CN116251189A - Application of TTK protein kinase in prevention and treatment of mesenchymal stem cell osteogenesis weakening and age-related osteoporosis - Google Patents

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of TTK protein kinase in preventing and treating mesenchymal stem cell osteogenesis weakening and age-related osteoporosis. The invention discloses application of TTK protein kinase in preventing and treating mesenchymal stem cell osteogenesis weakening and age-related osteoporosis in order to mine osteoporosis treatment drugs with stronger targeting and safer and more effective. According to the invention, through research, the overexpression of the TTK can promote the osteoblast differentiation of mesenchymal stem cells, after the expression of the TTk of the senile osteoporosis animal is increased, the bone quantity is increased, and the bone defect recovery condition is better, so that the TTK overexpression has a better treatment effect on age-related osteoporosis, is hopeful to become a new target point for preventing and treating the osteoblast weakening of the mesenchymal stem cells or preventing and treating the age-related osteoporosis, provides a new approach and a new direction for preventing and treating the osteoblast weakening of the mesenchymal stem cells or the age-related osteoporosis, and has important potential application value.

Description

Application of TTK protein kinase in prevention and treatment of mesenchymal stem cell osteogenesis weakening and age-related osteoporosis

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of TTK protein kinase in preventing and treating mesenchymal stem cell osteogenesis weakening and age-related osteoporosis.

Background

Osteoporosis is a common degenerative disease characterized by reduced bone mass and increased bone fragility. As the disease progresses, the probability of a patient developing a brittle fracture increases significantly, severely affecting the patient's survival prognosis and quality of life. Mesenchymal stem cells (Mesenchymal stem cells, MSCs) are an important member of the stem cell family, a group of cells derived from mesoderm and having the ability to self-renew and multi-directionally differentiate, widely distributed in bone marrow. MSCs have multidirectional differentiation potential and immunoregulation capability, and have the capability of differentiating into osteoblasts, adipocytes and chondroblasts. The homeostasis of bone metabolism in humans is maintained by both bone formation and bone resorption, MSCs being the primary source of osteoblasts, mediating bone formation processes, which are mediated primarily by osteoclasts. Bone formation and bone resorption during physiological processes remain balanced and maintain bone mass at a certain level, but with age, bone formation is reduced and osteoporosis follows.

At present, the medicines for treating osteoporosis are mainly divided into anti-bone absorption medicines and bone formation promoting medicines, wherein the anti-bone absorption medicines mainly comprise bisphosphonates, estrogen and selective estrogen receptor modulators, nuclear factor-kappa B receptor activating factor ligand (RANKL) inhibitors and calcitonin, and the bone formation promoting medicines mainly comprise parathyroid hormone and parathyroid hormone related peptide. Although the diagnosis and treatment of osteoporosis have been well advanced in recent years, the exact cause of the occurrence of the osteoporosis cannot be confirmed at present, and a radical cure method cannot be found. With the progress of the disease, the probability of occurrence of brittle fracture of an osteoporosis patient is greatly improved, and the patient is more likely to fall down, so that the brittle fracture is disabled and even die. Moreover, all of the osteoporosis drugs currently available in bulk have associated complications that render them less acceptable to patients. At the same time, there are few drugs that promote bone formation and there are many restrictions on use. Therefore, there is a need to dig osteoporosis treatment drugs with stronger targeting and safer and more effective.

TTK (Threonine and tyrosine kinase, TTK; NCBI accession number NP-003309.2) is a protein kinase that phosphorylates tyrosine, serine, and threonine, is a spindle-detection-point complex, and has a major biological function of participating in the replication of centrosomes and spindle detection points. During mitosis, this protein is necessary for centrally overlapping the chromosomal arrangement on the centromere. It was found to be a mitotic checkpoint protein for the precise isolation of mitotic chromosomes. When such proteins fail to degrade and produce excessive centrosomes, abnormal mitotic spindles are produced, thereby triggering cancer production. Studies show that TTK is expected to become a new cancer treatment target. However, TTK has not been reported to be useful for the prevention and treatment of mesenchymal stem cell osteogenesis-attenuation and age-related osteoporosis.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention provides application of TTK protein kinase in preventing and treating mesenchymal stem cell osteogenesis weakening and age-related osteoporosis, and a novel drug targeting MSCs is developed by taking TTK as a target point, so that osteogenesis differentiation of the MSCs is promoted, and age-related osteoporosis is prevented and treated.

In order to achieve the above purpose, the present invention is realized by the following technical scheme:

the first aspect of the invention provides an application of an agent for promoting expression of TTK protein kinase in preparing a medicament for preventing and treating mesenchymal stem cell osteogenesis weakening.

In a second aspect, the invention provides the use of an agent that promotes expression of TTK protein kinase in the manufacture of a medicament for the prevention and treatment of age-related osteoporosis.

According to the invention, the research shows that the reduction of TTK can cause the reduction of the osteoblast capacity of the mesenchymal stem cells, and the reduction of the osteoblast capacity of the mesenchymal stem cells is proved to be closely related to the occurrence and development of age-related osteoporosis, and further research shows that the overexpression of TTK has better treatment effect on the age-related osteoporosis and is expected to become a new target for preventing and treating the osteoblast weakening of the mesenchymal stem cells or preventing and treating the age-related osteoporosis.

Preferably, the agent that promotes expression of TTK protein kinase includes a lentivirus that overexpresses TTK protein kinase, an adeno-associated virus that overexpresses TTK protein kinase, a recombinant expression vector that overexpresses TTK protein kinase, a recombinant bacterium that overexpresses TTK protein kinase.

More preferably, the agent that promotes expression of TTK protein kinase includes lentivirus pSLenti-EF1-EGFP 2A-Puro-CMV-TTK-Myc-WPRE and adeno-associated virus rAAV 9-Ttk-mNaNON Green.

The invention provides a strategy for treating age-related osteoporosis by using TTK over-expressed adeno-associated virus. Compared with the existing clinic therapies, the invention starts from the etiology of age-related osteoporosis, achieves the aim of treating age-related osteoporosis by promoting TTK protein kinase expression and enhancing bone formation, and has stronger targeting to MSCs and safer and more effective compared with the existing lentivirus/adenovirus therapies.

In a third aspect, the present invention provides a medicament for promoting osteoblastic differentiation of mesenchymal stem cells or a medicament for preventing and treating age-related osteoporosis, the medicament having an agent promoting expression of TTK protein kinase as a main active ingredient.

Preferably, the application form of the medicine is enriched, so that the medicine is applicable to different ranges, and the medicine also comprises a pharmaceutically acceptable carrier.

More preferably, the carrier is a functional pharmaceutical adjuvant acceptable in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some novel pharmaceutical polymeric materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid, and the like. Excipients such as diluents, binders, lubricants, disintegrants, co-solvents, stabilizers and the like may also be included.

Preferably, in order to improve the application range of the medicament, the dosage forms of the medicament comprise injection, oral liquid, tablets, medicinal granules, capsules and pills. Pharmaceutical formulations may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically), and if some drugs are unstable under gastric conditions, they may be formulated as enteric coated tablets.

Compared with the prior art, the invention has the beneficial effects that:

the invention discloses a new application of TTK protein kinase, namely application in preventing and treating mesenchymal stem cell osteogenesis weakening and age-related osteoporosis. According to the invention, the over-expression of the TTK can promote the osteoblast differentiation of mesenchymal stem cells, after the expression of the TTk of the senile osteoporosis animal is increased, the bone quantity is increased, and the bone defect recovery condition is better, so that the over-expression of the TTK has a better treatment effect on age-related osteoporosis, and is expected to become a new target for preventing and treating the osteoblast weakening of the mesenchymal stem cells or preventing and treating the age-related osteoporosis. The invention provides a new approach and a new direction for preventing and treating the mesenchymal stem cell osteoblast weakening or the age-related osteoporosis, and has important potential application value.

Drawings

FIG. 1 shows the results of transcriptome sequencing of TTK expression levels in MSCs at passage 4 and 12;

FIG. 2 is a flow chart of an experiment in which TTK affects the progression of mesenchymal stem cell aging;

FIG. 3 shows Western blot test results of MSCs osteogenic marker RUNX2 and OSX mRNA after knockdown or overexpression of TTK;

FIG. 4 shows the results of RT-qPCR testing of MSCs osteogenic marker RUNX2, OSX mRNA after knockdown or overexpression of TTK;

FIG. 5 shows ARS and ALP staining results of MSCs after TTK knockdown or overexpression;

FIG. 6 shows the results of tissue HE, masson staining, COL1 histochemical staining of MSCs after knockdown or overexpression of TTK;

FIG. 7 is a flow chart of an experiment for alleviating senile osteoporosis by using TTK over-expressed adeno-associated virus;

FIG. 8 shows immunofluorescence results of geriatric osteoporosis mice injected with TTK-overexpressing adeno-associated virus;

FIG. 9 is a graph showing the results of repair of Micro-CT bone defects in geriatric osteoporosis mice after injection of TTK-overexpressing adeno-associated virus;

FIG. 10 shows the results of a Micro-CT bone trabecular analysis of senile osteoporosis mice injected with TTK-overexpressing adeno-associated virus.

Detailed Description

The following describes the invention in more detail. The description of these embodiments is provided to assist understanding of the present invention, but is not intended to limit the present invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.

The experimental methods in the following examples, unless otherwise specified, are conventional, and the experimental materials used in the following examples, unless otherwise specified, are commercially available.

Example 1 effect of TTK on progression of mesenchymal Stem cell aging

The present invention relates to a method for isolating mesenchymal stem cells MSCs from bone marrow of healthy volunteers in early stage for passage 4 times and passage 12 times (aging) (extracting bone marrow from the posterior upper iliac crest of healthy volunteers under aseptic condition, then isolating and purifying mesenchymal stem cells from bone marrow by density gradient centrifugation, isolating and purifying mesenchymal stem cells from bone marrow by density gradient centrifugation at 600g for 30 minutes, re-suspending isolated MSCs in bovine serum (FBS, sichuan of Hangzhou) from 90% MEM (Gibco) and 10% fetal bovine serum (FBS, sichuan of Hangzhou Holly) and inoculating in culture flask at 37 ℃ C., 5% CO ₂ The culture was performed in an incubator under ambient conditions, and the medium was replaced every three days. When the cells reached 80-90% confluence, MSCs were digested with 0.25% trypsin containing 0.53mM EDTA and re-inoculated in new flasks for passaging) and passaged 4Transcriptome sequencing analysis (Huada gene) of MSCs was performed twice and 12 times, and as a result, it was found that TTK expression was significantly reduced in MSCs at 12 times (senescent) compared to MSCs at 4 times (FIG. 1). For this purpose, TTK was designed to knock down siRNA and overexpress lentivirus, and the effect of TTK on the progression of mesenchymal stem cell senescence was verified, as shown in fig. 2, and the specific test method included the following steps:

(1) Knockdown shRNA (TTK shRNA, sh-TTK for short, sequence CCAGTTGTAAAGAATGACTTT) is synthesized by Guangzhou Ai Ji biotechnology limited company, and Sh-NC (sequence TTCTCCGAACGTGT CACGTTTC) is used as a control; constructing TTK over-expression lentivirus (abbreviated as OE-TTK) by Shanghai and Meta biological limited company, wherein an application vector is pSLenti-EF1-EGFP-P2A-Puro-CMV-TTK-Myc-WPRE, and an empty vector OE-NC is used as a control; the nucleotide sequence of TTK protein kinase is:

ATGGAATCCGAGGATTTAAGTGGCAGAGAATTGACAATTGATTCCATAATGAACAAAGTGAGAGACATTAAAAATAAGTTTAAAAATGAAGACCTTACTGATGAACTAAGCTTGAATAAAATTTCTGCTGATACTACAGATAACTCGGGAACTGTTAACCAAATTATGATGATGGCAAACAACCCAGAGGACTGGTTGAGTTTGTTGCTCAAACTAGAGAAAAACAGTGTTCCGCTAAGTGATGCTCTTTTAAATAAATTGATTGGTCGTTACAGTCAAGCAATTGAAGCGCTTCCCCCAGATAAATATGGCCAAAATGAGAGTTTTGCTAGAATTCAAGTGAGATTTGCTGAATTAAAAGCTATTCAAGAGCCAGATGATGCACGTGACTACTTTCAAATGGCCAGAGCAAACTGCAAGAAATTTGCTTTTGTTCATATATCTTTTGCACAATTTGAACTGTCACAAGGTAATGTCAAAAAAAGTAAACAACTTCTTCAAAAAGCTGTAGAACGTGGAGCAGTACCACTAGAAATGCTGGAAATTGCCCTGCGGAATTTAAACCTCCAAAAAAAGCAGCTGCTTTCAGAGGAGGAAAAGAAGAATTTATCAGCATCTACGGTATTAACTGCCCAAGAATCATTTTCCGGTTCACTTGGGCATTTACAGAATAGGAACAACAGTTGTGATTCCAGAGGACAGACTACTAAAGCCAGGTTTTTATATGGAGAGAACATGCCACCACAAGATGCAGAAATAGGTTACCGGAATTCATTGAGACAAACTAACAAAACTAAACAGTCATGCCCATTTGGAAGAGTCCCAGTTAACCTTCTAAATAGCCCAGATTGTGATGTGAAGACAGATGATTCAGTTGTACCTTGTTTTATGAAAAGACAAACCTCTAGATCAGAATGCCGAGATTTGGTTGTGCCTGGATCTAAACCAAGTGGAAATGATTCCTGTGAATTAAGAAATTTAAAGTCTGTTCAAAATAGTCATTTCAAGGAACCTCTGGTGTCAGATGAAAAGAGTTCTGAACTTATTATTACTGATTCAATAACCCTGAAGAATAAAACGGAATCAAGTCTTCTAGCTAAATTAGAAGAAACTAAAGAGTATCAAGAACCAGAGGTTCCAGAGAGTAACCAGAAACAGTGGCAATCTAAGAGAAAGTCAGAGTGTATTAACCAGAATCCTGCTGCATCTTCAAATCACTGGCAGATTCCGGAGTTAGCCCGAAAAGTTAATACAGAGCAGAAACATACCACTTTTGAGCAACCTGTCTTTTCAGTTTCAAAACAGTCACCACCAATATCAACATCTAAATGGTTTGACCCAAAATCTATTTGTAAGACACCAAGCAGCAATACCTTGGATGATTACATGAGCTGTTTTAGAACTCCAGTTGTAAAGAATGACTTTCCACCTGCTTGTCAGTTGTCAACACCTTATGGCCAACCTGCCTGTTTCCAGCAGCAACAGCATCAAATACTTGCCACTCCACTTCAAAATTTACAGGTTTTAGCATCTTCTTCAGCAAATGAATGCATTTCGGTTAAAGGAAGAATTTATTCCATATTAAAGCAGATAGGAAGTGGAGGTTCAAGCAAGGTATTTCAGGTGTTAAATGAAAAGAAACAGATATATGCTATAAAATATGTGAACTTAGAAGAAGCAGATAACCAAACTCTTGATAGTTACCGGAACGAAATAGCTTATTTGAATAAACTACAACAACACAGTGATAAGATCATCCGACTTTATGATTATGAAATCACGGACCAGTACATCTACATGGTAATGGAGTGTGGAAATATTGATCTTAATAGTTGGCTTAAAAAGAAAAAATCCATTGATCCATGGGAACGCAAGAGTTACTGGAAAAATATGTTAGAGGCAGTTCACACAATCCATCAACATGGCATTGTTCACAGTGATCTTAAACCAGCTAACTTTCTGATAGTTGATGGAATGCTAAAGCTAATTGATTTTGGGATTGCAAACCAAATGCAACCAGATACAACAAGTGTTGTTAAAGATTCTCAGGTTGGCACAGTTAATTATATGCCACCAGAAGCAATCAAAGATATGTCTTCCTCCAGAGAGAATGGGAAATCTAAGTCAAAGATAAGCCCCAAAAGTGATGTTTGGTCCTTAGGATGTATTTTGTACTATATGACTTACGGGAAAACACCATTTCAGCAGATAATTAATCAGATTTCTAAATTACATGCCATAATTGATCCTAATCATGAAATTGAATTTCCCGATATTCCAGAGAAAGATCTTCAAGATGTGTTAAAGTGTTGTTTAAAAAGGGACCCAAAACAGAGGATATCCATTCCTGAGCTCCTGGCTCATCCATATGTTCAAATTCAAACTCATCCAGTTAACCAAATGGCCAAGGGAACCACTGAAGAAATGAAATATGTTCTGGGCCAACTTGTTGGTCTGAATTCTCCTAACTCCATTTTGAAAGCTGCTAAAACTTTATATGAACACTATAGTGGTGGTGAAAGTCATAATTCTTCATCCTCCAAGACTTTTGAAAAAAAAAGGGGAAAAA。

the amino acid sequence of TTK protein kinase is:

MESEDLSGRELTIDSIMNKVRDIKNKFKNEDLTDELSLNKISADTTDNSGTVNQIMMMANNPEDWLSLLLKLEKNSVPLSDALLNKLIGRYSQAIEALPPDKYGQNESFARIQVRFAELKAIQEPDDARDYFQMARANCKKFAFVHISFAQFELSQGNVKKSKQLLQKAVERGAVPLEMLEIALRNLNLQKKQLLSEEEKKNLSASTVLTAQESFSGSLGHLQNRNNSCDSRGQTTKARFLYGENMPPQDAEIGYRNSLRQTNKTKQSCPFGRVPVNLLNSPDCDVKTDDSVVPCFMKRQTSRSECRDLVVPGSKPSGNDSCELRNLKSVQNSHFKEPLVSDEKSSELIITDSITLKNKTESSLLAKLEETKEYQEPEVPESNQKQWQSKRKSECINQNPAASSNHWQIPELARKVNTEQKHTTFEQPVFSVSKQSPPISTSKWFDPKSICKTPSSNTLDDYMSCFRTPVVKNDFPPACQLSTPYGQPACFQQQQHQILATPLQNLQVLASSSANECISVKGRIYSILKQIGSGGSSKVFQVLNEKKQIYAIKYVNLEEADNQTLDSYRNEIAYLNKLQQHSDKIIRLYDYEITDQYIYMVMECGNIDLNSWLKKKKSIDPWERKSYWKNMLEAVHTIHQHGIVHSDLKPANFLIVDGMLKLIDFGIANQMQPDTTSVVKDSQVGTVNYMPPEAIKDMSSSRENGKSKSKISPKSDVWSLGCILYYMTYGKTPFQQIINQISKLHAIIDPNHEIEFPDIPEKDLQDVLKCCLKRDPKQRISIPELLAHPYVQIQTHPVNQMAKGTTEEMKYVLGQLVGLNSPNSILKAAKTLYEHYSGGESHNSSSSKTFEKKRGKK。

(2) Mesenchymal stem cells (4 th generation) were transfected with TTK shRNA and overexpressing lentiviruses, respectively, for 48 hours: will be 0.7X10 ⁵ Plates of MSCs were plated in 12-well plates using osteogenic induction medium [ composition: DMEM (1000 mg/L glucose, sigma-Aldrich), 10% FBS (Sichuan green), 100IU/mL penicillin, 100IU/mL streptomycin (Jingxin), 0.1. Mu.M dexamethasone (Sigma-Aldrich), 10mM beta-glycerophosphate (Sigma-Aldrich) and 50. Mu.M ascorbic acid (Sigma-Aldrich) were osteoinductive for 10 days.

(3) Western blot is used for detecting the expression of MSCs bone formation marker molecule proteins RUNX2 and OSX: cells were collected and lysed on ice in RIPA buffer (well as century) containing protease and phosphatase inhibitors for 30 min, then lysates were obtained by centrifugation at 14,000rpm for 10 min at 4 ℃, equivalent lysates were diluted in 5x SDS loading buffer (bi-cloud days) and subjected to SDS-polyacrylamide gel electrophoresis (PAGE), followed by transfer to PVDF membrane (Millipore), membrane was blocked in TBST (150mM NaCl,50mM Tris-HCl, pH 7.5 and 0.05% tween-20) containing 5% skim dry milk for 1 h at room temperature, then incubated with primary antibody [ anti-RUNX2 (Cell Signaling Technology, 12556S), anti-OSX (Abcam, ab 209484) ] overnight at 4 ℃, secondary antibody [ horseradish peroxidase (HRP) -conjugated anti-use (Cell Signaling Technology, cat.7076) or HRP-conjugated anti-use 5670) bound reagent (Millipore) for light emission detection at 78.70 h.

(4) The RT-qPCR instrument is used for detecting the expression of MSCs bone formation marker molecules RUNX2 and OSX mRNA, and the specific method is as follows: total RNA from MSCs was extracted using RNAiso Plus (TaKaRa), reverse transcribed into cDNA using PrimeScript RT kit (TaKaRa), and then used SYBR Premix Ex Taq ^TM (TaKaRa) qRT-PCR was performed on the LightCycler R480 PCR system (Roche), primer sequences were: RUNX2, forward Primer: TGGTTACTGTCATGGCGGGTA Reverse Primer: TCTCAGATCGTTGAACCTTGCTA; OSX, forward Primer: CCTCTGCGGGACTCAACAAC Reverse Primer: AGCCCATTAGTGCTTGTAAAGG. Finally, the result is analyzed by a 2-delta Ct method, and the amplification data of the target gene is normalized by a reference gene GAPDH, and each qRT-PCR analysis is performed in triplicate.

(5) MSCs osteogenic levels were detected using ARS, ALP staining kit (bi-cloudy day).

(6) Will be 5x10 ⁵ The MSCs were cultured in 25cm2 flasks, osteoinductive medium was used for 7 days, and then cultured in HA/TCP scaffolds (Zimmer), after 24 hours, the scaffolds were implanted under 8 weeks BALB/c nu/nu nude mice, and after 8 weeks specimens were harvested.

(7) In vivo osteogenic levels of MSCs were detected using HE, masson staining kit, COL1 immunohistochemical staining (bi-cloudy days).

(8) Test results:

the Western blot results in fig. 3 suggest that TTK knockdown or overexpression during osteogenesis induction significantly down-regulates or promotes expression of RUNX2, OSX proteins, an osteogenesis marker of MSCs.

The results of RT-qPCR in fig. 4 suggest that knockdown or overexpression of TTK during osteoinduction significantly down-regulates or promotes expression of the MSCs osteogenic markers RUNX2, OSX mRNA.

The ARS and ALP results of fig. 5 suggest that knockdown or overexpression of TTK during osteoinduction significantly down regulates or promotes calcium deposition and alkaline phosphatase expression during osteogenesis.

Fig. 6 is an in vivo osteogenic experiment in mice transplanted with MSCs scaffolds, and the results suggest that knockdown or overexpression of TTK significantly down-regulates or promotes bone formation levels in MSCs.

The results show that mRNA level and protein level of mesenchymal stem cell osteoblast marker molecules are down-regulated after TTK is knocked down, ARS and ALP staining is weakened, and in-vivo osteoblast level is weakened; in contrast to this, TTK was demonstrated to promote osteoblastic differentiation of mesenchymal stem cells after overexpression.

EXAMPLE 2 alleviation of senile osteoporosis by TTK

Example 1 demonstrates that TTK (or Ttk) reduction can lead to a decrease in osteoblastic capacity of mesenchymal stem cells, which has been shown to be closely related to the occurrence and development of age-related osteoporosis (demontipro, o., vidal, c., and Duque, g. (2012) Aging and bone loss: new insights for the clinian, thor.adv. Musculoskelet. Dis.4,61-76.10.1177/1759720X11430858.; yang, t.l., shen, h., liu, a., dong, s.s., zhang, l., deng, f.y., zhao, q., and Deng, h.w. (2020) A road map for understanding molecular and genetic determinants of osteoporosis, nat. Rev. Endocrinol.16,91-103.10.1038/s41574-019-0282-7. Therefore, the aim of enhancing the bone formation capacity of MSCs is achieved by performing tail vein injection of TTK over-expression adeno-associated virus on the senile osteoporosis mice, so that the progress of senile osteoporosis is relieved. As shown in fig. 7, specific test method steps include the following steps:

(1) Senile osteoporosis mice and bone defect model construction: male C57 mice of 18 months of age are selected, the bones and the thighbones of the mice are drilled with holes with diameters of 2.5mm and 1.0mm respectively by using bone drills, and then wounds are sutured.

(2) Grouping tail vein injection siRNA: the senile osteoporosis mice and bone defect models are divided into two groups after construction, wherein the two groups comprise a rAAV 9-Control-mNaeon Green group and a rAAV 9-Ttk-mNaeon Green group (rAAV 9-Control-mNaeon Green and rAAV 9-Ttk-mNaeon Green commission and metabiological company construction). At week 0 of molding, 200uL rAAV9 (4×10) was injected 1 day after molding ¹¹ GC；2×10 ¹³ GC/kg), once, and the mouse skull and femur specimens were collected at week 8.

(3) Number of mouse bone trabeculae and bone repair detection: mice were sacrificed at week 8, the bones and femur were harvested, and the number of femur trabeculae and the repair of defects of the bones and femur were examined by Micro-CT by immunofluorescence detection of Ttk overexpression, wherein BV/TV: relative bone volume; tb.n: number of bone trabeculae; tb.sp: degree of trabecular separation; tb.Th: bone trabecular thickness; ct. th: cortical bone thickness.

The immunofluorescence detection method specifically comprises the following steps: bone tissue sections were deparaffinized and rehydrated, immersed in 10mM citrate buffer (pH 6.0), and microwaved for 15 minutes for antigen retrieval. Bone sections were immersed with 0.5% triton X-100 for 20 min, blocked with 10% fetal bovine serum in PBS for 1 hr, then anti-TTK antibody (Abcam, cat No. ab 11108), anti-OCN antibody (Novus, cat No. mab 1419) were incubated with the samples overnight at 4 degrees celsius, and the secondary antibodies used were anti-murine Alexa 488 (Cell Signaling Technology, cat No. 4408) and anti-rabbit Alexa 555 (Cell Signaling Technology, cat No. 4413). The samples were then sealed with DAPI (Beyotime, cat No. p 0131), observed under a laser scanning confocal microscope at 488nm (green TTK), 555nm (red, OCN) and 405nm (blue, DAPI) wavelengths, and photographed with a nicon Eclipse Ni-E confocal microscope.

The Micro-CT detection method specifically comprises the following steps: micro-CT was performed using an Inveon MM system (siemens) with parameters set to a pixel size of 8.82lm, a voltage of 80kV, a current of 500lA, an exposure time of 1500ms, and an image was obtained by 360 degree rotation shooting. BV/TV, tb.N, tb.Th, tb.Sp and Ct.Th in the trabecular region (1-2 mm under the distal to proximal epiphysis) were calculated using Inveon Research Workplace (Siemens) according to guidelines set by the American society of bone and mineral research. In addition, two-dimensional and three-dimensional bone structure image slices are reconstructed.

(4) Test results:

the immunofluorescence results of FIG. 8 suggest that the rAAV-Ttk group of mice Ttk expression is increased and the number of Ocn-tagged osteogenic MSCs is increased as compared to the rAAV9-Control group.

The three-dimensional reconstruction results of Micro-CT in FIG. 9 suggest that the recovery of the femoral defect is better in the rAAV-Ttk group of mice with the skull defect than in the rAAV9-Control group.

The Micro-CT bone trabecular analysis result of FIG. 10 shows that compared with the rAAV9-Control group, the rAAV-Ttk group has more bone trabecular number, which indicates that the rAAV-Ttk has better treatment effect on age-related osteoporosis.

The results show that compared with the rAAV9-Control group, the expression of the senile osteoporosis mice Ttk in the rAAV-Ttk group is increased, the bone mass is increased, and the bone defect recovery condition is better.

Comprehensive examples 1 and 2 show that the overexpression of TTK can promote the improvement of the osteogenesis ability of mesenchymal stem cells, has a better treatment effect on age-related osteoporosis, and is expected to be a new target for preventing and treating the osteogenesis attenuation of mesenchymal stem cells or preventing and treating the age-related osteoporosis.

The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, and yet fall within the scope of the invention.

Claims (7)

1. Application of a reagent for promoting TTK protein kinase expression in preparing a medicine for preventing and treating mesenchymal stem cell osteogenesis weakening.

2. Use of an agent that promotes expression of TTK protein kinase in the manufacture of a medicament for the prevention and treatment of age-related osteoporosis.

3. The use according to claim 1 or 2, wherein the agent promoting expression of TTK protein kinase comprises a lentivirus overexpressing TTK protein kinase, an adeno-associated virus overexpressing TTK protein kinase, a recombinant expression vector overexpressing TTK protein kinase, a recombinant bacterium overexpressing TTK protein kinase.

4. Use according to claim 3, wherein the agent promoting expression of TTK protein kinase comprises lentivirus pSLenti-EF1-EGFP-P2A-Puro-CMV-TTK-Myc-WPRE and adeno-associated virus rAAV9-Ttk-mneon green.

5. A medicament for promoting osteoblastic differentiation of mesenchymal stem cells or for preventing and treating age-related osteoporosis, characterized in that the medicament has an agent promoting expression of TTK protein kinase as a main active ingredient.

6. A medicament for promoting osteoblastic differentiation of mesenchymal stem cells according to claim 5, further comprising a pharmaceutically acceptable carrier.

7. The medicine for promoting bone formation differentiation of mesenchymal stem cells according to claim 5, wherein the dosage form of the medicine comprises injection, oral liquid, tablet, granule, capsule, pill.

Images