CN116256519B - Antigen hypersensitive detection method - Google Patents

Antigen hypersensitive detection method Download PDF

Info

Publication number
CN116256519B
CN116256519B CN202310127635.7A CN202310127635A CN116256519B CN 116256519 B CN116256519 B CN 116256519B CN 202310127635 A CN202310127635 A CN 202310127635A CN 116256519 B CN116256519 B CN 116256519B
Authority
CN
China
Prior art keywords
sequence
nucleic acid
restriction enzyme
antibody
coating
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202310127635.7A
Other languages
Chinese (zh)
Other versions
CN116256519A (en
Inventor
李先坤
陈相如
赵久茗
刘一丁
王江
陈晓林
李佳皓
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chengdu Northen Medical Laboratory Co ltd
Original Assignee
Chengdu Northen Medical Laboratory Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chengdu Northen Medical Laboratory Co ltd filed Critical Chengdu Northen Medical Laboratory Co ltd
Priority to CN202310127635.7A priority Critical patent/CN116256519B/en
Publication of CN116256519A publication Critical patent/CN116256519A/en
Application granted granted Critical
Publication of CN116256519B publication Critical patent/CN116256519B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804—Nucleic acid analysis using immunogens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54306—Solid-phase reaction mechanisms
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54326—Magnetic particles
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention belongs to the field of molecular biology, and particularly relates to an antigen hypersensitive detection method, which comprises the following steps of: s1, antibody coating: coating the antibody in a solid phase or a liquid phase; s2, capturing target molecules: coating and then adding a sample to be tested; s3, binding a labeled antibody with a target: adding a labeled antibody coupled to a nucleic acid target sequence; s4, binding the sandwich complex with an amplifying molecule: adding an amplifying molecule, wherein the amplifying molecule is composed of a leader sequence and a 5-20 times repeated sequence, and the leader sequence is complementary with the nucleic acid target sequence; s5, generating a chemiluminescent signal: adding a report probe and then adding a chemiluminescent substrate to read a result; the reporter probe is complementary to the repeat sequence of the amplifier molecule. The invention uses the amplifying sequence for detecting nucleic acid to detect antigen, overcomes the different gap between the nucleic acid detection and the protein detection principle, remarkably expands the lowest detection limit of antigen compared with the prior art, and has good specificity and high detection rate.

Description

Antigen hypersensitive detection method
Technical Field
The invention belongs to the field of molecular biology, and particularly relates to an antigen hypersensitive detection method.
Background
Enzyme-linked immunosorbent assay (ELISA) is a common method of antibody or antigen determination. ELISA was based on the enzyme-catalyzed reaction of those immune complexes with the associated enzyme. Antibodies can be immobilized on a surface-coated plastic plate, so that the immune complex can be easily separated from other components for measurement by simply washing the plastic plate.
Biotin-streptavidin signal amplification System, biotin-Avidin-System (BAS) was a novel biological reaction amplification System developed at the end of the 70 s. With the advent of various biotin derivatives, BAS is rapidly being used in a wide variety of medical fields. In recent years, a number of studies have demonstrated that the biotin-avidin system can be almost bound to various markers that have been successfully studied. The high affinity firm combination between biotin and avidin and the multi-stage amplification effect make BAS immunolabeling and related tracer analysis more sensitive. It has become a new technology widely used for qualitative and quantitative detection and positioning observation and research of trace antigen and antibody.
Since each avidin can bind 4 molecules of biotin, this feature can be used to construct a multi-layered signal amplification system. However, such amplification is limited, resulting in no substantial improvement in detection sensitivity. Meanwhile, the multistage amplification operation is complex, and the result is uncontrollable.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a technical scheme for antigen hypersensitive detection, and the signal feedback result with extremely low concentration level is finally detected through signal amplification treatment on the labeled secondary antibody labeled nucleic acid molecules.
The aim of the invention is realized by the following technical scheme: an antigen hypersensitivity detection method comprising the steps of:
s1, antibody coating: coating the antibody in a solid phase or a liquid phase; the antibody is specifically combined with a target molecule in a sample to be detected, and the target molecule is an antigen;
s2, capturing target molecules: coating and then adding a sample to be tested;
s3, binding a labeled antibody with a target: adding a labeled antibody, wherein the labeled antibody is specifically combined with a target molecule in a sample to be detected, and the labeled antibody is coupled with a nucleic acid target sequence;
s4, binding the sandwich complex with an amplifying molecule: adding an amplifier consisting of a leader sequence and a 5-to 20-fold repeat sequence, the leader sequence being complementary to the nucleic acid target sequence, the leader sequence being different from the repeat sequence;
s5, generating a chemiluminescent signal: adding a report probe and then adding a chemiluminescent substrate to read a result; the reporter probe is complementary to the repeat sequence of the amplifier.
In step S1, the method of solid phase coating is to use a microplate to coat the sample to be tested, and the method of liquid phase coating is to use magnetic beads to coat the sample to be tested.
Further, in step S3, the method for coupling the labeled antibody to the nucleic acid target sequence is as follows: religation by modification with a chemical coupling agent.
Further, in step S3, the labeled antibody is labeled with streptavidin.
Further, in step S4, the Tm value of the leader sequence is 55 ℃ to 62 ℃; the Tm value of the repeated sequence is less than 55 ℃; the 5' end of the leader sequence also comprises a fragment which is subjected to enzyme digestion by a restriction enzyme I enzyme digestion site protected by phosphorothioate adenosine, and the restriction enzyme I enzyme digestion site is an adhesive end after enzyme digestion; the 3' end of the nucleic acid signal amplification sequence also comprises a fragment which is subjected to enzyme digestion by an enzyme digestion site of restriction enzyme II; the restriction enzyme II enzyme cutting site is cut into a flat tail end.
Further, in step S4, the preparation method of the amplifying molecule includes the following steps:
A. designing a nucleic acid signal leader sequence and a plurality of times of repeated sequences, respectively adding restriction enzyme I cleavage sites at the 5 'end of the leader sequence, and adding restriction enzyme II cleavage sites at the 3' end of the plurality of times of repeated sequences; the restriction enzyme I cleavage site is connected with the leader sequence of the nucleic acid signal amplification sequence, and is a sticky end after cleavage; the restriction enzyme II enzyme cutting site is connected with the repeated sequence of the nucleic acid signal amplifying sequence, and the end of the restriction enzyme II enzyme cutting site is flat;
B. the synthesized sequence is inserted into a vector and then cloned and copied;
C. single cleavage of the vector sequence with restriction enzyme I to generate a 5 'cohesive end, and filling of the 5' cohesive end with Kelnow large fragment polymerase and thioadenosine triphosphate; cutting the target strip from the carrier by using restriction enzyme II;
D. and (3) carrying out exonuclease III digestion to obtain a nucleic acid signal amplification sequence.
Further, wherein the restriction enzyme I is one of EcoRI, bamHI, hindII, hindIII; the restriction enzyme II is one of EcoR V, alu I, bsu R I, bal I, hal III, HPa I and Sma I.
Further, the vector is pGEM-3ZF (+) vector.
Further, in step S5, alkaline phosphatase is attached to the reporter probe, and the chemiluminescent substrate reacts with alkaline phosphatase to generate a chemiluminescent signal.
Further, in step S5, the method for reading the result is as follows: and judging the concentration level of the target molecule according to the intensity of the chemiluminescent signal.
The beneficial effects of the invention are as follows: the invention uses the amplifying sequence for detecting nucleic acid to detect antigen, overcomes the different gap between the nucleic acid detection and the protein detection principle, remarkably expands the lowest detection limit of antigen compared with the prior art, and has good specificity and high detection rate.
Drawings
Fig. 1 and 2 are flowcharts of the detection principle of the present invention.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to the accompanying drawings, but the scope of the present invention is not limited to the following description.
The detection principle flow of the invention is as follows:
A. antibody coating: coating the antibody in a solid phase or liquid phase, wherein the coating carrier can be a micro-pore plate or magnetic beads; the antibody is specifically combined with a target molecule in a sample to be detected, and the target molecule is one of protein, antigen, antibody and molecular polymer;
B. target molecule capture: coating and then adding a sample to be tested;
C. labeled antibody binding to target: adding a labeled antibody, wherein the labeled antibody is specifically combined with a target molecule in a sample to be detected, and the labeled antibody is coupled with a nucleic acid target sequence;
D. sandwich complexes bind to amplifying molecules: the amplification molecule (the amplification molecule in the invention is a nucleic acid signal amplification sequence disclosed in patent CN 105886501) is added, and the amplification molecule is selectively hybridized and combined with the pre-amplification molecule to form a branched structure. A large number of amplifying molecules can be combined on each pre-amplifying molecule, and the signal is further amplified. The amplifier is composed of a leader sequence and a 5-20 times repetitive sequence, wherein the leader sequence is complementary to the nucleic acid target sequence, and the leader sequence is different from the repetitive sequence;
E. probe label binding: adding a probe label containing alkaline phosphatase, and hybridizing the probe label connected with alkaline phosphatase to bind with the amplifying molecule. A large number of probe labels may be bound to each amplification molecule, allowing the signal to be amplified even further.
F. Generating a chemiluminescent signal: adding a substrate, reacting with alkaline phosphatase on a probe marker to generate a chemiluminescent signal, wherein the intensity of light is positively correlated with the amount of target protein, the amount of target protein can be captured by reacting the intensity of the light signal of a chemiluminescent detector, and the light signal is expressed by relative photon numbers.
G. Detecting a target: the concentration level of the target molecule is detected, and then the experimental result is calculated according to the obtained photon number.
For a further understanding of the present invention, the present invention will be described in detail with reference to specific examples, taking the detection of novel coronavirus N antigen as an example. Unless otherwise indicated, the reagents and apparatus used in the present invention are those commonly used in the art. The methods according to the present invention are all general methods in the art.
Example 1 antibody coating (solid support)
1. Reagent(s)
Coating solution (carbonate buffer): 1.5 to 1.9g/L of sodium carbonate (raw material); sodium bicarbonate (raw material) 2.6-3.0 g/L; the water was purified to 1L (pH 9.5-9.7).
Sealing liquid: bovine serum albumin (SIGMA, B2064) 5-6 g/L; 35-40 g/L of sucrose (raw material); tryptone (raw) 8-10 g/L; procLin 300 (SIGMA) 0.5-1 mL/L; the water was purified to 1L.
Washing liquid: 0.1 to 0.2g/L of monopotassium phosphate (raw material); 2.8 to 2.9g/L of disodium hydrogen phosphate dodecahydrate (raw material); 8-9 g/L of sodium chloride (raw material); tween-20 (SIGMA) 0.5-1 mL/L; the water was purified to 1L.
2. Coating method
1. Diluted antibodies (Phenanthron organism, COV19-PS-MAb 17) are coated at the concentration of 4-5 ng/uL, 2.0-2.5 ng/uL, 1-1.25 ng/uL and 100 uL/hole;
2. incubation at 2-8deg.C overnight (or 3h at 37deg.C).
3. Washing the plate with washing liquid, namely 400 uL/Kong Xi plate for 1 time, and beating to dry.
4. Sealing-150 uL/hole adding sealing liquid
Refrigerating and incubating overnight at 5.2-8 ℃ (or 2h at 37 ℃);
6. the sealing liquid in the coating plate is pumped out and then is patted dry.
7. Placing the coated plate on a clean baking plate frame, and baking for 3-4 hours until thoroughly drying; the temperature is controlled to be 37 ℃ (+/-2 ℃) and the humidity is controlled to be less than 40% in the drying process;
the data results are shown in Table 1 below:
TABLE 1
The coating concentration is preferably 2.0-2.5 ng/uL.
Example 2 preparation of nucleic acid-antibody Complex
1. Reagent(s)
Antibody dilution: 1 to 1.5g/L of sodium dihydrogen phosphate (raw material); disodium hydrogen phosphate (raw) 0.4-0.5 g/L; 20-20.5 g/L of sodium chloride (raw material); tween-20 (SIGMA) 1-1.5 mL/L; the new born calf serum (raw industry) is 50-55 mL/L; tritonX-100 (SIGMA) 1-1.5 mL/L; procLin 300 (SIGMA) 0.5-1 mL/L; the water was purified to 1L.
2. Preparation method
Use of strepitavidin coupling kit(ab 102921) (abcam) for labelling of antibodies.
1. The antibody (Phenanthroid, COV19-PS-MAb 15) was diluted to 1mg/mL with sterile water.
2. 100uL of antibody was added to strepavidin mix (powder).
3. 10uL Modifier reagent was added.
4. Standing at normal temperature for 3h.
5. 10 portions of uL Quencher reagent are added and reacted for 30 minutes.
6. Adding antibody diluent to make the final concentration of labeled antibody be 0.1-0.4 mg/mL.
7. The strepitavidin-labeled antibody was coupled to a 100nM Biotin-modified Pre-amplifier sequence (Pre-amp) (5 '-Biotin-ATC GTT AGG CAT TCAGGG A-3'/5'-Biotin-ATC GTT AGG CAT T-3') in a ratio of 1:1, 1:3-4, 1:6-8 at a coupling temperature of 25-37 ℃. .5'Biotin-ATC GTT AGG CAT T-3' sequence, most preferably 1:3-4.
The synthetic sequences are shown in table 2 below:
TABLE 2
Synthesis of sequence 1 5’-Biotin-ATC GTT AGG CAT TCA GGG A-3’
Synthesis of sequence 2 5’-Biotin-ATC GTT AGG CAT T-3’
The data results are shown in tables 3 and 4 below:
TABLE 3 Table 3
Synthetic sequence 2 is preferred.
TABLE 4 Table 4
Antibody: the preferred ratio of nucleic acids is 1:3 to 4.
EXAMPLE 3 preparation of an amplifier
Some embodiments have a leader sequence of TCCCTGAATGCCTAACGAT and a repeat sequence of AGGTCTTTACCACCAATATTCTTTT; the leader sequence of some embodiments is AATGCCTAACGAT and the repeat sequence is TCTTTACCACCAA. The preparation method is based on the CN105886501 nucleic acid signal amplifying sequence and amplifying method. Hybridization temperature is 37-55deg.C, hybridization time is 10-40min.
Example 4 preparation of Probe marker (LP)
The probe tag of some embodiments is AAAAGAATATTGGTGGTAAAGACCT-AP; the probe tag of some embodiments is TTGGTGGTAAAGA-AP. The preparation method is based on the CN105886501 nucleic acid signal amplifying sequence and amplifying method. Hybridization temperature is 37-55deg.C, hybridization time is 10-40min.
Example 5 magnification comparison
The sequence combinations are as follows in table 5:
TABLE 5
The data results are shown in Table 6 below:
TABLE 6
Note that: sequence combination 1 is the unamplified result of the BSA system; sequence combination 2 is the result of joint amplification of the BSA system by 42 times; sequence combination three is a 400-fold result of the BSA system joint amplification.
Example 5 specificity test
And selecting ten substances of influenza A virus H1N1 (2009), influenza B Yamagata, influenza B Victoria, parainfluenza virus type 2, coronavirus OC43, coronavirus 229E, parainfluenza virus type 2, streptococcus pneumoniae, mycoplasma pneumoniae and enterovirus A for specificity test. The data results are shown in Table 7 below:
TABLE 7
Example 6 Positive detection Rate test
The positive detection rate test is carried out by selecting N antigen with the concentration of 48ug/mL, 4.8ug/mL, 480ng/mL, 48ng/mL, 4.8ng/mL, 480pg/mL, 48pg/mL, 4.8pg/mL, 480fg/mL and 48fg/mL as samples. The data results are shown in Table 8 below:
TABLE 8
Note that: the photon number/BL is more than or equal to 2, the photon number/BL is less than 1.3, the photon number/BL is less than 2, and the photon number/BL is less than 1.3, and the photon number/BL is positive.
Thus, according to the detection method of the present invention, antigens with a concentration of 480fg/mL or more can be detected at 100%. The literature, sandwich ELISA method for detecting novel coronavirus and establishment and verification of antigen method, uses common ELISA method for detecting novel coronavirus surface spike glycoprotein receptor binding domain, and the quantitative detection lower limit of the kit is 31ng/mL; the literature ' preparation of SARS-CoV-2S protein monoclonal antibody ' and establishment of double antibody sandwich ELISA detection method ' establishes double antibody sandwich ELISA method to detect SARS-CoV-2S protein antigen content, and its detection sensitivity is 1.25U; the literature 'preparation of novel coronavirus N protein monoclonal antibody and establishment of double-antibody sandwich ELISA antigen detection method' establishes a novel coronavirus N protein double-antibody sandwich ELISA method, and the detection sensitivity is 3.9ng/mL; literature "Rapid detection method for establishing SARS-CoV-2 by specific recognition of N protein antibody" A method for rapidly detecting SARS-CoV-2 by double antibody sandwich enzyme-linked immunosorbent assay (ELISA) is established by specific recognition of N protein antibody, and the minimum detection sensitivity is 12.35ng/mL. It can be seen that the detection limit of the invention is thousands/tens of thousands times higher than that of the current relevant literature. In addition, according to the specificity and positive detection rate test, the invention has better specificity and obviously improves the positive detection rate.
The foregoing is merely a preferred embodiment of the invention, and it is to be understood that the invention is not limited to the form disclosed herein but is not to be construed as excluding other embodiments, but is capable of numerous other combinations, modifications and environments and is capable of modifications within the scope of the inventive concept, either as taught or as a matter of routine skill or knowledge in the relevant art. And that modifications and variations which do not depart from the spirit and scope of the invention are intended to be within the scope of the appended claims.

Claims (10)

1. A method for detecting a non-diagnostic antigen of interest, comprising the steps of:
s1, antibody coating: coating the antibody in a solid phase or a liquid phase; the antibody is specifically combined with target molecules in a sample to be detected; the antigen is a novel coronavirus N antigen;
s2, capturing target molecules: coating and then adding a sample to be tested;
s3, binding a labeled antibody with a target: adding a labeled antibody, wherein the labeled antibody is specifically combined with a target molecule in a sample to be detected, and the labeled antibody is coupled with a nucleic acid target sequence; the preparation method of the labeled antibody comprises the following steps: coupling the streptavidin marked antibody with a 100nM Biotin modified pre-amplifier sequence according to the ratio of 1:3-4, wherein the pre-amplifier sequence is 5'-Biotin-ATC GTT AGG CAT T-3';
s4, binding the sandwich complex with an amplifying molecule: adding an amplifier consisting of a leader sequence and a 5-to 20-fold repeat sequence, the leader sequence being complementary to the nucleic acid target sequence, the leader sequence being different from the repeat sequence;
s5, generating a chemiluminescent signal: adding a report probe and then adding a chemiluminescent substrate to read a result; the reporter probe is complementary to the repeat sequence of the amplifier.
2. The method according to claim 1, wherein in step S1, the solid phase coating is performed by coating the sample to be tested with a microplate, and the liquid phase coating is performed by coating the sample to be tested with magnetic beads.
3. The method of claim 1, wherein in step S3, the method of coupling the labeled antibody to the nucleic acid target sequence comprises: religation by modification with a chemical coupling agent.
4. The method according to claim 1, wherein in step S3, the labeled antibody is labeled with streptavidin.
5. The method according to claim 1, wherein in step S4, the Tm value of the leader sequence is 55 ℃ to 62 ℃; the Tm value of the repeated sequence is less than 55 ℃; the 5' end of the leader sequence also comprises a fragment which is subjected to enzyme digestion by a restriction enzyme I enzyme digestion site protected by phosphorothioate adenosine, and the restriction enzyme I enzyme digestion site is an adhesive end after enzyme digestion; the 3' end of the nucleic acid signal amplification sequence also comprises a fragment which is subjected to enzyme digestion by an enzyme digestion site of restriction enzyme II; the restriction enzyme II enzyme cutting site is cut into a flat tail end.
6. The method for detecting an antigen of non-diagnostic interest according to claim 5, wherein in step S4, the method for preparing the amplifying molecule comprises the steps of:
A. designing a nucleic acid signal leader sequence and a plurality of times of repeated sequences, respectively adding restriction enzyme I cleavage sites at the 5 'end of the leader sequence, and adding restriction enzyme II cleavage sites at the 3' end of the plurality of times of repeated sequences; the restriction enzyme I cleavage site is connected with the leader sequence of the nucleic acid signal amplification sequence, and is a sticky end after cleavage; the restriction enzyme II enzyme cutting site is connected with the repeated sequence of the nucleic acid signal amplifying sequence, and the end of the restriction enzyme II enzyme cutting site is flat;
B. the synthesized sequence is inserted into a vector and then cloned and copied;
C. single cleavage of the vector sequence with restriction enzyme I to generate a 5 'cohesive end, and filling of the 5' cohesive end with Kelnow large fragment polymerase and thioadenosine triphosphate; cutting the target strip from the carrier by using restriction enzyme II;
D. and (3) carrying out exonuclease III digestion to obtain a nucleic acid signal amplification sequence.
7. The method according to claim 6, wherein the restriction enzyme I is one of EcoRI, bamHI, hindII and HindIII; the restriction enzyme II is one of EcoR V, alu I, bsu R I, bal I, hal III, HPa I and Sma I.
8. The method of claim 6, wherein the vector is pGEM-3ZF (+) vector.
9. The method according to any one of claims 1 to 8, wherein in step S5, alkaline phosphatase is attached to the reporter probe, and the chemiluminescent substrate reacts with alkaline phosphatase to generate a chemiluminescent signal.
10. The method for detecting a non-diagnostic target antigen according to claim 9, wherein in step S5, the method for reading the result is as follows: and judging the concentration level of the target molecule according to the intensity of the chemiluminescent signal.
CN202310127635.7A 2023-02-17 2023-02-17 Antigen hypersensitive detection method Active CN116256519B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310127635.7A CN116256519B (en) 2023-02-17 2023-02-17 Antigen hypersensitive detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310127635.7A CN116256519B (en) 2023-02-17 2023-02-17 Antigen hypersensitive detection method

Publications (2)

Publication Number Publication Date
CN116256519A CN116256519A (en) 2023-06-13
CN116256519B true CN116256519B (en) 2024-01-16

Family

ID=86685866

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310127635.7A Active CN116256519B (en) 2023-02-17 2023-02-17 Antigen hypersensitive detection method

Country Status (1)

Country Link
CN (1) CN116256519B (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101250585A (en) * 2008-03-28 2008-08-27 广州市搏克生物技术有限公司 Method for detecting DNA, RNA and ultramicro-amount protein
CN102272600A (en) * 2008-12-31 2011-12-07 雅培医护站股份有限公司 Method and device for immunoassay using nucleotide conjugates
CN105510591A (en) * 2014-09-22 2016-04-20 程永升 Detection kit and detection method using antibody to modify immuno-PCR reaction
CN105886501A (en) * 2016-04-26 2016-08-24 科蒂亚(新乡)生物技术有限公司 Nucleic acid signal amplification sequence and method
CN106932590A (en) * 2015-12-31 2017-07-07 复旦大学 A kind of quantitative determination low-abundance protein and the thereafter method of modified protein
CN110564816A (en) * 2019-09-23 2019-12-13 天津一安生物技术有限公司 Kit for detecting listeria monocytogenes based on immune double-labeled colloidal gold probe and hybrid chain amplification, application and detection method
CN113791207A (en) * 2021-08-06 2021-12-14 南方科技大学 High-sensitivity immunoassay method and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040197793A1 (en) * 2002-08-30 2004-10-07 Arjang Hassibi Methods and apparatus for biomolecule detection, identification, quantification and/or sequencing

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101250585A (en) * 2008-03-28 2008-08-27 广州市搏克生物技术有限公司 Method for detecting DNA, RNA and ultramicro-amount protein
CN102272600A (en) * 2008-12-31 2011-12-07 雅培医护站股份有限公司 Method and device for immunoassay using nucleotide conjugates
CN105510591A (en) * 2014-09-22 2016-04-20 程永升 Detection kit and detection method using antibody to modify immuno-PCR reaction
CN106932590A (en) * 2015-12-31 2017-07-07 复旦大学 A kind of quantitative determination low-abundance protein and the thereafter method of modified protein
CN105886501A (en) * 2016-04-26 2016-08-24 科蒂亚(新乡)生物技术有限公司 Nucleic acid signal amplification sequence and method
CN110564816A (en) * 2019-09-23 2019-12-13 天津一安生物技术有限公司 Kit for detecting listeria monocytogenes based on immune double-labeled colloidal gold probe and hybrid chain amplification, application and detection method
CN113791207A (en) * 2021-08-06 2021-12-14 南方科技大学 High-sensitivity immunoassay method and application thereof

Also Published As

Publication number Publication date
CN116256519A (en) 2023-06-13

Similar Documents

Publication Publication Date Title
US20230407380A1 (en) Assay methods
CA1234061A (en) Labeled dna
CN110308272B (en) Improved assay method
CN100420947C (en) Method for quantitative determination of specific analyte with single trapping agent and reagent kit therefor
US20170168044A1 (en) Quantitative analysis method based on air pressure measuring
US20040033531A1 (en) Assay methods and systems
US20030054413A1 (en) Bio-sensing platforms for detection and quantitation of biological molecules
WO2017181339A1 (en) Method and kit for simultaneous detection of protein ligand and gene
US20040018495A1 (en) Microparticle based signal amplification for the detection of analytes
Gao et al. Rolling circle amplification integrated with suspension bead array for ultrasensitive multiplex immunodetection of tumor markers
CN111575406A (en) Novel coronavirus rapid screening method and kit based on nucleic acid isothermal amplification
Xiao et al. Dual-mode detection of avian influenza virions (H9N2) by ICP-MS and fluorescence after quantum dot labeling with immuno-rolling circle amplification
CN116256519B (en) Antigen hypersensitive detection method
US20160258938A1 (en) Method of detecting an analyte in a sample
CN116987770A (en) Method and system for ultrasensitive detection of target analyte in sample
KR19990028561A (en) Non-Isolated Specific Binding Chemiluminescence Assay
CN115436335B (en) Method for detecting thrombin based on perylene derivative probe without marking
US20230213517A1 (en) Method for detecting virus particles and kits therefor
Assicot et al. A simple and rapid fluorimetric determination of catechol-O-methyl transferase (COMT) activity
CN110878296B (en) High-sensitivity HRP enzyme and preparation method and application thereof
CN100495035C (en) Antigen and ligand PCR pipe detecting reagent kit, its manufacturing method and application
CN107109463B (en) Determination of the Activity of the bond Forming enzymes
CN1285737C (en) Process for testing SARS virus genome segment by silicon shell nano particle
CN113933364B (en) Target concentration detection method based on silicon nanowire field effect biochemical sensor
KR20160067540A (en) Simultaneous Detection Methods of Multiple Targets in a Sample and Uses Thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant