CN116262926A

CN116262926A - Non-capping linear RNA recombinant nucleic acid molecule and application thereof

Info

Publication number: CN116262926A
Application number: CN202211248922.5A
Authority: CN
Inventors: 韩悌云; 徐实
Original assignee: Nanjing Chengshi Biotechnology Co ltd
Current assignee: Nanjing Chengshi Biomedical Technology Co ltd
Priority date: 2022-10-12
Filing date: 2022-10-12
Publication date: 2023-06-16
Anticipated expiration: 2042-10-12
Also published as: CN116262926B

Abstract

The invention provides a non-capping linear RNA (NCT RNA) recombinant nucleic acid molecule and application thereof. The non-capped linear RNA recombinant nucleic acid molecule comprises a flavivirus genome sfRNA element, a spacer sequence, a translation initiation element IRES, a coding element encoding at least one polypeptide of interest, a 3' -UTR element, a polyA sequence. The invention also provides an expression cassette, a vector, a cell, a pharmaceutical composition, a kit, application, a preparation method and the like containing the recombinant nucleic acid molecule. The invention utilizes the sfRNA sequence of the flaviviridae genome to protect the 5' -end of the RNA from degradation, and improves the stability of non-capping linear mRNA in cells. Meanwhile, the regulation and control of mRNA by binding IRES or a derivative thereof promote the sustainable and stable expression of target protein by non-capping linear mRNA.

Description

Non-capping linear RNA recombinant nucleic acid molecule and application thereof

Technical Field

The invention relates to the field of recombinant nucleic acid molecules, in particular to a non-capping linear RNA recombinant nucleic acid molecule and application thereof.

Background

mRNA (messenger ribonucleic acid ) has important application value in the aspects of protein production, application to gene therapy in the form of nucleic acid vaccines and the like. Compared with the traditional vaccine, the nucleic acid vaccine has the advantages of durable immune response, self-adjuvant property, simple manufacturing process, capability of being used for preventing and treating tumors and the like, and has wide prospect in the fields of infectious diseases, tumors and the like. IRES (internal ribosome, internal RibosomeEntry Site) mediated circular RNA is capable of stably and continuously expressing a target gene in eukaryotic cells, and it is confirmed that IRES can be used for preparing in vitro mRNA and expressing the target gene in vivo instead of cap analogue (cap analogue). Compared with linear RNA, the circular RNA has higher tolerance to exonuclease than linear mRNA due to the fact that the 5 '-end and the 3' -end of the circular RNA are connected end to form a closed loop, so that the circular RNA can be expressed for a longer time and lasting. In addition, compared with the complicated capping, tailing and nucleotide modification in the traditional linear mRNA preparation process, the preparation method of the circular RNA has the characteristics of higher efficiency, low cost and the like. However, if the conventional IVT (In Vitro Transcription ) is adopted, namely, capping and nucleotide modification are not involved, mRNA prepared by one-step conventional IVT reaction has the characteristic of permanently and stably expressing the target protein, so that compared with the circular RNA, the process difficulty is remarkably reduced, the production and preparation period is improved, and the production cost is further saved.

In the linear mRNA prepared by the IVT at present, in order to ensure that the mRNA can stably and permanently express a target gene in a cell, an enzyme method or a co-transcription mode is adopted to add an m7G cap (m 7G cap) at the 5 'end of the mRNA and a polyA sequence at the 3' end. However, the prior art methods for preparing linear mRNA have problems, for example, the linear mRNA currently used requires enzymatic capping involving two steps of reaction and purification (IVT and capping reaction) or co-transcription capping requiring only one step of IVT reaction but introducing cap analogues to ensure stable expression of the gene of interest in the cell. Therefore, the method is not the optimal choice from the two aspects of process difficulty and cost. Although capping is not involved in the preparation of the circular RNA, the cyclization efficiency, RNase R cleavage efficiency and stringent purification process requirements all lead to complicated preparation processes and increased cost of the circular RNA.

The prior art provides a variety of non-capped linear mRNAs, for example CN112119162A (App. publication 2020.12.22) discloses a nucleic acid molecule comprising at least one expression control sequence comprising a viral Internal Ribosome Entry Site (IRES) element having a viral 5 'untranslated region (5' UTR); at least one coding region operably linked to the at least one expression control sequence and encoding a peptide or protein; and at least one of a plurality of adenosines and a plurality of thymidines upstream of the at least one expression control sequence. Wherein the viral IRES element is derived from at least one of Picornaviridae, togaviridae, bicistroviridae, flaviviridae, retroviridae, and Herpesviridae. The nucleic acid molecule further comprises a viral 3 ' untranslated region (3 ' UTR) located downstream of the 5 ' UTR, and wherein the at least one coding region is located between the 5 ' UTR and the 3 ' UTR. This patent document teaches the introduction of IRES elements derived from the flaviviridae family into the 5' UTR, however, does not disclose or suggest the introduction of other sequences upstream of the IRES, nor does it relate to the use of the flaviviridae genome sfRNA to achieve the effect of preventing nucleic acid degradation and significantly improving the expression of the gene of interest.

Disclosure of Invention

In order to solve the defects in the prior art, in the in vitro preparation of non-capping linear RNA, the invention prevents the degradation of nucleic acid, improves the stability of the non-capping linear RNA in cells, and the stability and durability of the expression of a target gene in cells. The invention also provides expression cassettes, vectors, cells, compositions, uses for treating diseases, methods of preparation, and the like comprising the non-capped linear RNA recombinant nucleic acid molecules. The non-capping linear RNA has wide application prospect in the fields of infectious vaccines, therapeutic tumor vaccines, dendritic cell tumor vaccines based on mRNA, gene therapy, protein supplementation therapy and the like.

In one aspect, the invention provides a non-capped linear RNA recombinant nucleic acid molecule characterized by: from the 5 'to 3' direction, the recombinant nucleic acid molecule comprises elements arranged in the following order:

a flavivirus genome sfRNA element, a spacer sequence, a translation initiation element IRES, a coding element encoding at least one polypeptide of interest, a 3' -UTR element, a polyA sequence; wherein the flavivirus is dengue fever virus, and the sfRNA has a sequence shown in SEQ ID NO. 5.

Further, the IRES is derived from Coxsackie virus B3 (Coxsackie virus B3), and the sequence of the Coxsackie virus B3 IRES is shown as SEQ ID NO. 1.

Further, the flavivirus genome sfRNA is derived from any one selected from the group consisting of the following flaviviridae: zika virus, west Nile virus, japanese encephalitis virus, and Tamana bat virus.

Further, the translation initiation element IRES is derived from any one of Enterovirus 71 (Enterovirus 71) IRES, echovirus 29 (Echovirus 29) IRES and human rhinovirus B3 (human rhinovirus B3) IRES, wherein the Enterovirus 71 IRES sequence is shown as SEQ ID NO. 2, the Echovirus 29 IRES sequence is shown as SEQ ID NO. 3, and the human rhinovirus B3 IRES sequence is shown as SEQ ID NO. 4.

Further, an eIF4G aptamer is integrated into the IRES to obtain an IRES derivative; preferably, the IRES derivative is a Coxsackie virus B3 (Coxsackie virus B3) IRES derivative, an Enterovirus 71 (Enterovirus 71) IRES derivative, an Echovirus 29 (Echovirus 29) IRES derivative or a human rhinovirus B3 (human rhinovirus B3) IRES derivative, and the sequences are shown in SEQ ID NOs 7-10 respectively; wherein the eIF4G aptamer sequence is shown in SEQ ID NO. 6.

Further, the spacer sequence is shown as SEQ ID NO. 11.

Further, the interval sequence is PABPs, and the PABPs sequence is shown as SEQ ID NO. 12.

Further, from the 5 'to 3' direction, the recombinant nucleic acid molecule comprises elements arranged in the following order:

a dengue virus sfRNA with a sequence shown as SEQ ID NO. 5, a spacer sequence with a sequence shown as SEQ ID NO. 11, a coxsackievirus B3 IRES with a sequence shown as SEQ ID NO. 1, a coding element for coding at least one target polypeptide, a 3' -UTR element, a polyA sequence; or alternatively

Dengue virus sfRNA with a sequence shown as SEQ ID NO. 5, spacer sequence PABPs with a sequence shown as SEQ ID NO. 12, coxsackievirus B3 IRES with a sequence shown as SEQ ID NO. 1, a coding element for coding at least one target polypeptide, a 3' -UTR element and a polyA sequence; or alternatively

Dengue virus sfRNA with a sequence shown as SEQ ID NO. 5, a spacer sequence with a sequence shown as SEQ ID NO. 11, a coxsackievirus B3 IRES derivative with a sequence shown as SEQ ID NO. 7, a coding element for coding at least one target polypeptide, a 3' -UTR element and a polyA sequence; or alternatively

Dengue virus sfRNA with the sequence shown in SEQ ID NO. 5, spacer sequence PABPs with the sequence shown in SEQ ID NO. 12, coxsackievirus B3 IRES derivative with the sequence shown in SEQ ID NO. 7, coding element for at least one target polypeptide, 3' -UTR element and polyA sequence.

One aspect of the invention provides an expression cassette comprising the non-capped linear RNA recombinant nucleic acid molecule. The expression cassette can be used to express the non-capped linear RNA recombinant nucleic acid molecule.

In one aspect, the invention provides a vector comprising a non-capped linear RNA recombinant nucleic acid molecule. The vector may be used to express the non-capped linear RNA recombinant nucleic acid molecule. Preferably, the vector may be a viral vector; preferably, the viral vectors include, but are not limited to, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, or the like; preferably, the vector may be a non-viral vector; preferably, the vector may be a mammalian cell expression vector; preferably, the expression vector may be a bacterial expression vector; preferably, the expression vector may be a fungal expression vector.

In one aspect, the invention provides a cell comprising the non-capped linear RNA recombinant nucleic acid molecule or the vector, which cell can express the non-capped linear RNA recombinant nucleic acid molecule. Preferably, the cell is a bacterial cell; preferably, the bacterial cells are E.coli cells or the like; preferably, the cell is a fungal cell; preferably, the fungal cell is a yeast cell; preferably, the yeast cells are pichia cells and the like; preferably, the cell is a mammalian cell; preferably, the mammalian cells are black line hamster ovary Cells (CHO), human embryonic kidney cells (293), B cells, T cells, DC cells, NK cells, or the like.

In one aspect the invention provides a pharmaceutical composition comprising the non-capped linear RNA recombinant nucleic acid molecule, expression cassette, vector or cell, preferably the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, preferably the pharmaceutically acceptable carrier comprises one or more of the following: pharmaceutically acceptable solvents, dispersing agents, additives, shaping agents and pharmaceutical excipients.

In one aspect, the invention provides a kit comprising the non-capped linear RNA recombinant nucleic acid molecule.

In one aspect, the invention provides the use of the non-capped linear RNA recombinant nucleic acid molecule, expression cassette, vector or cell in the preparation of a pharmaceutical composition for the treatment or prevention of a disease.

In one aspect, the invention provides the application of the non-capped linear RNA recombinant nucleic acid molecule in preparing a diagnosis and detection kit.

In one aspect, the invention provides a method of treating or preventing a disease comprising administering the non-capped linear RNA recombinant nucleic acid molecule, expression cassette, vector, cell or pharmaceutical composition of the invention to a subject in need thereof.

In one aspect, the invention provides a diagnostic, test method comprising administering the non-capped linear RNA recombinant nucleic acid molecule, kit or pharmaceutical composition of the invention to a subject or sample in need thereof.

In one aspect, the invention provides the use of the non-capped linear RNA recombinant nucleic acid molecule, expression cassette, vector, cell or pharmaceutical composition for the treatment and prevention of a disease.

One aspect of the invention provides the use of the non-capped linear RNA recombinant nucleic acid molecule, kit, or pharmaceutical composition for detection, diagnosis.

In one aspect the invention provides the use of said non-capped linear RNA recombinant nucleic acid molecule or said expression cassette or said vector or said cell for in vitro preparation of non-capped linear RNA.

In one aspect, the invention provides a method for preparing a non-capped linear RNA recombinant nucleic acid molecule in vitro, characterized in that: the method comprises the following steps:

a transcription step: transcribing the non-capped linear RNA recombinant nucleic acid molecule, or the vector, in vitro to form non-capped linear RNA;

optionally, the method further comprises the step of purifying the non-capped linear RNA.

In one aspect, the invention provides a method for expressing a polypeptide of interest in a cell, wherein the method comprises transferring the non-capped linear RNA recombinant nucleic acid molecule, or the expression cassette, or the vector, into the cell and expressing the protein of interest.

In one aspect, the invention provides the use of dengue virus genome sfRNA in the in vitro preparation of a non-capped linear RNA recombinant nucleic acid molecule, characterized in that: the sequence of the sfRNA is shown as SEQ ID NO. 5.

In one aspect, the invention provides the use of dengue virus genome sfRNA and IRES derived from coxsackievirus B3 in the in vitro preparation of a non-capped linear RNA recombinant nucleic acid molecule, characterized in that: the sfRNA sequence is shown as SEQ ID NO. 5, and the IRES sequence is shown as SEQ ID NO. 1.

One aspect of the present invention provides a method of designing a spacer sequence, wherein the method comprises the steps of:

(1) Determining the secondary structure of sfRNA according to the sequence of sfRNA of a genome of a flaviviridae family;

(2) Determining an IRES secondary structure according to the type 1 IRES sequence;

(3) Designing a spacer sequence according to the secondary structures of (1) and (2), wherein the spacer sequence does not interfere with the secondary structures of (1) and (2), and the spacer sequence does not have a hairpin structure of more than 10bp inside; preferably, the spacer sequence is designed as shown in SEQ ID NO. 11 or SEQ ID NO. 12.

The non-capping linear RNA recombinant nucleic acid molecule provided by the invention has one or more of the following beneficial technical effects:

1. The non-capping linear RNA recombinant nucleic acid molecule of the invention can protect the 5' -end of RNA from degradation by utilizing a flaviviridae genome sfRNA sequence, in particular a dengue virus genome sfRNA sequence, and can obtain the functionalized non-capping linear RNA.

2. The combination of the flavivirus genome sfRNA and the Coxsackie virus B3 IRES (CVB 3 IRES) of non-capped linear RNA (NCT RNA) has a remarkable effect on improving the expression of the target gene.

3. Compared with classical capping linear mRNA and circular RNA, the protein expression of the target gene under the NCT RNA architecture in cells is equivalent to that of the target gene and the circular RNA, but the NCT RNA obtained by the invention is simpler, more convenient and has low cost.

4. Compared with the mRNA expression of the commercial target gene, the invention proves that the target gene expression mediated by the NCT RNA architecture has stable and durable characteristics.

5. Integration of eiF4G aptamer into IRES internally gives IRES mutants, and NCT RNAs comprising the mutants can significantly improve expression levels of the gene of interest.

6. Further replacement of the spacer sequence of the non-capped linear RNAs of the invention with panps (sequence targeted by polyA binding protein, polyA Binding Protein sequence) can improve IRES-mediated gene expression.

7. Under the action of sfRNA and polyA, the NCT RNA prevents the mRNA from being degraded by exonuclease, thereby improving the stability of the mRNA in cells and prolonging the half-life period. Simultaneously, the IRES or the derivative thereof is combined for regulating mRNA, the ribosome complex is combined with the mRNA and starts to translate the target protein at a translation start site, so that the target protein can be expressed continuously and stably by the non-capping linear mRNA.

8. In the IVT process of NCT RNA, the introduction of cap analogues and modified bases is not involved, the obtained RNA does not involve post-treatment steps, the difficulty of the preparation process and the strict purification requirements are greatly reduced, and the NCT RNA is suitable for in-vitro large-scale industrial preparation. The non-capping linear RNA is suitable for in-vitro large-scale production, and has wide application prospects in the fields of mRNA infectious disease vaccines, therapeutic mRNA tumor vaccines, mRNA-based dendritic cell tumor vaccines, mRNA-based gene therapy, protein supplementation therapy and the like.

Drawings

FIG. 1 is a schematic representation of non-capped linear RNA designed from a DNA vector according to the present invention.

FIG. 2 shows the predicted secondary structure of the dengue virus genome sfRNA (abbreviated as D3) of the present invention.

FIG. 3 shows the predicted secondary structure of CVB3 IRES according to the invention.

FIG. 4 shows the results of secondary structure prediction of EV71 IRES according to the invention.

FIG. 5 shows the predicted secondary structure of E29 IRES of the invention.

FIG. 6 shows the predicted secondary structure of HRV-B3 IRES of the present invention.

FIG. 7 shows the predicted secondary structure of the eiF4G aptamer of the invention.

FIG. 8 shows the predicted secondary structure of CVB3 IRES derivatives of the present invention.

FIG. 9 shows the predicted secondary structure of EV71 IRES derivatives of the invention.

FIG. 10 shows the predicted secondary structure of E29 IRES derivatives of the invention.

FIG. 11 shows the predicted secondary structure of the HRV-B3 derivatives of the invention.

FIG. 12 shows NCT RNAs 1-6 of the present invention; schematic representation of NCT RNA 1-2, 7-9-Fluc.

FIG. 13 is a schematic representation of the present invention supported RNA-Fluc and oRNA-Fluc.

FIG. 14 shows the results of in vitro expression of NCT RNA1-Fluc, NCT RNA 2-Fluc, supplied RNA-Fluc and oRNA-Fluc of the present invention.

FIG. 15A is a photograph showing the imaging of the Fluc expression of NCT RNA1-Fluc of the

present invention

24, 48, 72 hours after injection of commercial Fluc into mice.

FIG. 15B is a graph of the relative light unit results of NCT RNA1-Fluc of the

present invention

24, 48, 72 hours after injection of commercial Fluc into mice.

FIG. 16 is a schematic representation of NCT RNA z-EGFP of the present invention.

FIG. 17 shows EGFP expression results of NCT RNA1 and NCT RNA z-EGFP of the present invention.

FIG. 18 shows the results of the Fluc expression of NCT RNA 1-Fluc, NCT RNA 2-Fluc, NCT RNA 7-Fluc, NCT RNA 8-Fluc and NCT RNA 9-Fluc according to the present invention.

FIG. 19 shows EGFP expression results of NCT RNA1, NCT RNA2, NCT RNA3, and NCT RNA6 of the present invention.

Detailed Description

Definitions and terms

The term "Non-capped linear RNA", i.e. "NCT RNA", also known as Non-Capped Translatable RNA, is a functionalized Non-capped linear RNA obtained by degrading the 5' -end of the protective RNA using the sequence of the flaviviridae genome sfRNA.

The term "sfRNA": subgenomic flavivirus RNA (subgenomic flaviviral ribonucleic acid, sfRNA) is part of the genome from the virus. In host cells infected with flaviviruses, there is an accumulation of large amounts of sfRNA formed by incomplete degradation of genomic RNA.

The term "IRES" (Internal ribosome entry site, IRES), also known as an internal ribosome entry site, belongs to a translational control element, typically located 5' to a gene of interest, and allows RNA to be translated in a cap-independent manner. The transcribed IRES may bind directly to the ribosomal subunit so that the mRNA start codon is properly oriented in the ribosome for translation. IRES sequences are usually located in the 5' UTR of mRNA (directly upstream of the start codon). IRES functionally replaces the need for various protein factors that interact with eukaryotic translation mechanisms.

The term "translation initiation element" refers to any sequence element capable of recruiting ribosomes to initiate the translation process of an RNA molecule.

The term "coding region", CDS (coding DNA sequence) CDS, is a region of a gene in which DNA or RNA is the coding region of a protein, which typically begins at the 5 'end with a start codon and ends at the 3' end with a stop codon.

The term "expression" includes any step involving the production of a polypeptide, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

The term "recombinant nucleic acid molecule" refers to a polynucleotide having sequences that are not linked together in nature. The recombinant polynucleotide may be included in a suitable vector, and the vector may be used for transformation into a suitable host cell. The polynucleotide is then expressed in a recombinant host cell to produce, for example, "recombinant polypeptides," "recombinant proteins," "fusion proteins," and the like.

The term "recombinant expression vector" refers to a DNA structure used to express, for example, a polynucleotide encoding a desired polypeptide. Recombinant expression vectors can include, for example, vectors comprising (1) a collection of genetic elements, such as promoters and enhancers, that regulate gene expression; (2) A structure or coding sequence transcribed into mRNA and translated into protein; and (3) transcriptional subunits of appropriate transcriptional and translational initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not critical and any vector may be used, including plasmids, viruses, phages and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, nonchromosomal and synthetic DNA sequences, such as viral plasmids, bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from combinations of plasmids and phage DNA, DNA from viruses such as lentiviruses, retroviruses, vaccinia, adenoviruses, chicken pox, baculovirus, SV40, and pseudorabies.

The term "5' -UTR" refers to a "5' untranslated region" or "5' UTR" that is a portion of a gene that is transcribed into a primary RNA transcript (pre-mRNA) and is located upstream of the coding sequence. Primary transcripts are initial RNA products, comprising introns and exons, produced by transcription of DNA. Many primary transcripts must undergo RNA processing to form physiologically active RNAs. The processing to form mature mRNA involves modification of the ends, excision of introns, capping and/or cleavage of individual rRNA molecules from the precursor RNA. Thus, the 5' UTR of an mRNA is a portion of the mRNA that is not translated into a protein and is located upstream of the coding sequence. In genomic sequences, the 5' UTR is generally defined as the region between the transcription start point and the start codon. The 5 'untranslated region (5' UTR) of vertebrate mRNA can be tens to hundreds of bases in length.

The term "3'-UTR" refers to a "3' -untranslated region" or "3'UTR" that refers to a region that is located at the 3' end of a gene, downstream of the stop codon of a protein coding region, and that is transcribed but not translated into an amino acid sequence, or to a corresponding region in an RNA molecule. The 3' -untranslated region typically extends from the stop codon of the translation product to a poly (a) sequence that is typically attached after the transcription process. The 3' -untranslated region of mammalian mRNA typically has a homologous region known as the AAUAAA hexanucleotide sequence. The sequence may be a poly (a) attachment signal and is often located 10 to 30 bases upstream of the poly (a) attachment site. The 3' -untranslated region may comprise one or more inverted repeats, which may fold to create a stem-loop structure that acts as a barrier to riboexonucleases or interacts with proteins known to improve RNA stability (e.g., RNA binding proteins).

The term "polyA" refers to a "polyadenylation sequence", "poly (a) sequence" or "poly (a) tail" and refers to a sequence of adenosine residues that is typically located at the 3' end of an RNA molecule. The present invention allows such sequences to be attached via a DNA template during RNA transcription based on repeated thymidylate residues in the strand complementary to the coding strand, whereas the sequences are not normally encoded in DNA, but are attached to the free 3' end of RNA by a template independent RNA polymerase after transcription in the nucleus.

The term "host cell" refers to a cell into which an exogenous polynucleotide has been introduced, including the progeny of such a cell. Host cells include "transformants" and "transformed cells," which include primary transformed cells and progeny derived therefrom. Host cells are any type of cellular system that can be used to produce the antibody molecules of the invention, including eukaryotic cells, e.g., mammalian cells, insect cells, yeast cells; and primary cells, e.g., E.coli cells. Host cells include cultured cells, as well as cells within transgenic animals, transgenic plants, or cultured plant tissue or animal tissue. The term "recombinant host cell" encompasses host cells which differ from the parent cell upon introduction of a recombinant nucleic acid molecule, recombinant expression vector, non-capped linear RNA, in particular by transformation. The host cells of the present disclosure may be prokaryotic or eukaryotic, and are primarily cells capable of introducing the recombinant nucleic acid molecules, recombinant expression vectors, non-capped linear RNAs, and the like of the present disclosure.

The term "individual", "patient" or "subject" includes mammals and birds. Mammals and birds include, but are not limited to, domesticated animals (e.g., pigs, cattle, sheep, chickens, ducks, cats, dogs, horses, etc.), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice, rats, etc.).

The term "transformation, transfection, transduction" has the meaning commonly understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host.

The term "treatment" refers to: after suffering from the disease, the subject is contacted (e.g., administered) with the non-capped linear RNAs, compositions, etc. of the invention, thereby alleviating the symptoms of the disease as compared to when not contacted, and does not mean that the symptoms of the disease must be completely inhibited. The suffering from the disease is: the body develops symptoms of the disease.

The term "preventing" refers to: by contacting (e.g., administering) a subject with a non-capped linear RNA, composition, etc. of the invention prior to the onset of disease, the symptoms after the onset of disease are reduced compared to when not contacted, and do not mean that complete inhibition of the disease is necessary.

The term "effective amount" refers to an amount or dose of a recombinant nucleic acid molecule, recombinant expression vector, non-capped linear RNA, vaccine or composition of the invention that, upon administration to a patient in single or multiple doses, produces a desired effect in a patient in need of treatment or prevention. The effective amount can be readily determined by the skilled artisan by considering a number of factors: species such as mammals; size, age, and health; specific diseases involved; the extent or severity of the disease; response of individual patients; specific antibodies administered; mode of administration; the bioavailability characteristics of the administration formulation; a selected dosing regimen; and the use of any concomitant therapy.

The term "pharmaceutically acceptable carrier" refers to auxiliary materials widely used in the field of pharmaceutical production. The main purpose of the carrier is to provide a pharmaceutical composition that is safe to use, stable in nature and/or has specific functionalities, and to provide a method for obtaining an effective absorption in the body of a subject. The pharmaceutically acceptable carrier may be a filler that is inert or may be an active ingredient that provides some function to the pharmaceutical composition (e.g., stabilizes the overall pH of the composition or prevents degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable carriers include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, mucilages, disintegrants, lubricants, anti-adherent agents, glidants, gelling agents, absorption-delaying agents, dissolution inhibitors, enhancing agents, adsorbents, buffers, chelating agents, preservatives, coloring agents, flavoring and sweetening agents and the like.

Unless defined otherwise or clearly indicated by context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

EXAMPLE 1NCT RNA construction

(1) Non-capped linear RNA (NCT RNA) was obtained from the DNA vector design, and the schematic frame is shown in FIG. 1. Wherein, the structure of the DNA carrier is as follows from 5 'to 3': t7 promoter, D3 (Flaviviridae dengue virus genome sfRNA), spacer (spacer sequence), IRES, CDS (coding region of target gene), 3' -UTR, polyA, according to IVT design to obtain corresponding NCT RNA, its structure is from 5' to 3 ': d3 (Flaviviridae dengue virus genome sfRNA), spacer, IRES, CDS (coding region of target gene), 3' -UTR, polyA. 5 '-ppp in FIG. 1 represents the triphosphate radical carried by the first base NTP during IVT, since NCT RNA does not involve capping, resulting in its mRNA having a triphosphate radical at the 5' -end.

(2) The translational initiation element sequences CVB3 (Coxsackie virus B3) and IRES (the sequences are shown as SEQ ID NO: 1), EV71 (enterovirus 71) and IRES (the sequences are shown as SEQ ID NO: 2), E29 (echovirus 29 ) and HRV-B3 (human rhinovirus, human rhinovirus B3) with high expression proteins are selected (the sequences are shown as SEQ ID NO: 3).

(3) The software RNAfold was used to predict the secondary structure of dengue virus genome sfRNA (D3, sequence shown in SEQ ID NO: 5) and the predicted results are shown in FIG. 2.

(4) The secondary structure prediction was performed on CVB3 IRES, EV71 IRES, E29 IRES and HRV-B3 IRES using software RNAfold, respectively, and the prediction results are shown in FIG. 3, FIG. 4, FIG. 5 and FIG. 6, respectively.

(5) According to the predicted secondary structures of (3) and (4), a spacer sequence (spacer) for NCT RNA was designed. The interval sequence has less hairpin structure and does not interfere the secondary structure of the two sequences (3) and (4), two interval sequences are preferably designed, the interval sequence 1 is shown as SEQ ID NO. 11, the interval sequence 2 is a PABPs sequence shown as SEQ ID NO. 12.

(6) The software RNAfold was used to predict the secondary structure of the eiF4G aptamer (sequence shown in SEQ ID NO: 6) and the predicted results are shown in FIG. 7.

(7) According to the predicted secondary structures of (4) and (6), the eiF4G aptamer nucleic acid molecules are integrated into the IRES domain IV of CVB3 IRES, EV71 IRES, E29 IRES and HRV-B3 IRES, and the integrated structures of the CVB3 IRES, EV71 IRES, E29 IRES and HRV-B3 IRES are kept unchanged, so that CVB3 IRES derivatives (the sequences of which are shown as SEQ ID NO: 7), EV71 IRES derivatives (the sequences of which are shown as SEQ ID NO: 8), E29 IRES derivatives (the sequences of which are shown as SEQ ID NO: 9) and HRV-B3 IRES derivatives (the sequences of which are shown as SEQ ID NO: 10) are respectively obtained after integration, and the secondary structure predictions of the CVB3 IRES derivatives, EV71 IRES derivatives, E29 IRES derivatives and HRV-B3 IRES derivatives are respectively carried out by using software RNAfold, and the predicted results of which are shown as FIG. 8, FIG. 9, FIG. 10 and FIG. 11.

TABLE 1 specific sequences of elements involved in NCT RNA of the present invention

Element name	Sequence(s)
		CVB3 IRES	TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGC GCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATA CCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAA CAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTG TTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGG AGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTA ACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGT GTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGT GGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGG ACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTT GGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAG CACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACT CTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTAT TCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCA TATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTAT ATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTA AAACATTACAATTCATTGTTAAGTTGAATACAGCAAA（SEQ ID NO:1）
EV71 IRES	TTAAAACAGCTGTGGGTTGTCACCCACCCACAGGGTCCACTGGG CGCTAGTACACTGGTATCTCGGTACCTTTGTACGCCTGTTTTAT ACCCCCTCCCTGATTTGCAACTTAGAAGCAACGCAAACCAGATC AATAGTAGGTGTGACATACCAGTCGCATCTTGATCAAGCACTTC TGTATCCCCGGACCGAGTATCAATAGACTGTGCACACGGTTGAA GGAGAAAACGTCCGTTACCCGGCTAACTACTTCGAGAAGCCTAG TAACGCCATTGAAGTTGCAGAGTGTTTCGCTCAGCACTCCCCCC GTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACC GTGGCGGTGGCTGCGTTGGCGGCCTGCCTATGGGGTAACCCATA GGACGCTCTAATACGGACATGGCGTGAAGAGTCTATTGAGCTAG TTAGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGG AGCACATACCCTTAATCCAAAGGGCAGTGTGTCGTAACGGGCAA CTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCTTTTT ATTCTTGTATTGGCTGCTTATGGTGACAATTAAAGAATTGTTAC CATATAGCTATTGGATTGGCCATCCAGTGTCAAACAGAGCTATT GTATATCTCTTTGTTGGATTCACACCTCTCACTCTTGAAACGTT ACACACCCTCAATTACATTATACTGCTGAACACGAAGCG（SEQ ID NO:2）
		E29 IRES	ttaaaacagcctgtgggttgatcccacccacagggcccactggg cgctagcactctggtatcacggtacctttgtgcgcctgttttat acttcctcccccaactgcaacttagaagtaacacaaaccgatca acagtcagcgtggcacaccagccacgttttgatcaaacacttct gttaccccggactgagtatcaatagactgctcacgcggttgaag gagaaaacgttcgttatccggccaactacttcgagaaacctagt aacgccatggaagttgtggagtgtttcgctcagcactaccccag tgtagatcaggttgatgagtcaccgcattccccacgggtgaccg tggcggtggctgcgttggcggcctgcccatggggaaacccatgg gacgctcttatacagacatggtgcgaagagtctattgagctagt tggtagtcctccggcccctgaatgcggctaatcccaactgcgga gcatacactctcaagccagagggtagtgtgtcgtaatgggcaac tctgcagcggaaccgactactttgggtgtccgtgtttcatttta ttcctatactggctgcttatggtgacaattgagagattgttacc atatagctattggattggccatccggtgactaacagagctatta tatatctttttgttgggtttataccacttagcttgaaagaggtt aaaactctacattacattttaatactgaacaccgcaaa（SEQ ID NO:3）
HRV-B3 IRES	TTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGT AGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATT GTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAA CATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTAC AAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACT GCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAG CTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATT TCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGG GTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCAGCTTATGCT GGGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTT GGTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCT GGAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGC AATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTA TTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATA TACTGTGATC（SEQ ID NO:4）
		D3	taaaagtcaggtcggatcaagccatagtacggaaaaaactatgc tacctgtgagccccgtccaaggacgttaaaagaagtcaggccat cacaaatgccacagcttgagtaaactgtgcagcctgtagctcca cctgagaaggtgtaaaaaatctgggaggccacaaaccatggaag ctgtacgcatggcgtagtggactagcggttagaggagacccctc ccttacaaatcgcagcaacaac（SEQ ID NO:5）
eiF4G aptamer	ACTCACTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCG（SEQ ID NO:6）
		CVB3 IRES derivatives	TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGC GCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATA CCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAA CAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTG TTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGG AGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTA ACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGT GTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGT GGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGACTCACTATTTG TTTTCGCGCCCAGTTGCAAAAAGTGTCGCCCATGGGACGCTCTA ATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCC TCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACC CTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCG GAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATAC TGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTA TTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCT TTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTA CAATTCATTGTTAAGTTGAATACAGCAAA（SEQ ID NO:7）
EV71 IRES derivatives	TTAAAACAGCTGTGGGTTGTCACCCACCCACAGGGTCCACTGGG CGCTAGTACACTGGTATCTCGGTACCTTTGTACGCCTGTTTTAT ACCCCCTCCCTGATTTGCAACTTAGAAGCAACGCAAACCAGATC AATAGTAGGTGTGACATACCAGTCGCATCTTGATCAAGCACTTC TGTATCCCCGGACCGAGTATCAATAGACTGTGCACACGGTTGAA GGAGAAAACGTCCGTTACCCGGCTAACTACTTCGAGAAGCCTAG TAACGCCATTGAAGTTGCAGAGTGTTTCGCTCAGCACTCCCCCC GTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACC GTGGCGGTGGCTGCGTTGGCGGCCTGCCTATGGGCCACTCACTA TTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGGGCCCATAGGAC GCTCTAATACGGACATGGCGTGAAGAGTCTATTGAGCTAGTTAG TAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCA CATACCCTTAATCCAAAGGGCAGTGTGTCGTAACGGGCAACTCT GCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCTTTTTATTC TTGTATTGGCTGCTTATGGTGACAATTAAAGAATTGTTACCATA TAGCTATTGGATTGGCCATCCAGTGTCAAACAGAGCTATTGTAT ATCTCTTTGTTGGATTCACACCTCTCACTCTTGAAACGTTACAC ACCCTCAATTACATTATACTGCTGAACACGAAGCG（SEQ ID NO:8）
		E29 IRES derivatives	ttaaaacagcctgtgggttgatcccacccacagggcccactggg cgctagcactctggtatcacggtacctttgtgcgcctgttttat acttcctcccccaactgcaacttagaagtaacacaaaccgatca acagtcagcgtggcacaccagccacgttttgatcaaacacttct gttaccccggactgagtatcaatagactgctcacgcggttgaag gagaaaacgttcgttatccggccaactacttcgagaaacctagt aacgccatggaagttgtggagtgtttcgctcagcactaccccag tgtagatcaggttgatgagtcaccgcattccccacgggtgaccg tggcggtggctgcgttggcggcctgcccatgggACTCACTATTT GTTTTCGCGCCCAGTTGCAAAAAGTGTCGcccatgggacgctct tatacagacatggtgcgaagagtctattgagctagttggtagtc ctccggcccctgaatgcggctaatcccaactgcggagcatacac tctcaagccagagggtagtgtgtcgtaatgggcaactctgcagc ggaaccgactactttgggtgtccgtgtttcattttattcctata ctggctgcttatggtgacaattgagagattgttaccatatagct attggattggccatccggtgactaacagagctattatatatctt tttgttgggtttataccacttagcttgaaagaggttaaaactct acattacattttaatactgaacaccgcaaa（SEQ ID NO:9）
HRV-B3 derivatives	TTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGT AGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATT GTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAA CATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTAC AAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACT GCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAG CTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATT TCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGG GTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCAGCCCACTCA CTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGGGGCTGGGA CGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTGGTT GTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTGGAG CCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGCAATT CCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTATTTT TCTTATTATTGTCTTATGGTCACAGCATATATATAACATATACT GTGATC（SEQ ID NO:10）
		Spacer sequence 1	AAACGCAATAGCCGAAAAACAAAAAACAAAAAAAACAAAAAAAA AACCAAAAAAACAAAACACA（SEQ ID NO:11）
Spacer sequence 2	AAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAATAATT GACTAA（SEQ ID NO:12）
		3’-UTR	CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCT GGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCC CACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACAC CTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCC ACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAAC GAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTC GTGCCAGCCACACC（SEQ ID NO:13）
polyA	AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA（SEQ ID NO:14）
		EGFP	ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT CCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCG TGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACC CTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCC CACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCC GCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCC ATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGA CGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCG ACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAG GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAA CAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCA TCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGC GTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGA CGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGT CCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTC CTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGA CGAGCTGTACAAGTAATAA（SEQ ID NO:15）
Fluc	ATGGAGGACGCCAAGAACATCAAGAAGGGCCCCGCCCCCTTCTA CCCCCTGGAGGACGGCACCGCCGGCGAGCAGCTGCACAAGGCCA TGAAGCGGTACGCCCTGGTGCCCGGCACCATCGCCTTCACCGAC GCCCACATCGAGGTGGACATCACCTACGCCGAGTACTTCGAGAT GAGCGTGCGGCTGGCCGAGGCCATGAAGCGGTACGGCCTGAACA CCAACCACCGGATCGTGGTGTGCAGCGAGAACAGCCTGCAGTTC TTCATGCCCGTGCTGGGCGCCCTGTTCATCGGCGTGGCCGTGGC CCCCGCCAACGACATCTACAACGAGCGGGAGCTGCTGAACAGCA TGGGCATCAGCCAGCCCACCGTGGTGTTCGTGAGCAAGAAGGGC CTGCAGAAGATCCTGAACGTGCAGAAGAAGCTGCCCATCATCCA GAAGATCATCATCATGGACAGCAAGACCGACTACCAGGGCTTCC AGAGCATGTACACCTTCGTGACCAGCCACCTGCCCCCCGGCTTC AACGAGTACGACTTCGTGCCCGAGAGCTTCGACCGGGACAAGAC CATCGCCCTGATCATGAACAGCAGCGGCAGCACCGGCCTGCCCA AGGGCGTGGCCCTGCCCCACCGGACCGCCTGCGTGCGGTTCAGC CACGCCCGGGACCCCATCTTCGGCAACCAGATCATCCCCGACAC CGCCATCCTGAGCGTGGTGCCCTTCCACCACGGCTTCGGCATGT TCACCACCCTGGGCTACCTGATCTGCGGCTTCCGGGTGGTGCTG ATGTACCGGTTCGAGGAGGAGCTGTTCCTGCGGAGCCTGCAGGA CTACAAGATCCAGAGCGCCCTGCTGGTGCCCACCCTGTTCAGCT TCTTCGCCAAGAGCACCCTGATCGACAAGTACGACCTGAGCAAC CTGCACGAGATCGCCAGCGGCGGCGCCCCCCTGAGCAAGGAGGT GGGCGAGGCCGTGGCCAAGCGGTTCCACCTGCCCGGCATCCGGC AGGGCTACGGCCTGACCGAGACCACCAGCGCCATCCTGATCACC CCCGAGGGCGACGACAAGCCCGGCGCCGTGGGCAAGGTGGTGCC CTTCTTCGAGGCCAAGGTGGTGGACCTGGACACCGGCAAGACCC TGGGCGTGAACCAGCGGGGCGAGCTGTGCGTGCGGGGCCCCATG ATCATGAGCGGCTACGTGAACAACCCCGAGGCCACCAACGCCCT GATCGACAAGGACGGCTGGCTGCACAGCGGCGACATCGCCTACT GGGACGAGGACGAGCACTTCTTCATCGTGGACCGGCTGAAAAGC CTGATCAAGTACAAGGGCTACCAGGTGGCCCCCGCCGAGCTGGA GAGCATCCTGCTGCAGCACCCCAACATCTTCGACGCCGGCGTGG CCGGCCTGCCCGACGACGACGCCGGCGAGCTGCCCGCCGCCGTG GTGGTGCTGGAGCACGGCAAGACCATGACCGAGAAGGAGATCGT GGACTACGTGGCCAGCCAGGTGACCACCGCCAAGAAGCTGCGGG GCGGCGTGGTGTTCGTGGACGAGGTGCCCAAGGGCCTGACCGGC AAGCTGGACGCCCGGAAGATCCGGGAGATCCTGATCAAGGCCAA GAAGGGCGGCAAGATCGCCGTGTGATAG（SEQ ID NO:16）

EXAMPLE 2 preparation of NCT RNA

(1) Gene synthesis

Designing plasmid synthesis and clone construction (completed by entrusting gold, and connecting the obtained gene fragment to a pUC57 vector;

(2) Linearized plasmid template preparation

1) Plasmid extraction

a. Activating the synthesized puncture bacteria under the activation condition of 37 ℃/250 rpm/3-4 hours;

b. and (3) taking activated bacterial liquid for expansion culture, wherein the culture conditions are as follows: 37 ℃/250 rpm/overnight;

c. plasmid extraction (using the small endotoxin-free medium extraction kit) and OD 260/280 was measured.

2) Plasmid enzyme digestion

The plasmid prepared in the above step 1) was digested with SapI or BspQI single cleavage method, and the cleavage system is shown in Table 2.

TABLE 2 enzyme digestion system

Reagent(s)	Volume of
		Plasmid(s)	10ug
Enzyme (1000U)	5ul
		10x buffer	50ul
Nuclease-free water	Total volume of 500ul

Cleavage was carried out overnight at 37 ℃. The digested products were recovered using a universal DNA purification kit (Tiangen Biochemical Co., ltd.), OD was measured and identified by 1% agarose gel electrophoresis. The purified linear plasmid templates were used for in vitro transcription.

(3) Preparation of non-capped Linear mRNA by in vitro transcription

1) In vitro transcription

mRNA was synthesized using the T7 in vitro transcription kit (Vazyme T7 High Yield RNA Transcription Kit) and the transcription system is shown in Table 3.

TABLE 3 transcription system

Reagent(s)	Volume of
		T7 RNA Polymerase Mix	2 ul
10x Transcription Buffer	2 ul
		UTP Solution
	2 ul
		ATP Solution
	2 ul
		CTP Solution
	2 ul
		GTP Solution
	2 ul
		Stencil (1 ug)	x ul
Adding RNase-free ddH ₂ O reaches the final volume	20 ul

Incubation was carried out at 37℃for 2h, and then the linear DNA template was digested with DNase I. Digestion conditions: digestion is carried out at 37℃for 15min.

2) Non-capping linear mRNA purification

The transcription product obtained in the step 1) is purified by using a LiCl precipitation method, and the OD value and 1% denaturing agarose gel electrophoresis are measured to identify the RNA size.

The preparation method of the 1% modified agarose gel comprises the following steps:

1) Weighing 1g agarose, adding into 72ml of nucleic-free H2O, and heating and dissolving in a microwave oven;

2) Cooling the agarose to 55-60deg.C, adding 0.1% gel red,10ml10x MOPS,18ml formaldehyde into a fume hood, and pouring glue;

3) The procedure for denaturing agarose gel electrophoresis was as follows: taking an equal volume of sample RNA and carrying out denaturation at 2x loading buffer,65-70 ℃ for 5-10min. Loading, electrophoresis is carried out under the condition of 100v/30min, and then a gel imaging system is adopted for photographing.

NCT RNA1-6 was obtained by the preparation of this example 2; NCTRNA 1-2, 7-9-Fluc; the supplied RNA-Fluc; the structure of the oRNA-Fluc is as follows in sequence from 5 'to 3':

NCT RNA1：D3、spacer、CVB3 IRES、EGFP，3’-UTR、polyA。

NCT RNA2：D3、CVB3 IRES、EGFP，3’-UTR、polyA。

NCT RNA3：D3、PABPs、CVB3 IRES、EGFP，3’-UTR、polyA。

NCT RNA4：CVB3 IRES、EGFP，3’-UTR、polyA。

NCT RNA5：spacer、CVB3 IRES、EGFP，3’-UTR、polyA。

NCT RNA6: d3, spacer, CVB3 IRES incorporating eiF4G aptamer, EGFP,3' -UTR, polyA.

NCT RNA 1-Fluc：D3、spacer、CVB3 IRES、Fluc，3’-UTR、polyA。

NCT RNA 2-Fluc：D3、CVB3 IRES、Fluc，3’-UTR、polyA。

NCT RNA 7-Fluc：D3、spacer、EMCV IRES、Fluc，3’-UTR、polyA。

NCT RNA 8-Fluc：D3、spacer、E29 IRES、Fluc，3’-UTR、polyA。

NCT RNA 9-Fluc：D3、spacer、EV71 IRES、Fluc，3’-UTR、polyA。

Capped RNA-Fluc：5’-UTR、Fluc，3’-UTR、polyA。

The oRNA-Fluc: the main element is IRES, fluc, polyA.

EGFP in NCT RNA1-6 is an enhanced green fluorescent protein gene, and Fluc in NCT RNA1-2 and 7-9-Fluc is firefly luciferase. The Capped RNA-Fluc is an example of a capping RNA. The oRNA-Fluc is an example of a circular RNA. FIG. 12 shows NCT RNAs 1-6 of the present invention; schematic representation of NCT RNA1-2, 7-9-Fluc. FIG. 13 shows schematic representations of the supported RNA-Fluc and oRNA-Fluc of the present invention.

Wherein the spacer of NCT RNA1 is spacer sequence 1;

NCT RNA2 is that sfRNA is directly connected with CVB3 IRES without a spacer;

the spacer of NCT RNA3 is spacer 2, i.e. panps;

NCT RNA4 has no sfRNA and spacer, only CVB3 IRES;

NCT RNA5 has no sfRNA and spacer is spacer 1;

the spacer between sfRNA and CVB3 of NCT RNA6 is spacer 1.

NCT RNA 1-2-Fluc used CVB3 IRES and NCT RNA7-9-Fluc used different IRES.

The spacer in the NCT RNA was spacer 1 except NCT RNA 3.

Example 3 verification of expression of non-capped Linear RNA synthesized in vitro

The present example uses a non-Capped linear RNA framework for NCT RNA1-Fluc, NCT RNA2-Fluc expressing firefly luciferase protein, with gapped RNA-Fluc and oRNA-Fluc as controls. The experimental results are shown in FIG. 14, wherein the abscissa in FIG. 14 represents different RNAs, and No.1 is oRNA-Fluc; no.2 is supported RNA-Fluc; no.3 is NCT RNA2-Fluc; no.4 is NCT RNA1-Fluc. The ordinate is a chemiluminescent signal, and a higher ordinate represents a higher protein expression amount in a cell. The results in fig. 14 demonstrate that Fluc protein expression in HEK293T cells under the NCT RNA architecture of the invention is comparable to the former two compared to classical capped linear mRNA and circular RNA, demonstrating that the NCT RNA framework of the invention can be used to express a variety of proteins and that protein expression meets the expected needs.

Furthermore, in FIG. 14, the structure of NCT RNA1-Fluc and NCT RNA 2-Fluc differ only by the presence of a spacer of sequence SEQ ID NO:11 between the former D3 and CVB 3. The value of the ordinate of NCT RNA1-Fluc is higher than that of NCT RNA 2-Fluc, and the NCT RNA framework protein containing the spacer has higher expression quantity and better effect.

Wherein, the detection method is Fluc detection, as follows:

HEK293T cells were plated on a 96-well plate with a transparent black bottom, and then, on the next day, NCT RNA expressing Fluc was transfected in an amount of 350ng mRNA transfected per well, and on the control, supported Fluc mRNA was used, and D-sodium fluorescein was added at a final concentration of 300ng/ul 24 hours after transfection, and chemiluminescent signals were detected by an enzyme-labeled instrument.

Example 4 animal experiments to verify the expression of non-capped linear RNA in vivo

This example uses the NCT RNA framework to prepare NCT RNA1-Fluc, taking NCT RNA1-Fluc as an example. Control group was set up with commercial Fluc (apexbio Co., EZ cap ^TM Firefly Luciferase mRNA). Balb/c mice are selected and intramuscular injection is carried out, and the dosage is 5ug of control group added liposome LNP and 5ug of NCT RNA1-Fluc added liposome LNP. The injection site and abdomen of the mice were shaved prior to imaging, and the expression of Fluc in the mice was observed at 24, 48, and 72 hours after administration, thereby determining the stability of both mrnas in vivo and the persistence of Fluc expression. The results of the 24, 48, 72 hour imaging photographs of the mice are shown in fig. 15A. The results of the detection of the relative light units are shown in FIG. 15B, and the abscissa of FIG. 15B represents the time (hours) after administration, and the ordinate represents the chemiluminescent signal (RLU), and the higher the ordinate, the higher the mRNA protein expression amount in the cells. The results of the photographs in FIG. 15A and the graphs in FIG. 15B show that NCT RNA1-Fluc is expressed in mice in a higher amount than commercial Fluc in comparison with the control, and that NCT RNA1-Fluc is expressed in 24, 48 and 72 hours, so that the stability and the durability of NCT RNA1-Fluc expression are relatively better from the expression effect. Indicating that the Fluc expression mediated by NCT RNA architecture has stable and durable characteristics.

Example 5 NCT RNA of the present invention has a better effect with dengue virus sfRNA (D3) than with other flaviviridae sfRNA

This example uses a non-capped linear RNA framework for NCT RNA1 expressing EGFP. In addition, a control NCT RNA z-EGFP was constructed with the structure of:

NCT RNA z- EGFP：Z3、spacer、CVB3 IRES、EGFP，3’-UTR、polyA。

NCT RNA Z-EGFP differs from NCT RNA1 only in that they use different flavivirus sfRNAs, NCT RNA1 uses dengue virus sfRNA (D3), NCT RNA Z-EGFP uses Zika virus sfRNA (Z3). A schematic of NCT RNA z-EGFP is shown in FIG. 16. Wherein the sfRNA sequence of Zika virus (Zika) as shown in SEQ ID NO:17 is as follows:

TTGTCAGGCCTGCTAGTCAGCCACAGCTTGGGGAAAGCTGTGCAGCCTGTGACCCCCCCAGGAGAAGCTGGGAAACCAAGCCCATAGTCAGGCCGAGAACGCCATGGCACGGAAGAAGCCATGCTGCCTGTGAGCCCCTCAGAGGACACTGAGTC（SEQ ID NO:17）

the results of EGFP expression experiments are shown in FIG. 17, and the results show that the expression level of EGFP using NCT RNA1 of dengue virus sfRNA (D3) is significantly higher than NCT RNA Z-EGFP using Zika virus sfRNA (Z3). This shows that the NCT RNA of the invention has higher expression level of target protein by adopting dengue virus sfRNA (D3) than other flavivirus sfRNA, and better effect.

The detection method comprises the following steps:

EGFP detection: HEK293T cells were plated in single wells on clear plastic 24-well plates, 1ug of EGFP-expressing NCT RNA was transfected the next day, and the EGFP expression in HEK293T cells was observed by an inverted fluorescence microscope at 24, 48 and 72 hours after transfection, respectively, and photographed.

EXAMPLE 6 NCT RNA of the invention has better effect when combined with D3 and CVB3 IRES than when combined with other IRES

The present example uses a non-capped linear RNA framework for expressing NCT RNA1-Fluc, NCT RNA2-Fluc, NCT RNA7-Fluc, NCT RNA8-Fluc, NCT RNA9-Fluc of firefly luciferase protein.

Wherein EMCV in NCT RNA7-Fluc refers to EMCV IRES, which is encephalomyocarditis virus (Encephalomyocarditis virus), and the sequence of the EMCVIRES (shown as SEQ ID NO: 18) is as follows:

TTGCCAGTCTGCTCGATATCGCAGGCTGGGTCCGTGACTACCCACTCCCCCTTTCAACGTGAAGGCTACGATAGTGCCAGGGCGGGTACTGCCGTAAGTGCCACCCCAAACAACAACAACAAAACAAACTCCCCCTCCCCCCCCTTACTATACTGGCCGAAGCCACTTGGAATAAGGCCGGTGTGCGTTTGTCTACATGCTATTTTCTACCGCATTACCGTCTTATGGTAATGTGAGGGTCCAGAACCTGACCCTGTCTTCTTGACGAACACTCCTAGGGGTCTTTCCCCTCTCGACAAAGGAGTGTAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTAAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGTGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACGTGCTTTACACGTGTTGAGTCGAGGTGAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAACCACGATTACAAT（SEQ ID NO:18）。

NCT RNA1-Fluc, NCT RNA2-Fluc differ from NCT RNA7-Fluc, NCT RNA8-Fluc, NCT RNA9-Fluc in that IRES from different viruses are used, NCT RNA1-Fluc, NCT RNA2-Fluc employs CVB3 IRES, NCT RNA7-9-Fluc employs different IRES, NCT RNA7 employs EMCV IRES, NCT RNA8-Fluc employs E29 IRES, and NCT RNA9-Fluc employs EV71 IRES.

The experimental results are shown in FIG. 18, wherein the abscissa in FIG. 18 shows different RNAs, and No.3 is NCT RNA2-Fluc; no.4 is NCT RNA1-Fluc; no.5 is NCT RNA7-Fluc; no.6 is NCT RNA8-Fluc; no.7 is NCT RNA9-Fluc. The ordinate is a chemiluminescent signal, and a higher ordinate represents a higher protein expression amount in a cell. The results in FIG. 18 show that the values on the ordinate of No.3, no.4 are higher than the values on the ordinate of No. 5-No. 7. As can be seen, the NCT RNA frame of the invention using the combination of D3 and CVB3 IRES has higher protein expression level and better effect than the combination of D3 and other virus IRES.

Wherein, the detection method is Fluc detection, as follows:

EXAMPLE 7 NCT RNA of the present invention has better effect by using eiF4G aptamer and PABPs respectively

This example uses a non-Capped linear RNA framework for expression of EGFP NCT RNA1, NCT RNA2, NCT RNA3, NCT RNA6, and control supplied mRNA. NCT RNA6 differs from NCT RNA1 only in that the former NCT RNA6 employs an eiF4G aptamer nucleic acid molecule that is integrated into the CVB3 IRES derivative of CVB3 IRES (CVB3+eiF4G aptamer, CVB3 IRES derivative sequence is shown as SEQ ID NO: 7), and the latter NCT RNA1 employs a CVB3 IRES (sequence is shown as SEQ ID NO: 1). NCT RNA3 differs from NCT RNA1 only in that the former NCT RNA3 uses a spacer sequence of PABPs (the PABPs sequence is shown as SEQ ID NO: 12), and the latter NCT RNA1 uses a spacer sequence of spacer (the spacer sequence is shown as SEQ ID NO: 11).

The results of EGFP expression experiments are shown in FIG. 19, and the results show that EGFP expression level of NCT RNA6 was higher than NCT RNA1. This shows that the IRES derivative of NCT RNA integrated with eiF4G aptamer has higher expression level and better effect than the target protein of IRES without using eiF4G aptamer. Integration of the eiF4G aptamer into the IRES, and NCT RNA combined by IRES mutants can significantly improve the expression level of the target gene. The results of FIG. 19 also show that EGFP of NCT RNA3 was used in higher amounts than NCT RNA1. This shows that the NCT RNA of the invention adopts PABPs as the spacer sequence, has higher target protein expression quantity and better effect than the spacer sequence, and the PABPs can improve IRES-mediated gene expression.

The detection method comprises the following steps:

The above examples of the present disclosure are merely examples for clearly illustrating the present disclosure and are not limiting of the embodiments of the present disclosure. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. Any modifications, equivalent substitutions, improvements, etc. that fall within the spirit and principles of the present disclosure are intended to be included within the scope of the claims of the present disclosure.

Claims

1. A non-capped linear RNA recombinant nucleic acid molecule, characterized in that: from the 5 'to 3' direction, the recombinant nucleic acid molecule comprises elements arranged in the following order:

2. The recombinant nucleic acid molecule of claim 1, wherein: the IRES is derived from Coxsackie virus B3 (Coxsackie virus B3) IRES, and the sequence of the Coxsackie virus B3 IRES is shown as SEQ ID NO. 1.

3. The recombinant nucleic acid molecule of claim 1 or 2, wherein: the flavivirus genome sfRNA is derived from any one selected from the group consisting of the following flaviviridae: zika virus, west Nile virus, japanese encephalitis virus and Tama Na bat virus.

4. The recombinant nucleic acid molecule of claim 1 or 2, wherein: the translation initiation element IRES is derived from any one of Enterovirus 71 (Enterovirus 71) IRES, echovirus 29 (Echovirus 29) IRES and human rhinovirus B3 (human rhinovirus B3) IRES, wherein the sequence of the Enterovirus 71 IRES is shown as SEQ ID NO. 2, the sequence of the Echovirus 29 IRES is shown as SEQ ID NO. 3, and the sequence of the human rhinovirus B3 IRES is shown as SEQ ID NO. 4.

5. The recombinant nucleic acid molecule of claim 1 or 2, wherein: integrating an eIF4G aptamer into the IRES to obtain a recombinant nucleic acid molecule comprising an IRES derivative; preferably, the eIF4G aptamer is integrated into IRES domain IV, the IRES derivative being a Coxsackie virus B3 (Coxsackie virus B3) IRES derivative, an Enterovirus 71 (Enterovirus 71) IRES derivative, an Echovirus 29 (Echovirus 29) IRES derivative or a human rhinovirus B3 (human rhinovirus B3) IRES derivative, the IRES derivative sequences being shown in SEQ ID NOS 7-10, respectively; wherein the eIF4G aptamer sequence is shown in SEQ ID NO. 6.

6. The recombinant nucleic acid molecule of claim 1 or 2, wherein: the interval sequence is shown as SEQ ID NO. 11.

7. The recombinant nucleic acid molecule of claim 1 or 2, wherein: the interval sequence is PABPs, and the PABPs sequence is shown as SEQ ID NO. 12.

8. The recombinant nucleic acid molecule of claim 1, wherein: from the 5 'to 3' direction, the recombinant nucleic acid molecule comprises elements arranged in the following order:

9. An expression cassette comprising the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8.

10. A vector comprising the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8 or the expression cassette of claim 9.

11. A cell comprising the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8 or the expression cassette of claim 9 or the vector of claim 10.

12. A pharmaceutical composition comprising the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8 or the expression cassette of claim 9 or the vector of claim 10 or the cell of claim 11; preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

13. A kit comprising the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8.

14. Use of a non-capped linear RNA recombinant nucleic acid molecule according to any one of claims 1 to 8 or an expression cassette according to claim 9 or a vector according to claim 10 or a cell according to claim 11 for the preparation of a pharmaceutical composition for the treatment or prophylaxis of a disease.

15. Use of a non-capped linear RNA recombinant nucleic acid molecule according to any one of claims 1 to 8 or an expression cassette according to claim 9 or a vector according to claim 10 or a cell according to claim 11 for the preparation of a diagnostic, detection kit.

16. Use of the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8 or the expression cassette of claim 9 or the vector of claim 10 or the cell of claim 11 for in vitro preparation of non-capped linear RNA.

17. A method for preparing a non-capped linear RNA recombinant nucleic acid molecule in vitro, characterized in that: the method comprises the following steps:

a transcription step: transcribing the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8, or the expression cassette of claim 9, or the vector of claim 10 in vitro to form non-capped linear RNA;

18. A method for expressing a polypeptide of interest in a cell, comprising: the method comprises transferring the non-capped linear RNA recombinant nucleic acid molecule of any one of claims 1-8, or the expression cassette of claim 9, or the vector of claim 10 into a cell and expressing the protein of interest.

19. Use of dengue virus genome sfRNA in the in vitro preparation of a non-capped linear RNA recombinant nucleic acid molecule characterized in that: the sequence of the sfRNA is shown as SEQ ID NO. 5.

20. Use of dengue virus genome sfRNA and IRES derived from coxsackievirus B3 in the in vitro preparation of a non-capped linear RNA recombinant nucleic acid molecule, characterized in that: the sfRNA sequence is shown as SEQ ID NO. 5, and the IRES sequence is shown as SEQ ID NO. 1.