CN116270998A

CN116270998A - Multivalent biotoxin antigen vaccine assembled based on RBD (radial basis function) of double-receptor binding region, and preparation method and application thereof

Info

Publication number: CN116270998A
Application number: CN202310247930.6A
Authority: CN
Inventors: 余云舟; 李柏林; 杨志新; 陆健昇; 王荣; 杜鹏; 余硕; 戴秋云
Original assignee: Academy of Military Medical Sciences AMMS of PLA
Current assignee: Academy of Military Medical Sciences AMMS of PLA
Priority date: 2023-03-15
Filing date: 2023-03-15
Publication date: 2023-06-23

Abstract

The invention discloses a multivalent biotoxin antigen vaccine assembled based on a double receptor binding domain RBD, and a preparation method and application thereof. The invention provides a multivalent biotoxin molecular antigen vaccine, the active ingredients of which are fusion proteins formed by connecting Hc protective antigens of biotoxin 1 and Hc protective antigens of biotoxin 2 through connecting peptides; the biotoxin 1 and the biotoxin 2 are two different biotoxins; the biotoxin is selected from the following: tetanus toxin or other botulinum toxins of non-E type (including A, B and H, etc.). The invention proves that the Hc antigens of the receptor binding regions of the botulinum toxins of different serotypes and the tetanus toxins are fused and assembled into double Hc fusion antigen molecules by utilizing genetic engineering and biosynthesis technology, and the double Hc fusion antigen molecules can generate strong protection effect against a plurality of biotoxins as a single subunit vaccine. Therefore, the Hc fusion antigen molecule vaccine of the invention can generate protective efficacy against various biotoxin pathogens of different serotypes, and can be used as a broad-spectrum multivalent vaccine for the prevention and preventive treatment of biotoxins.

Description

Multivalent biotoxin antigen vaccine assembled based on RBD (radial basis function) of double-receptor binding region, and preparation method and application thereof

Technical Field

The invention relates to the field of bio-pharmaceuticals, in particular to a multivalent biotoxin antigen vaccine assembled based on a double receptor binding domain RBD, and a preparation method and application thereof.

Background

Botulinum toxins (Botulinum neurotoxin, boNTs) are neurotoxins secreted by botulinum bacteria, the most virulent of the biological and chemical toxins known to humans, and a half lethal dose LD to humans ₅₀ Only 0.1-1ng/kg. Botulinum toxins can be classified into 8 serotypes (a-H) based on their antigenic properties, with A, B, E, F and H botulinum toxins being able to cause human botulism. The novel botulinum toxin type H is a newly discovered serotype by biologists in 2013, which is a hybrid of types A and F, and has Hc similar to BoNT/A1, 84% sequence homology, and can be partially neutralized by anti-type A toxin antibodies, HN and L have 64% and 81% homology to BoNT/F1 and BoNT/F5, respectively.

Botulinum toxin-producing clostridium botulinum is a serious public health problem because it is widely found in nature and its spores are highly resistant to the external environment. Therefore, the prevention and treatment medicine development of the botulinum toxin has important practical significance.

Tetanus Toxin (TeNT) is a Toxin produced by clostridium tetani invading the human body through skin or mucosal wounds and growing and propagating in an anoxic environment. Tetanus is also very toxic, and the estimated lethal dose of human body is lower than 2.5ng/kg, and the untreated mortality rate is as high as 40%. Tetanus is a life threatening disease characterized by muscle spasms, which is caused by the neurotoxin of clostridium tetani. After various wounds, puerpera and neonates who give birth under unclean conditions can also occur.

Tetanus toxin has the same structural features as botulinum toxin and a similar mechanism of poisoning. Mature active botulinum toxin and tetanus toxin are long peptide chains linked together by a non-covalent disulfide bond by a light chain (L chain, 50 kDa) and a heavy chain (H chain, 100 kDa). The light chain is a toxic domain with zinc ion endopeptidase activity; the heavy chain N-terminus (HN domain), which is composed of a major alpha helix, plays an important role in the transmembrane transport of biotoxins; the C-terminus of the heavy chain (Hc domain) is a neural cell-specific binding domain, consisting of two subdomains (Hc-N and Hc-C), which interact with receptor proteins, and intervene in the entry of the neurotoxin into the cell.

Botulinum toxin has been the most toxic protein known at present, and the development of vaccines and neutralizing antibodies thereof has been attracting attention, but toxoid vaccines which are studied or used in limited ways at present have a number of disadvantages and cannot be popularized and applied. In recent years, research on botulinum toxin vaccines is enhanced at home and abroad, and an attempt is made to find safe and effective vaccines, wherein the most research prospect is a novel recombinant subunit vaccine. Most previous studies have shown that the botulinum toxin receptor binding domain (Receptor binding domain, RBD) Hc is a protective antigen-base determinant, has complete protection, and is a major target antigen for botulinum toxin vaccine studies. Meanwhile, the tetanus toxin receptor binding region Hc is also an important protective antigen, and can induce the organism to generate a strong protective effect. The tetanus recombinant subunit vaccine does not need to culture tetanus bacteria or purify tetanus toxin, so that the production process is safer and more efficient, and the tetanus toxin (toxoid molecule) inactivated by formaldehyde is replaced potentially to become a novel vaccine variety.

The multi-linked multivalent vaccine is a main development trend of vaccine industry at home and abroad, and depends on three engineering technologies of genes, fermentation and proteins, and the multi-linked multivalent vaccine has important progress in two key technologies of screening and preparing more effective pathogen protection antigens and efficient and stable preparation technology. The multi-linked multivalent vaccine can simultaneously immunize and protect a plurality of pathogens, and particularly, one vaccine can protect a plurality of pathogens, so that the multi-linked multivalent vaccine has remarkable advantages and application prospects. In view of the characteristics of botulinum toxin such as multiple serotypes and multiple subtypes, and the complex and diversified strains of toxin-producing bacteria, the botulinum toxin has diversity and variability, and the monovalent vaccine is difficult to protect multiple biotoxins or poisoning caused by multiple biotoxins at the same time. Therefore, the research of multivalent biotoxin antigen vaccine by means of mature monovalent candidate vaccine protective antigen has important significance and application prospect aiming at various botulinum toxin and tetanus toxin pathogens, and the multivalent vaccine can protect a plurality of botulinum toxins or botulinum toxins and tetanus toxins simultaneously.

Disclosure of Invention

The invention aims to provide a multivalent biotoxin antigen vaccine assembled based on a double receptor binding domain RBD, and a preparation method and application thereof.

In a first aspect, the invention claims a multivalent biotoxin molecule antigen vaccine.

In the present invention, the biotoxin is tetanus toxin or botulinum toxin.

The invention discloses a multivalent biotoxin molecular antigen vaccine, which comprises a fusion protein formed by connecting Hc antigen of biotoxin 1 and Hc antigen of biotoxin 2 through connecting peptide as active components;

the biotoxin 1 and the biotoxin 2 are two different biotoxins;

the biotoxin is selected from the following: tetanus toxin or other botulinum toxins of the non-E type.

In particular embodiments of the invention, the other botulinum toxin than type E is in particular botulinum toxin type A or type B or type H.

Further, the active ingredients of the multivalent biotoxin molecular antigen vaccine are specifically any one of the following:

(A1) A fusion protein formed by connecting Hc antigen of A-type botulinum toxin and Hc antigen of tetanus toxin through connecting peptide according to the sequence from amino acid to carboxyl end, and the fusion protein is named AHc-THc;

(A2) A fusion protein formed by connecting Hc antigen of tetanus toxin and Hc antigen of botulinum toxin A through connecting peptide according to the sequence from amino acid to carboxyl end, and the fusion protein is named as THc-AHc;

(A3) A fusion protein formed by connecting Hc antigen of A-type botulinum toxin and Hc antigen of B-type botulinum toxin through connecting peptide according to the sequence from amino acid to carboxyl end, and the fusion protein is named AHc-BHc;

(A4) A fusion protein formed by connecting Hc antigen of type B botulinum toxin and Hc antigen of type H botulinum toxin through connecting peptide in sequence from amino acid to carboxyl end is named BHc-HHc.

Further, the connecting peptide is (G4S) 3, and the specific amino acid sequence is: GGGGSGGGGSGGGGSGS.

Further, the amino acid sequence of the Hc antigen of the botulinum toxin type A is shown in SEQ ID No. 10.

Further, the amino acid sequence of the Hc antigen of the botulinum toxin type B is shown in SEQ ID No. 12.

Further, the amino acid sequence of the Hc antigen of the H-type botulinum toxin is shown in SEQ ID No. 8.

Further, the amino acid sequence of the Hc antigen of tetanus toxin is shown as SEQ ID No. 16.

More specifically, the amino acid sequence of AHc-THc is shown as SEQ ID No. 18.

More specifically, the amino acid sequence of the THc-AHc is shown as SEQ ID No. 20.

More specifically, the amino acid sequence of AHc-BHc is shown in SEQ ID No. 26.

More specifically, the amino acid sequence of BHc-HHc is shown in SEQ ID No. 28.

In a second aspect, the invention claims a method of preparing a multivalent biotoxin molecular antigen vaccine as set forth in the first aspect above.

The claimed method of preparing a multivalent biotoxin molecular antigen vaccine as set forth in the first aspect of the invention may comprise the steps of: introducing a nucleic acid molecule encoding the fusion protein into an E.coli receptor cell to obtain recombinant E.coli; culturing the recombinant escherichia coli to obtain the recombinant escherichia coli as the fusion protein; the multivalent biotoxin molecular antigen vaccine is then prepared with the fusion protein as an active ingredient.

Further, the nucleic acid molecule sequence of Hc antigen of the botulinum toxin type A is shown as SEQ ID No. 9.

Further, the nucleic acid molecule sequence of Hc antigen of the botulinum toxin type B is shown as SEQ ID No. 11.

Further, the nucleic acid molecule sequence of Hc antigen of the H-type botulinum toxin is shown in SEQ ID No. 7.

Further, the nucleic acid molecule sequence of Hc antigen of the tetanus toxin is shown as SEQ ID No. 15.

Further, the nucleic acid molecule encoding the AHc-THc is shown in SEQ ID No. 17.

Further, the nucleic acid molecule encoding the THc-AHc is shown in SEQ ID No. 19.

Further, the nucleic acid molecule encoding the AHc-BHc is shown in SEQ ID No. 25.

Further, the nucleic acid molecule sequence encoding the BHc-HHc is shown in SEQ ID No. 27.

In the method, in the process of culturing the recombinant escherichia coli, adding IPTG to a final concentration of 0.4mmol/L when the recombinant escherichia coli is cultured to a logarithmic growth phase, and then culturing at 30 ℃ for 4-5 h or overnight at 18 ℃; and after the culture is finished, collecting thalli, carrying out ultrasonic crushing, centrifuging and collecting supernatant, and obtaining the fusion protein from the supernatant.

Further, the step of purifying the supernatant by a Ni-NTA affinity column or a streptavidin affinity column is included after the centrifugation.

In both aspects, the multivalent biotoxin molecule antigen vaccine contains an adjuvant in addition to the active ingredient.

Further, such as aluminum adjuvants.

In a third aspect, the invention claims any of the following:

(B1) A protein which is a fusion protein as described in the first aspect hereinbefore;

(B2) A nucleic acid molecule, which is a nucleic acid molecule as described in the first aspect above, encoding (B1) the protein;

(B3) A recombinant vector, expression cassette, transgenic cell line or recombinant bacterium comprising the nucleic acid molecule of (B2);

(B4) A product for the prevention and/or treatment of a toxic condition caused by botulinum toxin and/or tetanus toxin, comprising (B1) the protein of (B2) the nucleic acid molecule of (B3) or the recombinant vector, expression cassette, transgenic cell line or recombinant bacterium of (B3).

In a fourth aspect, the invention claims the use of a protein as described in (B1) or a nucleic acid molecule as described in (B2) or a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium as described in (B3) in the third aspect hereinbefore for the preparation of a product for the prevention and/or treatment of a toxic condition caused by botulinum toxin and/or tetanus toxin. Wherein the botulinum toxin may also be botulinum toxin type H.

The applicant establishes a technical platform for researching the front foundation and the immunity efficacy of each functional domain of the botulinum toxin, systematically completes the research on the biological activity and the immunity efficacy of each functional epitope of the botulinum toxin such as A, B, E, F, H and the like, determines a series of novel functional epitopes and immune molecules with strong protection efficacy, such as receptor binding regions A/B-Hc or light chain-transmembrane regions E/F-L-HN and the like, and provides abundant candidate protective antigen molecules for developing broad-spectrum efficient multivalent botulinum toxin vaccines. In addition, the invention explores the immune efficacy of each functional domain epitope antigen of the H-type botulinum toxin, and the result shows that the H-type receptor binding region HHc also has strong protective effect, and has strong cross protective effect with the A-type botulinum toxin receptor binding region AHc. Given that botulinum toxin and tetanus toxin receptor binding domain Hc (Receptor binding domain, RBD) are important protective antigens, they can be subunit vaccine candidates. According to the technical scheme, the Hc antigens in the receptor binding regions of different serotypes of botulinum toxin or tetanus toxin are fused and assembled into a double Hc antigen molecular structure by utilizing a recombination technology, and the double Hc fusion antigen molecules are prepared into double Hc fusion antigen molecules by biosynthesis, and are used as multivalent biotoxin vaccines for preventing various biotoxin pathogens.

Based on the concept and technology, the invention explores a series of double Hc (or double receptor binding domain RBD) fusion antigen molecules, and verifies the feasibility of the technical scheme and the effectiveness of the protection effect of multivalent vaccine antigen molecules. For example, the fusion molecule structure combination of the botulinum toxin type A and the tetanus toxin prepares AHc-THc and THc-AHc antigen molecules, and the results show that the AHc-THc and the THc-AHc antigen molecules have correct structural characteristics and biological activity, can be used as subunit vaccines to generate strong protection effect against the botulinum toxin type A and the tetanus toxin, and can also cross-protect H-type novel botulinum toxin. Similarly, other combinations of types, such as AHc-BHc and BHc-HHc, etc., can also produce strong protection against botulinum toxins of types A and B, etc. The results show that a single fusion antigen molecule vaccine can generate protective efficacy against two or three different serotypes of toxin pathogens, and can be used as a broad-spectrum multivalent vaccine for the prevention and prophylactic treatment of biotoxins. The results show that the technology based on the multivalent biotoxin antigen assembled by the RBD of the double receptor binding region is feasible and can be applied to research and development of multivalent vaccines of various biotoxin pathogens.

Drawings

FIG. 1 is a diagram showing SDS-PAGE electrophoresis and Western Blot identification of functional domains HL, HHc, HHN, HL-HN protein of purified H-type botulinum toxin. A is SDS-PAGE identification of functional domain proteins of the H-type botulinum toxin and other protein antigens, and lanes 1-7 are FHc, AHc, FL-HN, HL, HHc, HHN and HL-HN protein samples, respectively. Wherein FHc shows botulinum toxin type F Hc; FL-HN shows the botulinum toxin F, L-HN; AHc shows botulinum toxin type A Hc, which all act as control functional domain proteins. B is Western blot identification of protein antigens of various botulinum toxin receptor binding regions (detection result of the primary antibody of the hyperimmune serum of the murine anti-H-type botulinum antitoxin receptor binding region), and lanes 1-3 are HHc, AHc, FHc respectively. C is Western blot identification of protein antigens of various botulinum toxin receptor binding regions (detection result of primary immune serum of horse-derived anti-botulinum antitoxin A receptor binding region), and lanes 1-3 are HHc, AHc, FHc respectively. D is Western blot identification of functional binding regions of H-type botulinum toxin L and HN and FL-HN protein antigen (detection result of the primary antibody of the hyperimmune serum of murine anti-F-type botulinum toxin FL-HN), and lanes 1-4 are HL, HN, HL-HN and FL-HN respectively. E is Western blot identification of functional binding regions of H-type botulinum toxin L and HN and FL-HN protein antigen (detection result of the primary antibody of the hyperimmune serum of murine anti-H-type botulinum toxin HL-HN), and lanes 1-4 are HL, HN, HL-HN and FL-HN respectively. Within the box is the protein of interest. M is protein Marker (170, 130, 90, 70, 55, 40, 35, 25, 15 and 10kDa from top to bottom).

FIG. 2 is a schematic diagram of the structure of a multivalent biotoxin antigen vaccine molecule based on dual receptor binding domain RBD assembly. Remarks: the receptor binding regions Hc and assembly sequences of the various botulinum toxins and tetanus toxins selected are shown in the figures, the numbers in brackets indicate the amino acid sequence information of the receptor binding region Hc, and the two receptor binding regions Hc-RBD pass (G4S) ₃ The linker peptide assembles into a dual receptor binding domain Hc molecule. GS linker (G4S) ₃ And (3) connecting peptides.

FIG. 3 shows SDS-PAGE and Western Blot identification of purified THc-linker-AHc and AHc-linker-THc, THc, AHc antigen proteins obtained after biosynthesis. Lanes 1-4 are THc-linker-AHc (100 kDa), AHc-linker-THc (100 kDa), THc (50 kDa), AHc (50 kDa) protein samples, respectively; m is a protein Marker (170, 130, 90, 70, 55, 40 and 35kDa in sequence from top to bottom). A is the SDS-PAGE identification of the tetanus toxin and botulinum toxin type A fusion receptor binding domain THc-linker-AHc antigen, the AHc-linker-THc antigen, the tetanus toxin receptor binding domain THc antigen alone, and the botulinum toxin type A receptor binding domain AHc antigen. B is Western blot identification of the fusion receptor binding region of tetanus toxin and botulinum toxin type A and the antigen of the receptor binding region alone (assay result of horse source botulinum antitoxin type A standard as primary antibody). C is Western blot identification of the fusion receptor binding region of tetanus toxin and botulinum toxin type A and the antigen of the receptor binding region alone (assay result of the murine anti-tetanus toxin receptor binding region with the hyperimmune serum as primary antibody).

FIG. 4 shows SDS-PAGE electrophoresis identification of recombinant AHc-linker-EHc, EHc-linker-AHc, AHc-linker-BHc, BHc-linker-HHc proteins obtained by purification after biosynthesis. In A, lane 1 shows a control strain that does not express the protein of interest; lane 2 shows a biosynthetic strain expressing EHc-linker-AHc protein; lane 3 shows the EHc-linker-AHc protein (100 kDa) obtained by purification; lane 4 shows a strain biosynthetically expressing AHc-linker-EHc protein; lane 5 shows the AHc-linker-EHc protein (100 kDa) obtained by purification. In B, lane 1 shows a control strain that does not express the protein of interest; lane 2 shows a biosynthetic AHc-linker-BHc protein-expressing strain; lane 3 shows the AHc-linker-BHc protein (100 kDa) obtained by purification; lane 4 shows a strain biosynthetically expressing BHc-linker-HHc protein; lane 5 shows the purified BHc-linker-HHc protein (100 kDa).

FIG. 5 shows the results of antibody levels of various functional domains HL, HHc, HHN, HL-HN protein antigens of H-type botulinum toxin after immunization of mice. A is the antibody titer of HL, HHN, HL-HN and HHc antigen immune serum against the respective antigens; b is the anti-AHc and anti-FL-HN antigen antibody titer of HHc and HL-HN antigen immune serum.

FIG. 6 shows the results of antibody levels after combined immunization of mice with tetanus toxin and botulinum toxin type A double receptor binding domain Hc fusion molecules and functional epitope antigen proteins of the receptor binding domain alone. A is the antibody titer of the recombinant antigens THc-linker-AHc, AHc-linker-THc, AHc+THc against each recombinant antigen (THc-linker-AHc, AHc-linker-THc, AHc+THc) of serum after 1 μg of group 1 immunization and 2 immunization of mice in combination with 1 μg of group 1 immunization and 2 immunization of groups. B is the anti-AHc antibody titer of serum after 1 μg and 4 μg groups of recombinant antigens THc-linker-AHc, AHc-linker-THc 1 immunization and 2 immunizations, THc+AHc combined with 1 μg group of 1 immunization and 2 immunizations of mice. C is the anti-THc antibody titer of serum after 1 μg and 4 μg groups of recombinant antigens THc-linker-AHc, AHc-linker-THc 1 immunization and 2 immunizations, THc+AHc in combination with 1 μg group of 1 immunization and 2 immunizations of mice.

And (3) injection: all data GraphPad Prism 5.0 of the experiment are analyzed, the average value + -standard error (mean + -SD) is used for the experimental result, and the statistical significance of the difference between paired experiments is analyzed by adopting a t-test method or a chi-square test method.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The methods used in the examples below are conventional methods unless otherwise specified, and specific steps can be found in: molecular Cloning: A Laboratory Manual (Sambrook, J., russell, david W., molecular Cloning: A Laboratory Manual, 3) ^rd edition,2001,NY,Cold Spring Harbor) and pharmacopoeia of the people's republic of China (national pharmacopoeia Committee, three parts in 2020, chemical industry Press).

The following examples first explore the immunopotency of epitope antigens of various functional domains of botulinum toxin type H, and the results demonstrate that H receptor binding domain HHc also has strong protective effects and that it has strong cross-protective effects with botulinum toxin type A receptor binding domain AHc. A series of double Hc fusion antigen molecules were then designed and prepared, and their structural characteristics and immunological activity were systematically evaluated to evaluate the protective efficacy of a single fusion antigen molecule vaccine against a variety of different toxin pathogens. The technical scheme aims to fuse RBD antigen proteins of binding regions of biotoxin receptors of different serotypes into a double Hc antigen molecular structure by utilizing a recombination technology, and the double Hc fusion antigen molecules are assembled and prepared into double Hc fusion antigen molecules, and are used as multivalent biotoxin vaccines for preventing various toxin biological agents.

EXAMPLE 1 expression purification and identification of functional Domain epitope recombinant proteins of botulinum toxin types I, H in E.coli Gene design and Synthesis of functional Domain epitope recombinant proteins of botulinum toxin types I (L, HN, L-HN and Hc)

The recombinant protein genes for coding each functional epitope of the H-type botulinum toxin are artificially optimized and synthesized according to the degeneracy of codons, and are directly cloned into cloning vectors such as pMD18-T (TaKaRa) vectors and the like to respectively code HL, HHN, L-HN and HHc (detailed recombinant proteins and sequence information are shown in Table 1). When cloning these artificially synthesized genes, ecoR I was introduced into the 5 'end and Xho I cleavage recognition sites were introduced into the 3' end of each functional epitope antigen gene for the convenience of the following procedures.

The gene design adopts common codons of escherichia coli, and ensures that the coded amino acid residue sequence is unchanged. All functional epitope antigen genes are optimized according to the full-length gene sequence and amino acid residue sequence (BoNT/H, strain WP_047402807.1, full length 1288 amino acids) of the H-type botulinum toxin, and the expression of the genes is facilitated.

Table 1, basic information Table of epitope antigen of functional Domain of botulinum toxin type H

2. Construction of the recombinant prokaryotic expression vectors

The plasmids obtained above were digested with EcoR I and Xho I, and the corresponding target gene fragments were recovered with a DNA recovery kit, respectively, and ligated with the prokaryotic expression vectors pTIG-Trx digested with the same enzymes (see patent: ZL 200710089588.2), the ligation products were transformed into E.coli (E.coli) DH 5. Alpha. Competent cells, positive clones were selected, plasmids were extracted, and the recombinant prokaryotic expression vectors having the correct sequences and insert positions were obtained, and named pTIG-Trx-HL, pTIG-Trx-HHN, pTIG-Trx-HL-HN and pTIG-Trx-HHc, respectively, depending on the insert fragments.

3. Expression of recombinant proteins in E.coli and purification and identification of expression products

1. SDS-PAGE detection of expression of recombinant proteins in E.coli and expression products

The 4 recombinant prokaryotic expression vectors constructed in the second step are respectively transformed into competent cells (TIANGEN company) of escherichia coli BL21 (DE 3), positive recombinants are screened, recombinant bacteria transformed with pTIG-Trx empty vector are used as negative control, then the positive recombinant bacteria are inoculated into 500mL of LB liquid medium containing 100mg/mL of ampicillin according to the proportion of 1:100, mass culture is carried out at 37 ℃ and 250rpm, and the culture is carried out until logarithmic growth phase (OD ₆₀₀ About 0.6 to 0.8), adding a chemical inducer IPTG to a final concentration of 0.4mmol/L, and shaking at 18℃for 220r/min overnight or at 30℃for 220r/min for 4 to 5 hours. After the culture, cells were collected by centrifugation, resuspended in 20mM sodium phosphate buffer (pH 8.0), sonicated, and the supernatant was collected by centrifugation for 12% SDS-PAGE, which indicated that the recombinant proteins induced to be expressed were expressed and were present in a soluble form, whereas the non-induced strain and the induced empty vector controls did not show the protein band of interest, indicating that the expressed proteins might be the proteins of interest, i.e., the recombinant proteins.

2. Purification and identification of expression products

The C-terminal of each recombinant protein expressed in the step 1 contains six histidine tags, so that the soluble expression product is purified by using Ni-NTA affinity chromatography column (French Ind.) and referring to the specification to obtain eluted and purified proteins, and then the purified proteins are subjected to 12% SDS-PAGE detection, and the detection result shows that the purified target proteins are obtained. The obtained target protein is stored at-20deg.C or-80deg.C for use. FIG. 1A shows SDS-PAGE patterns of purified 4 target proteins.

3. Western blot identification of expression products

The method is characterized in that murine anti-H-type botulinum toxin or anti-A and anti-F-type botulinum toxin serum antibodies (anti-various toxin functional structural domain super-immune serum antibodies prepared in the laboratory) are used as primary antibodies, immune serum antibodies are collected after animals are immunized for 3-4 times by recombining Hc and the like, horseradish peroxidase (HRP) is used as secondary antibodies for marking rabbit anti-mouse IgG (Sigma company), western blot analysis (B and E in figure 1) is carried out on each purified recombinant protein, and the result shows that the prepared target protein is specifically combined with anti-H-type botulinum toxin antibodies such as anti-HHc (B in figure 1) or HL-HN serum antibodies (E in figure 1), the size position of a positive band is consistent with the electrophoresis position, and the size of the positive band is equivalent to the theoretical size of each recombinant protein, so that the purified recombinant protein is the target protein. In addition, the present invention also identified its antigenic cross-reactivity with other serotypes (C and D in FIG. 1), and the results indicated that anti-botulinum toxin type A Hc serum antibodies were significantly cross-reactive with botulinum toxin type H (C in FIG. 1), did not bind to botulinum toxin type F Hc, and did not cross-react with botulinum toxin type H (D in FIG. 1).

In short, the gene sequence of each functional domain of H-type botulinum toxin is cloned by using a genetic engineering technology and connected to a prokaryotic expression vector pTIG-Trx to obtain a recombinant expression plasmid, the efficient soluble expression of the recombinant plasmid in escherichia coli is realized by optimizing the induction expression condition, and the recombinant expression is realized by using a HisTrap ^TM The HP protein purification column is used for purifying recombinant proteins with higher purity and good stability, and provides a basis for comparing the immunoprotection efficacy of different protein functional domain molecules.

EXAMPLE 2 expression purification and identification of various double receptor binding Hc-RBD fusion molecule recombinant proteins in E.coli

1. Gene design and synthesis of Hc-RBD fusion molecule recombinant protein of various double-receptor binding regions

Genes encoding various botulinum toxin and tetanus toxin receptor binding regions Hc-RBD (AHc, BHc, EHc and THc) and the like (detailed receptor binding regions Hc and sequence information are shown in Table 2) are artificially optimized and synthesized according to codon degeneracy, and are directly cloned into cloning vectors such as pMD18-T vectors for later use. When cloning these artificially synthesized genes, ecoR I and BamH I cleavage recognition sites were introduced at the 5 'end and Xho I cleavage recognition sites were introduced at the 3' end of one Hc gene, and at the 5 'end and the 5' end of the other Hc gene, in order to facilitate the following ligation operations.

The gene design adopts common codons of escherichia coli, and ensures that the coded amino acid residue sequence is unchanged. The Hc gene of all the receptor binding regions of various biotins is optimized according to the full-length gene sequences and amino acid residue sequences of various botulinum toxins (such as botulinum toxin type A, strain 62A, full-length 1296 amino acids, botulinum toxin type B, strain OKra, full-length 1291 amino acids, botulinum toxin type E, strain Beluga or NCTC11219, full-length 1252 amino acids, tetanus toxin, strain CMCC64008 and full-length 1315 amino acids), and the biosynthesis and expression of biotoxin gene proteins are facilitated.

TABLE 2 basic information about botulinum toxin and tetanus toxin receptor binding region Hc

2. Construction and identification of the recombinant prokaryotic expression vectors

First, in order to conveniently clone a plurality of target genes into a prokaryotic expression vector pTIG-Trx (see patent ZL 200710089588.2), bamHI and a Linker peptide Linker- (G4S) are first introduced into the present invention ₃ Cloning between EcoR I and Xho I of pTIG-Trx, so that the entire vector has three cloning sites (EcoR I, bamH I and Xho I; wherein the Linker peptide Linker- (G4S) precedes BamH I) ₃ ) Two different genes can be conveniently cloned, and the expression vector is named pTIG-Trx-M. In addition, in order to enrich the method for purifying target protein, the invention also replaces the his tag of the expression vector pTIG-Trx-M with the Tain Strep tag through two enzyme cleavage sites of Xho I and Sac I The expression vector was named pTIG-Trx-M-TS and thus the protein of interest could be purified by Strep-tag, tag (gene sequence TGGAGCCACCCCCAGTTCGAGAAGGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCAGCGCCTGGAGCCACCCCCAGTTCGAGAAG and encoding amino acids W-S-H-P-Q-F-E-K- (G-G-G-S) 2-G-G-S-A-W-S-H-P-Q-F-E-K).

The plasmids containing the target gene sequences obtained in the first step are digested with EcoR I and BamH I or BamH I and Xho I, the corresponding target gene fragments are recovered by a DNA recovery kit, and are connected with prokaryotic expression vectors pTIG-Trx-M or pTIG-Trx-M-TS digested with the same enzymes, the connection products are transformed into E.coli DH5 alpha competent cells, positive clones are screened, plasmids are extracted, sequencing is carried out, and recombinant prokaryotic expression vectors with correct sequences and insertion positions are obtained, and the recombinant prokaryotic expression vectors are named as pTIG-Trx-AHc-THc, pTIG-Trx-THc-AHc, pTIG-Trx-AHc-EHc, pTIG-Trx-EHc-AHc, pTIG-Trx-AHc-BHc and pTIG-Trx-BHc-HHc according to the insertion fragments.

3. Expression of each recombinant double Hc fusion protein molecule in escherichia coli and purification and identification of expression products

1. SDS-PAGE detection of expression of each recombinant double Hc fusion protein molecule in escherichia coli and expression products

The recombinant prokaryotic expression vector constructed in the second step is transformed into competent cells of escherichia coli BL21 (DE 3) (TIANGEN company), positive recombinants are screened, recombinant bacteria transformed with pTIG-Trx empty vector are used as negative control, then the positive recombinant bacteria are inoculated into 500mL of LB liquid medium containing 100mg/mL of ampicillin according to the proportion of 1:100, mass culture is carried out at 37 ℃ and 250rpm, and the culture is carried out until the logarithmic phase (OD ₆₀₀ About 0.6 to 1.0), the chemical inducer IPTG was added to a final concentration of 0.4mmol/L, and the culture was performed at 30℃for 4 to 5 hours with shaking at 220r/min or overnight with shaking at 18℃with shaking at 220 r/min. After the end of the culture, the cells were collected by centrifugation, resuspended in 20mM sodium phosphate buffer (pH 8.0), sonicated, and the supernatant collected by centrifugation was subjected to 12% SDS-PAGE, which indicated that the recombinant proteins induced to be expressed were expressed and could exist in a soluble manner, whereas the uninduced strain and the induced empty vector control did not appearThe protein band of interest indicates that the expressed protein may be the protein of interest, i.e., each recombinant antigen.

2. Purification and identification of expression products

The C-terminal of each recombinant toxin protein molecule expressed in the step 1 contains six histidine or streptavidin TS tags, so that a Ni-NTA affinity chromatography column (French Co.) or a streptavidin affinity chromatography column (Daidae Biotechnology Co., ltd.) is used for purifying the soluble expression product by referring to the instruction book, and the eluted and purified protein is obtained, and then 12% SDS-PAGE detection is carried out on the purified protein, and the detection result shows that the purified target protein is obtained. The obtained target protein is stored at-20deg.C or-80deg.C for use. FIG. 2 is a schematic diagram showing the structure of a multivalent biotoxin antigen vaccine molecule based on double receptor binding domain RBD assembly designed and biosynthesized by the present invention. FIGS. 3 and 4 show SDS-PAGE electrophoresis identification of purified target proteins (THc-linker-AHc, AHc-linker-THc, AHc-linker-EHc, EHc-linker-AHc, AHc-linker-BHc and BHc-linker-HHc).

3. Western blot of expression product

The method uses horse-derived toxin standards (purchased from Chinese food and drug verification institute) and polyclonal antibodies (hyperimmune serum antibodies prepared in the experiment) of anti-toxin receptor binding regions of various types as primary antibodies, uses horseradish peroxidase (HRP) labeled rabbit anti-horse IgG (Sigma company) as secondary antibodies, carries out Western blot on purified double Hc fusion protein molecules, and shows that the expressed target proteins are specifically bound with the antibodies in the toxin standards of various types, so that the target proteins contain the Hc functional domains of various corresponding toxins, and are consistent with theoretical design. The results of the identification of double Hc fusion protein molecules of tetanus toxin and botulinum toxin type A are shown in the figures 3, the size position of the positive band is consistent with the electrophoresis position, and the size of the positive band is equivalent to the theoretical size of the recombinant protein molecule, which shows that the purified recombinant protein is the target protein and contains the Hc functional domain of the receptor binding region of the two toxins.

In a word, the gene sequence of Hc functional domain of each type of toxin receptor binding region is cloned by using genetic engineering technology and connected to a prokaryotic expression vector pTIG-Trx series to obtain recombinant expression plasmid, high-efficiency soluble expression and biosynthesis of the recombinant plasmid in escherichia coli are realized through optimizing the induction expression condition, and recombinant biotoxin protein molecules with higher purity and good stability are purified through a HisTrapTM HP protein purification column or a streptavidin affinity chromatography column (figure 4), so that a foundation is provided for exploring the immune protection efficacy of different biotoxin proteins as subunit vaccines.

The structure and property information of the resultant fusion molecules of the Hc double receptor binding regions are shown in table 3.

TABLE 3 Hc fusion molecular Structure and Property information for each double receptor binding region

Note that: each double-receptor binding region Hc fusion molecule consists of two functional domains of receptor binding regions Hc derived from two different biotoxins, which are connected through a GS connecting peptide (linker) with a gene sequence of GGCGGTGGCGGTAGTGGCGGTGGCGGTAGCGGCGGTGGCGGTAGTGGATCC; the amino acid sequence is GGGGSGGGGSGGGGSGS.

EXAMPLE 3 detection of antibody level and protection of H-botulinum toxin after immunization of mice with epitope antigen proteins of functional domains of H-botulinum toxin

Given that botulinum toxin type H is a novel serotype toxin, it can also cause toxicity in humans, and no specific antibodies or vaccines are currently available to protect it. Thus, the present invention explores the immunopotency of epitope antigens of various functional domains of botulinum toxin type H, as well as its immunological cross-reactive properties with protective antigens of other botulinum toxins type serotypes.

The recombinant protein antigens prepared in example 1 above were individually immunized into mice and tested for immunogenicity and protection. The specific method comprises the following steps: balb/c mice (6-8 weeks, female, SPF grade, purchased from laboratory animal center of the military medical institute) were randomly grouped into 10 animals each, with an immunization dose of 1. Mu.g or 10. Mu.g antigen protein per mouse, respectively, while the negative control group was immunized with no immunization PBS containing recombinant protein was combined with aluminum adjuvant (Alhydrogel) at a final concentration of 1mg/ml ^TM 2.0%, bontai (Brenntag Biosector) company product), and two or three times at 3 week intervals, the mice were bled after two or three immunizations, and then tested for protection with each botulinum toxin (BoNT/a/F/H, where examples 3-4 were mainly tested for protection with botulinum toxin type H, and example 5 were tested for protection with three botulinum toxins types A, F and H) for challenge to evaluate protein antigen protection (one week observation, statistics), and mice serum antibody levels were tested by ELISA and neutralization titers were determined by classical in vivo neutralization experiments, as follows.

Serum antibody levels were determined by ELISA (coating each recombinant antigen with an enzyme-linked immunosorbent assay plate at a concentration of 2 μg/mL, using isolated immunized mouse serum as primary antibody, and HRP-labeled goat anti-mouse IgG (Santa Cruz Biotechnology, inc.) as secondary antibody). Mice serum of immune group diluted by PBS and used as negative control (N), OD of immune group ₄₉₂ The value (P) reaches more than 0.5, and the P/N is more than or equal to 2.1 and positive. Antibody levels for each group are expressed as mean ± standard error.

In vivo neutralization activity and neutralizing antibody titers of immunized mouse serum antibodies were determined by classical in vivo neutralization experiments, with serum antibody titers reported in International units per milliliter (IU/ml), one IU being defined as neutralization 10 ⁴ LD ₅₀ Neutralizing antibodies to botulinum toxin type A/F/H (note: reference to this protocol in relation to botulinum toxin neutralizing antibody assays, this time using botulinum toxin type H as the primary source, other neutralizing antibodies only replace botulinum toxin type different, and assays reference this method). The following protocol was designed to determine the serum neutralization titers of mice (cf. Chinese pharmacopoeia 2020 edition).

(1) The toxin is diluted with the sample to be tested. Diluting toxin to 100LD ₅₀ /ml. The mouse serum is then diluted to a factor equivalent to the corresponding toxin, e.g., about 200-fold to 0.1IU/ml of serum, at the expected titer. And simultaneously diluting the antitoxin standard substance to a corresponding concentration.

(2) The toxin binds to the sample to be tested in vitro. Diluted 1ml of toxin was mixed with different volumes of diluted serum or antitoxin standard (purchased from chinese food and drug assay institute) and 5 gradients were set per group. The toxin and the antibody are uniformly mixed by supplementing the diluent to the final volume of 2.5ml, and the mixture is placed in a 37 ℃ incubator for 15min so as to fully react the toxin and the antibody.

(3) Animals were dosed and observed. SPF-class female KM mice, 15-18g, were randomly grouped, 4 per group. The incubated biotoxin and antitoxin standard or test sample combined samples were intraperitoneally injected into mice at a dose of 500 μl/sample, 4 per dilution of each sample. Animals were observed daily for morbidity and mortality for 7 consecutive days. Comparing the 50% protection end points of animals in the experimental group with the 50% death end points of the biotoxin standard animal group, and calculating the titer of the serum (refer to the 2020 edition of Chinese pharmacopoeia).

The results shown in Table 4 and in FIG. 5A demonstrate that each of the recombinant antigens HL, HHN, HL-HN and HHc produced an antibody response to itself, and that each of the immunized groups produced a protective response at different doses and numbers of immunizations, and also exhibited positive dose correlation. However, the protective effect against toxins and the neutralizing antibody level were different, and different doses and the number of immunizations of HL-HN and HHc groups produced strong protective effects, whereas HHN was a weaker protein antigen, producing partial protective effects, and HL was not.

TABLE 4 results of protection level of functional Domain epitope antigen proteins of botulinum toxin H after immunization of mice

Note that: 2 x represents the secondary immunization group, 3 x represents the tertiary immunization group; protective experiments were performed 3 weeks after the last immunization with different doses of botulinum toxin type H challenge; survival/total number represents the level of protection, with 10 animals per group tested. Serum neutralizing antibodies were determined using classical in vivo neutralization experiments. At the level of protection, HL group andthe HN group has very obvious statistical difference compared with the Hc group and the HL-HN group ^*** p＝0.00001<0.001). ND shows no protective test for this dose group.

EXAMPLE 4 dose-dependent immunoprotection results of the H-botulinum toxin functional domains Hc and L-HN protein antigens

To further evaluate the protective efficacy of THc and TL-HN at low doses, the present invention conducted protective experimental studies on these two protein antigens at different doses once or three weeks after two. The dose-dependent immunoprotection protocol for recombinant Hc and L-HN antigens for botulinum toxin H is as follows: the doses of recombinant Hc and L-HN antigen and Hc+L-HN combination antigen were 4000, 1000, 250, 62.5, 15.6 and 3.9 ng/dose, 1 or 2 immunizations were performed in this order, as in example 3 above. The 1 immunization group was immunized three weeks after the first immunization with 10 ² LD ₅₀ Toxin, 2 immunization groups were immunized three weeks after the second immunization with 10 ³ LD ₅₀ Toxin challenge, one week of observation, statistics of survival results. Calculation of the half-dose ED for each group using the probability analysis method (SPSS 17.0-Probit) ₅₀ The value, expressed as the efficacy of the vaccine.

The results shown in Table 5 demonstrate that three immune groups HHC, HL-HN and HHc +HL-HN all produce strong protection after immunization at different doses, and half the effective dose ED of the HHC, HL-HN and HHc +HL-HN groups after one immunization ₅₀ 96.319 ng,673.105ng and 32.144ng, respectively; half-dose ED of HHC, HL-HN and HHc +HL-HN groups after two immunizations ₅₀ 2.193ng,8.262ng and 4.478ng, respectively.

The HHc antigen group produced a stronger protective effect than the HL-HN antigen group, indicating that it is the strongest subunit vaccine antigen. The protection efficacy of the HHc +HL-HN antigen group after 1 immunization is highest, which shows that the combined group has a synergistic effect compared with HHc and HL-HN independent groups, and reflects that more neutralizing antibody epitopes induce stronger immune effect; while the protective effect of the HHc antigen group after two immunizations was strongest. The results further show that HHc is far superior to HL-HN as an immune antigen, and particularly has more obvious effect under the conditions of low dosage and less immunization times. Thus, the results of the present invention verify and support HHc as its protective antigen.

TABLE 5 protection level results after different doses of recombinant botulinum toxin type H HHc and HL-HN antigen to immunized mice

Note that: the HHc +HL-HN group is combined immunization of two antigen groups; the 1 immunization group was immunized three weeks after the first immunization with 10 ² LD ₅₀ Toxin, 2 immunization groups were immunized three weeks after the second immunization with 10 ³ LD ₅₀ Toxin challenge, one week of observation, statistics of survival results.

EXAMPLE 5 protection of botulinum toxin type H functional Domain epitope antigen protein against A, F and botulinum toxin type H after immunization of mice

Given that both HL-HN and HHc functional domains are important protective antigens and that they have sequence homology to botulinum toxin type a and F related functional domains, the present invention further explores their cross-protective effect with botulinum toxins type a and F. Experimental protocol the same as in example 3, i.e.HL-HN and HHc, the immunization dose was 1. Mu.g or 10. Mu.g of antigen protein per mouse, respectively, and the animals were bled and tested for protection after two or three immunizations with 3 weeks of booster immunization (amounts of antigen protein and aluminium adjuvant are as above).

The results shown in FIG. 5B demonstrate that the HL-HN and HHc immune serum antibodies cross-react with both FL-HN and AHc, which are related to their high homology in sequence with FL-HN and AHc. However, the HL-HN and HHc functional domain antigens were both immunized 2 and 3 times at doses of 1 μg and 10 μg and were evaluated in protective assays, which indicated that the HL-HN recombinant antigen was not resistant to 100LD ₅₀ Attack by botulinum toxin type F, without any protective effect; while HHc antigen is able to completely fight 1000LD ₅₀ Challenge with botulinum toxin type a, and high titers of neutralizing antibodies are also contained in immune serum. HHc functional domains were 2.0 and 10.0IU/ml for neutralizing antibodies against botulinum toxin type H, respectively, after 2 immunizations at 1 μg and 10 μg doses, while neutralizing antibodies against botulinum toxin type A were 0.5 and 4.0IU/ml, respectively, indicating cross-over between themThe cross-guard neutralizes the antibodies. Thus, the above results suggest that protection is directly related to neutralizing antibodies.

In addition, the present invention continues to develop dose-dependent cross-immune protective studies of recombinant Hc botulinum toxin type H and recombinant Hc botulinum toxin type A. The scheme is as follows: the doses of recombinant HHc and AHc antigen were 4000, 1000, 250, 62.5, 15.6 and 3.9 ng/dose, 2 immunizations were performed, as described in example 3 above. After one and two three weeks of immunization, each immunization group was challenged with BoNT/A and BoNT/H, respectively, and one week was observed, and the results of the survival statistics are shown in Table 6. The protective test results show that HHc and AHc not only produce protective responses against self-toxins, but also produce strong cross-protective responses with botulinum toxin type A or H, respectively, and that this cross-protective effect also exhibits antigen dose dependence. Half-effective dose ED of HHC and AHc group cross-protection effect after primary immunization ₅₀ 40.479ng and 1122.781ng, respectively; half-effective dose ED of HHC and AHc group cross-protective effect after two immunizations ₅₀ 32.144ng and 55.816ng, respectively

Thus, the results of the present invention demonstrate that Hc including HHc and AHc are advantageous protective antigenic molecules with significant cross-protection from each other and can be used to prepare vaccines and antitoxin protection against each other's toxins. In this laboratory, we prepared anti-AHc botulinum antitoxin antibodies that were able to neutralize botulinum toxin type H, requiring 4 times of anti-botulinum toxin type A neutralizing antibodies to fully neutralize the same amount of botulinum toxin type H.

Meanwhile, it was found that the L-HN of BoNT/H is unique, it does not cross-react with the protective antigen of the L-HN of botulinum toxin type F, and is not capable of protecting botulinum toxin type F, so that it has a significant difference in L-HN functional domain from the existing botulinum toxin, and the existing conventional antitoxin is not capable of neutralizing the toxin, and more than 500 times of neutralizing antibodies are required for neutralization, so that the antibody drug cannot be used for specifically treating it.

TABLE 6 Cross protection results after immunization of botulinum toxin receptor binding region Hc antigen proteins of H and A

Note that: of HHc immunized groups, the immunized 1 group was immunized three weeks after the first immunization with 10 portions, respectively ² LD ₅₀ BoNT/A was tested for protection; the 2 groups were immunized three weeks after the second immunization with 10 each ³ LD ₅₀ BoNT/A was tested for protection; of the AHc immunized groups, the immunized 1 group was immunized three weeks after the first immunization with 10 ² LD ₅₀ BoNT/H was subjected to a protective assay and immunized 2 groups were given 10 weeks after the second immunization ³ LD ₅₀ BoNT/H was tested for protection; one week of observation, survival results were counted.

In conclusion, the invention prepares the functional structural domain protein molecules of the H-type botulinum toxin by utilizing a genetic engineering technology, and researches the immune protection effect of subunit vaccines of recombinant protein antigens, and the results show that Hc and L-HN antigens in the functional structural domain protein antigens of the H-type botulinum toxin have good immunogenicity and immune protection effects, HN antigen has general immune protection effects, and L has no protection effect. Further research and analysis results show that HL-HN has no cross protection effect on the type F botulinum toxin, while HHc has strong cross protection effect on the type A botulinum toxin, and compared with the L-HN antigen, the Hc antigen has obvious advantages and better efficacy in protecting efficacy and neutralizing antibody production.

Therefore, the recombinant Hc protein antigen prepared by the invention has better efficacy as an H-type botulinum toxin subunit vaccine than an L-HN antigen, and has better immunoprotection efficacy and application prospect. The Hc is not only an effective protective antigen, but also can produce cross protection with botulinum toxin type A, and can be used for constructing double Hc fusion molecules as multivalent vaccines.

EXAMPLE 6 immune Effect of tetanus toxin and botulinum toxin A double Hc fusion molecule proteins as multivalent subunit vaccine

Each recombinant protein prepared in example 2 above was anti-tumorMice were immunized with the antigen separately and tested for immunogenicity and protection. The specific method comprises the following steps: balb/c mice (6-8 weeks, female, SPF grade) were randomly grouped, 10 animals per group, immunized with 1. Mu.g or 4. Mu.g antigen protein per mouse, respectively, while the negative control group immunized with PBS free of recombinant protein, with aluminum adjuvant (Alhydrogel) at a final concentration of 1mg/ml ^TM 2.0% of Pontain (Brenntag Biosector) company product), and enhancing immunity (the dosage of antigen protein and aluminum adjuvant is the same as above) at intervals of 3 weeks, taking blood from mice after one or two immunizations, and then using different biotoxins to attack toxin to evaluate the protection effect of protein antigen.

The results shown in Table 7 and FIG. 6 demonstrate that both AHc-THc and THc-AHc recombinant protein antigens produced an antibody response against itself, as well as immunoprotection against both AHc and THc. The different doses and the number of immunizations in each immunization group produced a protective response, which also showed positive dose dependence. After primary immunization, the protection effect against tetanus toxin is slightly weaker, but after two immunization, the AHc-THc and THc-AHc groups generate strong complete protection effect, and have the same protection effect as the control group AHc+THc, so that no influence exists between the AHc and the THc in the double Hc fusion molecule, and the two combination modes can play an immune effect. In particular, the double Hc fusion molecule as a vaccine produces strong antibody reaction against AHc (B in FIG. 6) and THc (C in FIG. 6), further showing that the two antigen components in the fusion molecule exert their respective effects.

To further evaluate the protective efficacy of AHc-THc and THc-AHc at low doses, the present invention conducted protective experimental studies on these two protein antigens after immunization at different doses once or twice. Immunoprotection protocols were as follows: the doses of each recombinant protein antigen were 1000, 250, 62.5, 15.6 and 3.9 ng/dose, 1 or 2 immunizations, and the same protocol as above. Three weeks after immunization of each immunization group, challenge with different biotoxins, one week observation was performed, and survival number results were counted. Calculation of the half-dose ED for each group using the probability analysis method (SPSS 17.0-Probit) ₅₀ The value, expressed as the efficacy of the vaccine.

The results shown in tables 8 to 10 demonstrate that THc-AHc and the combination of AHc-THc and control AHc+THc are protected from different dosesAfter epidemic, strong protection against both toxins is produced, and the three groups have no difference in protection efficacy. Half-effective dose ED of three vaccines after one immunization against tetanus toxin ₅₀ 8.17ng,31.45ng and 21.104ng, respectively; half-effective dose ED of three vaccines after two immunizations ₅₀ 8.17ng,21.104ng and 31.225ng, respectively. Half-effective dose ED of three vaccines after one immunization against botulinum toxin type A ₅₀ 223.721ng,31.45ng and 31.45ng, respectively; half-effective dose ED of three vaccines after two immunizations ₅₀ 8.17ng,8.17ng and 8.17ng, respectively.

In addition, AHc-THc and THc-AHc molecular vaccines can also fully protect botulinum toxin type H after two immunizations, indicating that such RBD-based double fusion molecules can also produce cross protection against botulinum toxin type H. Therefore, single molecules AHc-THc and THc-AHc can be used as multivalent vaccine molecules to replace combined antigens, can protect three toxin pathogens, and are vaccine varieties with good application prospects.

TABLE 7 immunoprotection effects of tetanus toxin and botulinum toxin A double Hc fusion molecule vaccine against both toxins

Note that: protective experiments were performed 3 weeks after the last immunization with different doses of botulinum toxin type a and tetanus toxin challenge; serum neutralizing antibodies were determined using classical in vivo neutralization experiments. Survival/total number represents the level of protection, with 10 animals per group.

TABLE 8 results of protection level against two toxins after immunization of mice at different doses of the double Hc fusion molecule THc-linker-AHc

Note that: protective experiments were performed 3 weeks after the last immunization, with different doses of botulinum toxin type a and tetanus toxin challenge. Survival/total number represents the level of protection, with 10 animals per group.

TABLE 9 results of protection level against two toxins after different doses of double Hc fusion molecule AHc-linker-THc immunization of mice

Table 10 results of protection level against two toxins after different doses of AHc+THc combination vaccine to immunized mice

EXAMPLE 7 immune Effect study of other botulinum toxin double Hc fusion molecule proteins as multivalent subunit vaccine

Based on the multivalent biotoxin protein biosynthesis technology assembled by the RBD of the double-receptor binding region, the invention also develops the combination research of RBD of other receptor binding regions. The immune effect of the A and E botulinum toxin double Hc fusion molecule protein vaccines (AHc-EHc and EHc-AHc, FIG. 4A) was first investigated. Immunization and protocol evaluation the same example 6, 5 animals per group, were immunized at 1 μg or 10 μg antigen protein per mouse, 3 weeks apart to boost, mice were bled after one or two immunizations, and then protein antigen protection was evaluated by challenge with different biotoxins.

The results in Table 11 show that AHc-EHc and EHc-AHc, as subunit vaccines, induced strong protective efficacy against botulinum toxin type A, but weak protective efficacy against botulinum toxin type E, required 3 immunizations to provide some protection. However, the protective efficacy against both botulinum toxin types A and E was greater when the AHc+ EHc combination was immunized, suggesting that EHc protective antigen was attenuated in both botulinum toxin type A and E double Hc fusion molecules, which effect may be associated with botulinum toxin type E Hc being a weak protective antigen in the botulinum toxin type E functional domain, L-HN being a strong protective antigen (see patent ZL 201911292144.8 for details). Thus, the theory and technique that EL-HN needs to be selected as a protective antigen when studying botulinum toxin type E and other types of toxins to assemble multivalent vaccines has been demonstrated by this team.

Therefore, when combining double Hc fusion molecules against various toxins, it is necessary to consider the strength of their RBD as protective antigen, supporting strong fusion assembly. To verify this technology, the present invention developed more confirmatory studies such as the biosynthesis of botulinum toxin type A or H and B double Hc fusion molecule proteins as multivalent subunit vaccines (B in FIG. 4) and its immune effect studies. The immunization dose is 1 mug or 10 mug of antigen protein of each mouse respectively, the immunization is enhanced at intervals of 3 weeks, and the protection effect of protein antigen is evaluated by using different biotoxins to attack toxin three weeks after the two-time immunization. The results of the study showed that other combinations of types, such as AHc-BHc and BHc-HHc, were also able to produce strong protection against A, B and H botulinum toxins, and that the protection against the three toxins was comparable, with no score of strength (Table 12). Previously, this study demonstrated that either type a or type H Hc has strong cross-protection due to high homology, no protective differences between them, and that either type a Hc antigen or type H Hc antigen is able to fully protect both type a and type H botulinum toxins. The results of the double Hc fusion molecule protein multivalent subunit vaccine again demonstrate that the A or H type Hc in the fusion molecule has strong cross-protection and also demonstrate that they can be used as trivalent vaccines. The above results demonstrate that the feasibility of strong combinations is further verified in a combination of double Hc types a or H and B. Thus, further validation of further combined candidate vaccine molecules can be carried out according to this principle.

In summary, the double Hc fusion antigen molecule vaccines of the present invention can produce protective efficacy against two or three different serotypes of toxin pathogen, and can be used as broad-spectrum multivalent vaccines for biological defenses of toxins.

Table 11, A and E botulinum toxin double Hc fusion molecule protein vaccines for immunoprotection against both toxins

Note that: protective experiments were performed 3 weeks after the last immunization, with different doses of botulinum toxin type a and E. Survival/total number represents the level of protection, with 5 animals per panel tested. ND shows no protective test for this dose group.

Table 12, immunoprotection effect of botulinum toxin double Hc fusion molecule vaccine against three toxins

Note that: 3 weeks after two immunizations, 10 each ³ Protective experiments were performed at doses of three botulinum toxin challenge. Survival/total number represents the level of protection, with 10 animals per group.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

1. A multivalent biotoxin molecular antigen vaccine comprises a fusion protein formed by connecting Hc antigen of biotoxin 1 and Hc antigen of biotoxin 2 through a connecting peptide as active ingredients;

the biotoxin 1 and the biotoxin 2 are two different biotoxins;

2. The multivalent biotoxin molecular antigen vaccine of claim 1, wherein: the other botulinum toxin than E type is botulinum toxin type A or botulinum toxin type B or botulinum toxin type H.

3. The multivalent biotoxin molecular antigen vaccine of claim 1 or 2, characterized in that: the active ingredients of the multivalent biotoxin molecular antigen vaccine are any one of the following:

4. A multivalent biotoxin molecular antigen vaccine as set forth in any one of claims 1-3, characterized in that: the connecting peptide is (G4S) ₃ 。

5. The multivalent biotoxin molecular antigen vaccine of any one of claims 1-4, characterized in that: the amino acid sequence of the Hc antigen of the botulinum toxin A is shown as SEQ ID No. 10; and/or

The amino acid sequence of the Hc antigen of the botulinum toxin type B is shown as SEQ ID No. 12; and/or

The amino acid sequence of the Hc antigen of the H-type botulinum toxin is shown as SEQ ID No. 8; and/or

The amino acid sequence of the Hc antigen of the tetanus toxin is shown as SEQ ID No. 16;

and/or

Further, the amino acid sequence of the AHc-THc is shown as SEQ ID No. 18; and/or

Further, the amino acid sequence of the THc-AHc is shown as SEQ ID No. 20; and/or

Further, the amino acid sequence of the AHc-BHc is shown as SEQ ID No. 26; and/or

Further, the amino acid sequence of the BHc-HHc is shown in SEQ ID No. 28.

6. A method of preparing the multivalent biotoxin molecular antigen vaccine of any one of claims 1-5, comprising the steps of: introducing a nucleic acid molecule encoding the fusion protein into an E.coli receptor cell to obtain recombinant E.coli; culturing the recombinant escherichia coli to obtain the recombinant escherichia coli as the fusion protein; the multivalent biotoxin molecular antigen vaccine is then prepared with the fusion protein as an active ingredient.

7. The method according to claim 6, wherein: the nucleic acid molecule sequence of Hc antigen of the A-type botulinum toxin is shown as SEQ ID No. 9; and/or

The nucleic acid molecule sequence of Hc antigen of the coded botulinum toxin type B is shown as SEQ ID No. 11; and/or

The nucleic acid molecule sequence of the Hc antigen of the H-type botulinum toxin is shown in SEQ ID No. 7; and/or

The nucleic acid molecule sequence of the Hc antigen of the tetanus toxin is shown as SEQ ID No. 15.

8. The method according to claim 6 or 7, characterized in that: the nucleic acid molecule sequence for encoding the AHc-THc is shown in SEQ ID No. 17; and/or

The nucleic acid molecule sequence for encoding the THc-AHc is shown in SEQ ID No. 19; and/or

The nucleic acid molecule sequence for encoding the AHc-BHc is shown in SEQ ID No. 25; and/or

The nucleic acid molecule sequence for encoding the BHc-HHc is shown in SEQ ID No. 27.

9. Any one of the following substances:

(B1) A protein which is the fusion protein of any one of claims 1 to 5;

(B2) A nucleic acid molecule according to any one of claims 6 to 8;

10. Use of the protein according to claim 9 (B1) or the nucleic acid molecule according to claim 2 or the recombinant vector according to claim 3, the expression cassette, the transgenic cell line or the recombinant bacterium according to claim 3 for the preparation of a product for the prophylaxis and/or treatment of a toxic condition caused by botulinum and/or tetanus toxins.