Specific primers for table 5bcg_0819c gene

Primer name	Primer sequence 5'-3'	Sequence listing
			F1	GCATGAATTCATGTGTCCAGCGATGTACTGGTTACCAC	SEQ ID NO:8
R1	ATATTCTAGATCATTCGCTGCCACCAGTGCTCGGCTCGTTAG	SEQ ID NO:9

TABLE 6hyg Gene specific primers

Primer name	Primer sequence 5'-3'	Sequence listing
			F2	AGCCAGCGCATATGGTGACACAAGAATCCCTG	SEQ ID NO:10
R2	ACACTTAATTAATTAGGCGCCGGGGGCGGT	SEQ ID NO:11

Example 3:

this example demonstrates the immunogenicity comparison of BCG _0819c knockout strain (Δ BCG _0819c/pMV 261) and BCG wild-type strain (BCG/pMV 61) at the animal level.

Treating mice (3-6/time) with isoflurane for about 4min (1/s heart beat); taking out the mice, holding the mouth with hands (preventing mouth from breathing), and collecting appropriate amount of bacterial liquid (1×10) ⁷ Individual/40 μl) suspended between nostrils and continuously instilled (to avoid sneezing and bubbling in mice); after dripping, the mice are placed for 30s (more than 4 times of breathing is guaranteed), and the nostrils are placed upwards into a clean cage.

Day 2, 7, 14, 28 and 56 mice were individually selected for planing, after 75% ethanol sterilization, the skin was cut with scissors at about 45 ° (hair was avoided), the endothelium was opened, the chest was cut, the lower left lung was placed in a 1.5mL centrifuge tube containing 1mL dbs, and after grinding, cfu was measured by plating.

The results obtained are shown in FIG. 4, and it can be seen from the graph that the cfu value of BCG _0819c deletion mutant (delta BCG _0819c/pMV 261) in the lung of the mouse is extremely higher than that of BCG wild type strain (BCG/pMV 61) in numbers 2d,7d,14d,28d and 56d, so that the colonization ability of the lung of the animal is enhanced after the BCG wild strain knocks out BCG _0819c, the residence time of the BCG strain in the lung can be prolonged, and the BCG strain has better immunogenicity compared with the wild BCG strain.

In summary, the invention provides a BCG recombinant vaccine strain constructed by knocking out BCG _0819c genes on a wild type BCG strain Pasteur1173P2 to improve the immunogenicity and apply the strain to a novel anti-tuberculosis vaccine. Based on the above, the invention provides a preparation method for constructing a BCG recombinant vaccine strain with BCG _0819c gene deletion and application of the BCG recombinant vaccine strain with BCG _0819c gene deletion in anti-tuberculosis vaccines.

The above examples merely represent a few embodiments of the present invention, which are described in more detail and are not to be construed as limiting the scope of the present invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of the invention should be assessed as that of the appended claims.

Claims (4)

1. The novel recombinant BCG strain is characterized by being obtained by knocking out BCG _0819c genes from a wild BCG strain Pasteur1173P2, and the BCG _0819c gene sequence is shown as a sequence table SEQ ID NO. 1.

2. A method of constructing a novel recombinant bcg strain of claim 1, said method comprising the steps of:

(1) The upstream 1000bp fragment of the bcg _0819c gene was amplified with the Pasteur1173P2 strain as template and the bcg _0819c-up-PacI-F/bcg _0819c-up-SpeI-R primer pair; the primer sequence of the bcg _0819c-up-PacI-F is shown as SEQ ID NO. 2, and the primer sequence of the bcg _0819c-up-SpeI-R is shown as SEQ ID NO. 3; the 1000bp fragment sequence of the bcg _0819c gene upstream is shown as SEQ ID NO. 4;

(2) Using Pasteur1173P2 strain as template and bcg _0819c-dn-HindIII-F/bcg _0819c-dn-NheI-R primer pair to amplify bcg _0819c gene downstream 1000bp fragment; the primer sequence of the bcg _0819c-dn-HindIII-F is shown as SEQ ID NO. 5, and the primer sequence of the bcg _0819c-dn-NheI-R is shown as SEQ ID NO. 6; the 1000bp fragment sequence of the bcg _0819c gene downstream is shown as SEQ ID NO. 7;

(3) Respectively adopting corresponding restriction enzymes to carry out enzyme digestion on an upstream 1000bp fragment and a downstream 1000bp fragment of the bcg _0819c gene, and recovering the purified gene fragments; restriction enzymes of the 1000bp fragment upstream of the bcg _0819c gene are PacI and SpeI; restriction enzymes of 1000bp fragments downstream of the bcg _0819c gene are HindIII and NheI;

(4) Connecting the recovered 1000bp fragment at the downstream of the bcg _0819c gene to a pMind-lacZ vector cut by HindIII and NheI enzymes, converting the pMind-lacZ vector into DH5 alpha competence, picking up a transformant, and verifying to obtain a recombinant plasmid pMind-lacZ-bcg _0819c-dn1000;

(5) The plasmid pMind-lacZ-bcg _0819c-dn1000 is digested by PacI and SpeI, and then the recovered 1000bp fragment at the upstream of the bcg _0819c gene is connected, transformed into DH5 alpha competence, transformant is picked and verified, and recombinant plasmid pMind-lacZ-bcg _0819c-updn-2000 of knockout bcg _0819c gene is obtained;

(6) And (3) converting the plasmid pMind-lacZ-BCG _0819c-updn-2000 constructed in the step (5) into a wild-type BCG strain Pasteur1173P2 by an electrotransformation method, screening positive clones on a 7H10 flat plate containing OADC and hygromycin resistance, and identifying the positive clones through antibiotic verification and PCR verification to obtain the BCG recombinant strain.

3. Use of a novel recombinant bcg strain according to claim 1 for increasing the residence time of bcg in the lungs of animals.

4. The use of a novel recombinant bcg strain according to claim 1 for enhancing the preparation of tuberculosis vaccines.

Images