CN116219073A

CN116219073A - Primer and fluorescent probe for detecting eight pathogens of TORCH

Info

Publication number: CN116219073A
Application number: CN202310020461.4A
Authority: CN
Inventors: 陶维维; 周凯月; 林灵; 楼敬伟; 吴守信; 杨文文; 汪帅男; 王博伟; 何顺清; 汪梦竹; 吕芳; 何小明
Original assignee: Shanghai Biotecan Medical Diagnostics Co ltd; Shanghai Huateng Biotechnology Co ltd; Shanghai Biotecan Biology Medicine Technology Co ltd
Current assignee: Shanghai Biotecan Medical Diagnostics Co ltd; Shanghai Huateng Biotechnology Co ltd; Shanghai Biotecan Biology Medicine Technology Co ltd
Priority date: 2023-01-06
Filing date: 2023-01-06
Publication date: 2023-06-06

Abstract

The invention discloses a primer and a fluorescent probe for detecting eight pathogens of TORCH. The nucleic acid sequence of the primer comprises sequences shown in SEQ ID NO.1-SEQ ID NO. 18; the nucleic acid sequence of the fluorescent probe comprises the sequence shown in SEQ ID NO.19-SEQ ID NO. 27. The invention creatively designs the primer and the fluorescent probe for detecting the eight pathogens of the TORCH, realizes the parting detection of the total 8 targets of the TORCH in one tube by a PCR-beacon melting curve method, and has high detection sensitivity (the detection lower limit can reach 1 copy), good specificity, high flux and low cost.

Description

Primer and fluorescent probe for detecting eight pathogens of TORCH

Technical Field

The invention belongs to the technical field of biology, and relates to a primer and a fluorescent probe for detecting eight pathogens of TORCH.

Background

TORCH refers to a pathogen that causes congenital intrauterine infection and perinatal infection to cause abnormal development and stillbirth of a perinatal infant, and is an abbreviation of English name for a group of pathogenic microorganisms, wherein T (Toxoplasma) is Toxoplasma gondii, O (other) is other pathogenic microorganism such as treponema pallidum, herpes zoster virus, parvovirus B19, coxsackie virus, etc., R (rubella. Virus) is rubella virus, C (cytomegalo. Virus) is cytomegalovirus, and H (Herps. Virus) is herpes simplex type I/II.

Toxoplasma is a category of parasitic diseases. The whole life history development process of toxoplasma requires two hosts, a feline such as a cat as the final host, but its choice for intermediate hosts is very relaxed, and either mammalian or avian may be used as intermediate host. It has also been reported that insects such as mosquitoes, flies, cockroaches, etc. can carry the toxoplasma to the food or drinking water of humans, which can cause infections in humans. The human body infects toxoplasma, most of which are asymptomatic vermin, and only a few people develop the disease. The disease has complex clinical manifestation, the light person is recessive infection, the heavy person can be severe damage of multiple organs, such as toxoplasmosis, ocular disease, nephropathy, liver disease, lung disease, toxoplasmosis and other lesions of various systems. The arcuate body has a severe impact on pregnancy. Fetal malformations caused by infection with toxoplasma in early gestation mainly include: hydrocephalus, cerebellar malformation, chorioretinitis, and brain calcification. Multiple organ necrotic lesions of the fetus can be caused by blood circulation infection, such as hepatosplenomegaly, myocarditis, thrombocytopenia and the like, intrauterine hypoevolutism and premature delivery of the fetus can be caused by asymptomatic infection, and dysplasia of the fetus can not be caused by late-pregnancy infected persons.

HSV infection is very common in people, the infection rate is about 80-90%, and patients and healthy people with toxicity are infectious agents. Herpes simplex viruses are classified as type I and type II, and their infection pathways are primarily related by secretions and intimate contact with the susceptible person.

It is thought that type I viruses attack more than the waist and cause diseases such as herpes labialis, eczema herpeticum, stomatitis, keratoconjunctivitis; type II viruses multiply the lower lumbar region, causing genital herpes, which is transmitted primarily by sex life and may be associated with cervical cancer. Both type I and type II viruses can cause meningitis and skin herpes. Pregnant women are infected with HSV during pregnancy, which can cause fetal congenital infections. Neonates (less than 7 weeks of age) may develop extensive visceral and central nervous system infections after HSV infection, with a high mortality rate. The primary route of neonatal infection is by exposure to genital secretions during birth. In order to reduce infections in fetuses and newborns, pregnant women are recommended to do HSV serological examinations in an effort to avoid conception or production during HSV infection.

Rubella virus is an endemic disease in temperate climates, and the incidence peak is from spring to early summer. Rubella virus can be transmitted through respiratory tract, and nasopharyngeal secretion is used as main infectious source. The virus has weak infection ability by contact, occasionally causes no infection, has a latency period of 10 to 21 days, and is manifested by clinical symptoms such as cough, runny nose, pharyngalgia, headache, fever, anorexia, etc. The face may first develop rashes throughout the body within one month. The infection of rubella virus is a major hazard to pregnant women, and during pregnancy rubella virus infection can cause stillbirth, spontaneous abortion or serious infant malformation, the severity of infection being largely dependent on the period of pregnancy at which the infection occurs. If the infection is carried out in 8 weeks before pregnancy, the natural flow rate reaches 20 percent, the fetal infection can be almost certainly caused and serious sequelae appear in 12 weeks, and other diseases such as heart and eye deficiency, retinopathy, hearing deficiency, diabetes mellitus and other endocrine diseases, nerve deafness, glaucoma and the like can be caused. Infection of the mother with rubella virus in early gestation almost always causes a widely sustained multiple organ infection of the fetus, leading to stillbirth. Most women in China are infected with rubella virus and have certain immunity. Unlike some countries, there are not as many susceptible women. However, even so, rubella vaccine should generally be injected 6 months prior to pregnancy.

Cytomegalovirus (CMV) is an ancient virus that almost all people can infect during a certain period of life. The clinical manifestations of the virus after infection are related to the individual immunocompetence and age of the patient. Severe intrauterine infections in pregnant women can lead to intrauterine stillbirth and neonatal death. Cytomegalovirus infection of newborns can be infected by (1) contact during delivery through the maternal birth canal; (2) infection by breast feeding; (3) infection by multiple blood transfusions. Most newborns have no adverse reaction after being infected by cytomegalovirus, but have great danger to premature infants and infirm, and are mainly characterized by damaged neuromuscular. Infants and children often have no obvious symptoms after infection, and are occasional with hepatosplenomegaly, liver dysfunction and respiratory diseases. Teenagers and adults are asymptomatic in infection, a few of which can cause fever, hepatitis, generalized lymphadenectasis or various rashes, and few of which have complications such as pneumonia, myocarditis, pericarditis, neuritis, radiculitis and encephalitis; bacterial meningitis, thrombocytopenic purpura, hemolytic anemia and retinitis; (4) CMV is a major hazard to patients using immunosuppressants, and can cause pneumonia, hepatitis, and systemic diseases, ultimately leading to death.

CN110982938A discloses a fluorescent quantitative PCR kit for simultaneously detecting TORCH five pathogens and application thereof, the kit comprises a primer pair and a fluorescent probe for detecting nucleic acids of the five pathogens, a pseudo virus internal standard, and a primer pair and a fluorescent probe for detecting the internal standard, the kit can be used for simultaneously detecting nucleic acids of the five pathogens in two PCR reaction tubes at one time, the detection flux is high, the accuracy and the sensitivity are high, and the screening cost is low, but the method cannot achieve zero-distance contact between a fluorescent group and a quenching fluorescent group due to the space distance, so that zero-background fluorescence cannot be achieved.

CN114231649a discloses a primer probe combination, a kit and an application thereof for detecting TORCH five pathogens, wherein the application utilizes single PCR and multiple PCR to divide into two groups for screening five pathogens, the same genus pathogens are divided into one group, the other genus pathogens are divided into one group, after the reaction is completed, the detection result is analyzed according to an amplification curve graph and a CT value, but the method cannot achieve zero-distance contact between a fluorescent group and a quenching fluorescent group due to space distance, so that zero-background fluorescence cannot be achieved.

In summary, the existing method for detecting the TORCH pathogen has the problems of low sensitivity, high false positive rate, incapability of detecting a window period, poor anti-interference capability, relatively delayed detection result, incapability of realizing zero background fluorescence and the like. How to provide a rapid and highly sensitive method for detecting TORCH pathogens, which realizes zero background fluorescence, has become one of the problems to be solved in the biotechnology field.

Disclosure of Invention

Aiming at the defects and actual demands of the prior art, the invention provides a primer and a fluorescent probe for detecting eight types of TORCH pathogens, solves the problems of low sensitivity, high false positive rate, incapability of detecting a window period, poor anti-interference capability, relatively delayed detection result, incapability of realizing zero background fluorescence and the like in the existing method for detecting eight types of TORCH pathogens, realizes the parting detection of total 8 targets of TORCH in one tube, and has high detection sensitivity (the detection lower limit can reach 1 copy), good specificity, high throughput and low cost.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a primer and a fluorescent probe for detecting eight pathogens of TORCH, wherein the nucleic acid sequence of the primer comprises the sequences shown in SEQ ID No.1-SEQ ID No. 18; the nucleic acid sequence of the fluorescent probe comprises the sequence shown in SEQ ID NO.19-SEQ ID NO. 27.

The invention creatively designs a primer and a fluorescent probe for detecting eight pathogens of TORCH, and adds a certain number of reverse complementary sequences of the 3 'end at the 5' end of the probe primer, so that the dissociated probe forms a stem-loop structure similar to single-stranded RNA, the report fluorescent group and the quenching fluorescent group reach infinite approaching degree in space structure, thereby achieving the purpose of completely quenching background fluorescence, in addition, the typing detection of total 8 targets of TORCH is realized in one tube by a PCR-beacon melting curve method, the detection sensitivity is high (the detection lower limit can reach 1 copy), the specificity is good, the throughput is high, and the cost is low.

SEQ ID NO.1：GGGTTGGACTGGCTCATGTG。

SEQ ID NO.2：CCCCTGCCACTTGGTCATAG。

SEQ ID NO.3：TTCCGATTTTCTTGTTTCCGTC。

SEQ ID NO.4：GTCATTGTTTCTCTTCCGTTTTCT。

SEQ ID NO.5：CTTGGCTGTACCTCGAGTCT。

SEQ ID NO.6：AGGGGGGAACCGCAATTATC。

SEQ ID NO.7：AGGACARATGATTCTCCTGAAGGA。

SEQ ID NO.8：ATGGGGTTGATTGTCAAGTGCA。

SEQ ID NO.9：ACCTGTAAACCCTAGGAGCG。

SEQ ID NO.10：ACTAGCCTGAAGAATGCGGC。

SEQ ID NO.11：AAGGGGCGGTTTAATAATCACGTG。

SEQ ID NO.12：GGATCAAGCCCGAGGTCT。

SEQ ID NO.13：GCGAGCGTCCAGGTTTAGA。

SEQ ID NO.14：TGAACACCTCTGTCGGCGAG。

SEQ ID NO.15：GTACTTCCGGGACATGGGMGA。

SEQ ID NO.16：CTTTCCGCTTCTTCCGGC。

SEQ ID NO.17：TCGGGGAGRAAGATGACCAT。

SEQ ID NO.18：GATGTGGAAGCCGAACAAGC。

SEQ ID NO.19：CGGAGGCTCATGCCGCCGAGGAAGCG。

SEQ ID NO.20：AAGCAGCCACAAACGACCCAA。

SEQ ID NO.21：ACCTCCACGGCCAAGTACCGG。

SEQ ID NO.22：GGCTTCAMCATCGACGTAAAGCC。

SEQ ID NO.23：TAAGAAACATGTCTAATCCTGGTATCTTA。

SEQ ID NO.24：

GGCGTCGTACTATCCGCGCCCTCCGTGCGACGGGTAGTTCGGGCTCC。

SEQ ID NO.25：TTCTGACCTGAAGGCTCTGCGCG。

SEQ ID NO.26：AAGCAATGCAGTACGCCGATGCTT。

SEQ ID NO.27：CGCCCCCAGGTGAACTCACGGGGCG。

Preferably, the fluorescent probe comprises a fluorescent group at the 5 'end and a quenching group at the 3' end.

Preferably, the fluorescent group comprises any one or a combination of at least two of FAM, HEX, VIC, ROX, TAMRA or CY 5.

Preferably, the quenching group comprises any one or a combination of at least two of TAMRA, BHQ1, BHQ2, MGB, DABCYL or BHQ 3.

In a second aspect, the invention provides the primer for detecting eight pathogens of TORCH and the use of a fluorescent probe in the preparation of a product for detecting eight pathogens of TORCH.

In a third aspect, the present invention provides a kit for detecting eight pathogens of TORCH, the kit comprising the primer for detecting eight pathogens of TORCH of the first aspect and a fluorescent probe.

In a fourth aspect, the invention provides the primer for detecting the eight pathogens of TORCH and the application of the fluorescent probe in detecting the eight pathogens of TORCH.

In a fifth aspect, the present invention provides a method of detecting TORCH eight pathogens for non-disease diagnosis and/or treatment purposes, the method comprising:

and (3) taking nucleic acid of a sample to be detected as a template, performing fluorescent PCR amplification by using the primer and the fluorescent probe for detecting the TORCH eight pathogens according to the first aspect, and judging according to a fluorescent PCR amplification result.

Preferably, the sample to be tested comprises any one or a combination of at least two of newborn infant blood, vaginal swab or cervical scraping.

Preferably, the system for fluorescent PCR amplification further comprises Mix and DNA polymerase.

Preferably, the amplification procedure of the fluorescent PCR amplification comprises:

(1) Reverse transcription is carried out at 50-55 ℃ for 5-10 min; (2) pre-denaturation at 93-95℃for 4-5 min; (3) 94-95 ℃ for 10-15s;58-60 ℃ for 30-60s;40-45 cycles. Preferably, the melting curve procedure for fluorescent PCR amplification is: 93-95 ℃ for 10-25s;30-45 ℃ for 60-120s; the temperature is raised to 95 ℃ at a rate of 0.5% -1%.

Specific point values among 50 to 55 mentioned above may be selected from 50, 51, 52, 53, 54, 55, etc.

The specific point values in the above 5 to 10 may be selected from 5, 6, 7, 8, 9, 10, etc.

Specific point values among 93 to 95 described above may be selected from 93, 94, 95, etc.

Specific point values of 4 to 5 may be selected from 4, 5, etc.

Specific point values from 94 to 95 may be selected from 94, 95, etc.

The specific point values of 10 to 15 may be 10, 11, 12, 13, 14, 15, etc.

The specific point values of 58-60 above may be selected from 58, 59, 60, etc.

Specific point values in the above 30 to 60 may be selected from 30, 35, 40, 45, 50, 57, 58, 59, 60, etc.

Specific point values among the above 40 to 45 may be selected from 40, 41, 42, 43, 44, 45, etc.

Specific point values in the above 10 to 25 may be selected from 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, 25, etc.

Specific point values of 30 to 45 may be selected from 30, 35, 40, 41, 42, 43, 44, 45, etc.

Specific point values among the above 60 to 120 may be selected from 60, 65, 70, 75, 80, 90, 100, 110, 115, 120, etc.

Specific point values in the above 0.5% -1% may be selected from 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1% and the like.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention can rapidly, accurately and sensitively carry out qualitative gene detection on total 8 pathogens of TORCH by applying fluorescent quantitative PCR technology, has high detection sensitivity (the detection lower limit can reach 1 copy), good specificity, high flux, low cost and the like;

(2) The fluorescent quantitative PCR reaction procedure is completed in one step, secondary treatments such as product purification sequencing and the like are not needed, the operation is extremely simple and convenient, and the needed sample amount is small;

(3) The invention can adopt an asymmetric and melting curve analysis method, breaks through the limitation that one channel of the traditional detection system can only detect one target, and one fluorescent channel can detect at least two targets;

(4) The fluorescent probe designed by the invention is a molecular beacon probe, and can lead the report fluorescence and the quenching fluorescent group to reach infinite approaching degree in the space structure, thereby leading the amplified fluorescence value to be obviously higher than that of the common TaqMan probe.

Drawings

FIG. 1 is a graph showing HSV1/2 specific melting peaks at 78.5℃and TOX specific melting peaks at 72.6℃for FAM channels in the same tube;

FIG. 2 is a graph showing PVB 19-specific melting peaks at 64.2℃and HSV 2-specific melting peaks at 75.3℃for the VIC channels in the same tube;

FIG. 3 is a graph showing a CMV-specific melting peak at 80.6℃for the ROX channel, a VZV-specific melting peak at 61.5℃and an internal standard RNase P-specific melting peak at 73.4℃in the same tube;

FIG. 4 is a graph showing a peak of RV-specific melting at 73℃and a peak of HSV 1-specific melting at 58.8℃of Cy5 channel in the same tube;

FIG. 5 shows that no specific melting peak pattern appears in the FAM, VIC, ROX, cy channel for Mycoplasma gondii, mycoplasma urealyticum, neisseria gonorrhoeae, candida albicans, trichomonas vaginalis, chlamydia trachomatis, corynebacterium vaginalis, corynebacterium pumilum, acinetobacter baumannii, mycobacterium smegmatis, bacteroides fragilis, enterobacter cloacae, enterococcus faecalis, escherichia coli, staphylococcus aureus, staphylococcus epidermidis, streptococcus A, hepatitis B virus, hepatitis C virus, and EB virus related cross pathogens in the same tube.

Detailed Description

The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

Example 1

Beacon multiplex system addition amplification curve analysis.

In order to avoid false negative in detection, the invention adds the detection target of the international internal standard gene in the system, and the specific gene sequence and the marking method thereof are shown in table 1.

TABLE 1

Example 2

Fluorescent quantitative PCR analysis.

(1) Extracting a nucleic acid sample, checking the shelf life of the kit before an experiment, ensuring that ethanol is added in Wash buffers 1 and 2, marking a corresponding mark on a bottle, and preparing isopropanol, 75% ethanol, a 1.5mL Eppendorf tube in the effective period of high-pressure sterilization and various pipette tips; taking out EDTA anticoagulant tube filled with whole blood from refrigerator at 4deg.C, reversing for several times, and mixing; marking the unique identifier of the specimen corresponding to the Eppendorf tube with the volume of 1.5 mL; remove 900 μ L Cell Lysis Solution separately and add to sterilized 1.5mLEppendorf tubes; transfer 300 μl of whole blood to the 1.5mL EP tube with Cell Lysis Solution added thereto; covering an Eppendorf tube cover, and incubating for 10min at 25 ℃; centrifuging at 13,000rpm25deg.C for 20s; taking out the Eppendorf tube, and observing white precipitate; opening an Eppendorf tube cover, holding the bottom of the tube, tilting the EP tube opening to discard part of red supernatant, and sucking the red supernatant; covering the Eppendorf tube, and flicking the bottom of the Eppendorf tube with fingers to resuspend the white precipitate; transferring 300 mu L Nuclei Lysis Solution into the Eppendorf tube, covering the tube, and mixing; opening an Eppendorf tube, transferring 100 mu L Protein Precipitation Solution into the Eppendorf tube, covering a tube cover, and severely oscillating for 20s on an oscillator; centrifuging at 13,000rpm25deg.C for 3min; transferring the removed supernatant to a new sterilized 1.5mL Eppendorf tube; transferring 300 mu L of isopropanol into an Eppendorf tube, covering the tube and uniformly mixing, and separating out white flocculent gDNA/RNA; centrifuging at 13,000rpm25deg.C for 1min; opening an Eppendorf tube, pinching the bottom of the tube by hand, and discarding the supernatant by tilting the tube orifice; transferring 300 mu L of 75% ethanol, adding the ethanol into an Eppendorf tube, covering a tube cover, and gently and reversely washing the precipitate; centrifuging at 13,000rpm25deg.C for 1min; opening an Eppendorf tube, holding the bottom of the tube, and discarding the supernatant by tilting the tube orifice; placing new filter paper on an experiment table, reversely buckling an Eppendorf tube, sucking the liquid, and airing the uncapped side of the Eppendorf tube; visual inspection of the precipitate size, add 100 μldna/RNARehydration Solution to the precipitate; after overnight dissolution, measuring the concentration of the nucleic acid by using a Nanodrop ultraviolet spectrophotometer, wherein the concentration of the nucleic acid is more than or equal to 20 ng/mu L and the OD260/OD280 is 1.9+/-0.2, if the concentration is insufficient, adding ethanol to precipitate DNA/RNA again, and then adding DNA/RNA Rehydration Solution again to dissolve the nucleic acid; the unique numbers of the samples are marked again on the tube wall and the tube cover, and the nucleic acid samples are stored to a refrigerator at 4 ℃ by wrapping and protecting the nucleic acid samples with transparent adhesive tapes.

(2) The 25. Mu. LPCR amplification system (except for template addition) was prepared in the reagent preparation area, and the components and amounts added are shown in Table 2.

TABLE 2

/>

After the sample preparation area is subjected to short centrifugation on a template containing gDNA/RNA, 5.0 mu L of the template is added into an amplification system, a unique identifier of the sample is marked on the wall of a PCR tube, the code number of a detection item is marked on the tube cover, the PCR tube is vibrated and mixed uniformly, the sample is centrifuged on a table centrifuge, the PCR tube is placed into an adapter after the procedure is set, the adapter is installed into an amplification instrument, a reaction procedure is set according to the following table 3, a channel selected by the reaction procedure is (FAM/VIC/ROX/CY 5), and the instrument operation is started by clicking "start".

TABLE 3 Table 3

Stage(s)	Temperature time	Cycle number
			Reverse transcription	50℃10min	1cycle
Pre-denaturation	95℃5min	1cycle
			PCR amplification	95 ℃ 15s,60 ℃ 30s (fluorescence collection)	45cycles
Stabilized fluorescence	95℃10s，45℃120s	1cycle
			Melting procedure	45 ℃ is increased to 90 ℃,0.03 ℃/s	1cycle

(3) Respectively checking whether the corresponding FAM, VIC, ROX and Cy5 channels show specific melting peaks, wherein in the study, FAM channels show HSV1/2 specific melting peaks at 78.5 ℃ and TOX specific melting peaks at 72.6 ℃ respectively, as shown in figure 1; the VIC channel has PVB19 specific melting peak at 64.2deg.C and HSV2 specific melting peak at 75.3deg.C, respectively, as shown in FIG. 2; the ROX channel showed CMV-specific melting peak at 80.6deg.C, VZV-specific melting peak at 61.5deg.C, and internal standard RNase P-specific melting peak at 73.4deg.C, respectively, as shown in FIG. 3; cy5 channels showed RV-specific melting peaks at 73℃and HSV 1-specific melting peaks at 58.8℃respectively, as shown in FIG. 4.

(4) And (3) analyzing a sequencing result, namely double-clicking a mouse in an 'expert' folder, opening the operation file, selecting a 'gene scanning', clicking a 'calculation' key, carrying out genotype analysis on all detection samples, and judging sample detection results.

The comparison of the primers screened is shown in Table 4.

TABLE 4 Table 4

The results show that: the molecular beacon designed by the invention can lead the reported fluorescence and the quenching fluorescent groups to reach infinite approaching degree in the space structure, so that the amplified fluorescence value is obviously higher than that of a common TaqMan probe, and the primer probe for detecting eight pathogens of TORCH has good combination specificity.

Experimental comparative example

The fluorescent quantitative PCR detection of 12 samples (from the clinical samples of the partner hospital) was compared with the first generation sequencing.

The fluorescent quantitative PCR detection of 12 samples is performed for 1.5 h+result analysis for 0.5h and 2h in total, the first-generation sequencing detection is performed for 8 h+result analysis for 1h and 9h in total, and the fluorescent quantitative PCR detection is performed in a closed tube operation, so that secondary treatments such as product purification sequencing and the like are not needed, the risk of pollution of amplified products is avoided, and the comparison of the fluorescent quantitative PCR of 12 samples and the first-generation sequencing detection results is shown in Table 5.

TABLE 5

The results show that: the primer probe for detecting the TORCH eight pathogens has good combination specificity, and breaks through the limitation that one channel of the traditional detection system can only detect one target.

Detecting lower limit case

Cloning each target amplicon region to be detected onto the same pseudovirus, delivering the pseudovirus to the Shanghai Fubai Australian biotechnology limited company for synthesis and carrying out the quantitative detection of the pseudovirus, sequentially diluting the pseudovirus to 10000, 1000, 100, 10 and 1 copies/mu L by 10 times, and carrying out the fluorescent quantitative PCR reaction detection on the viruses with the dilution ratio.

Results: the detection lower limit of each type to be detected is 1 copy, which indicates that the primer probe combination for detecting the TORCH eight pathogens designed by the invention has high detection sensitivity (the detection lower limit can reach 1 copy), and has good specificity.

Specificity verification case

Treponema pallidum, ureaplasma urealyticum, neisseria gonorrhoeae (gonococcus), candida albicans, trichomonas vaginalis, chlamydia trachomatis, corynebacterium vaginalis, corynebacterium pumilus, acinetobacter baumannii, mycobacterium smegmatis, bacteroides fragilis, enterobacter cloacae, enterococcus faecalis, escherichia coli, staphylococcus aureus, staphylococcus epidermidis, streptococcus a, hepatitis b virus, hepatitis c virus, epstein barr virus, and the like obtained from ATCC in an amount of 10 ⁶ CFU/mL, the bacterial, fungal or viral of the dilution ratio was subjected to fluorescent quantitative PCR reaction using TORCH kit, and the results are shown in FIG. 5.

Results: the fact that no specific melting peak appears in each pathogen to be detected shows that the primer probe combination for detecting TORCH eight pathogens designed by the invention has high detection specificity.

In summary, the primer and fluorescent probe for detecting the TORCH eight pathogens designed by the invention are characterized in that a certain number of reverse complementary sequences of the 3 'end are added to the 5' end of the probe primer, so that the dissociated probe forms a stem-loop structure similar to single-stranded RNA, the report fluorescent group and the quenching fluorescent group reach infinite approaching degree in space structure, the effect of completely quenching background fluorescence can be achieved, in addition, the typing detection of total 8 targets of TORCH is realized in one tube by a PCR-beacon melting curve method, the detection sensitivity is high (the detection lower limit can reach 1 copy), the specificity is good, the high flux is high, and the cost is low.

The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Claims

1. A primer and a fluorescent probe for detecting eight pathogens of TORCH, wherein the nucleic acid sequence of the primer comprises the sequences shown in SEQ ID NO.1-SEQ ID NO. 18; the nucleic acid sequence of the fluorescent probe comprises the sequence shown in SEQ ID NO.19-SEQ ID NO. 27.

2. The fluorescent probe of claim 1, wherein the fluorescent probe comprises a fluorescent group at the 5 'end and a quenching group at the 3' end;

preferably, the fluorophore comprises any one or a combination of at least two of FAM, HEX, VIC, ROX, TAMRA or CY 5;

3. Use of a primer for detecting eight pathogens of TORCH as claimed in claim 1 or 2, and a fluorescent probe for the preparation of a product for detecting eight pathogens of TORCH.

4. A kit for detecting eight pathogens of TORCH, comprising the primer for detecting eight pathogens of TORCH according to claim 1 or 2 and a fluorescent probe.

5. The use of a primer for detecting eight pathogens of TORCH as claimed in claim 1 or 2, and a fluorescent probe for detecting eight pathogens of TORCH.

6. A method of detecting TORCH eight pathogens for non-disease diagnosis and/or treatment purposes, the method comprising:

using the nucleic acid of the sample to be detected as a template, performing fluorescent PCR amplification by using the primer and the fluorescent probe for detecting the TORCH eight pathogens according to claim 1 or 2, and judging according to the fluorescent PCR amplification result.

7. The method of claim 6, wherein the sample to be tested comprises any one or a combination of at least two of neonatal blood, vaginal swab, or cervical squeegee.

8. The method of claim 6 or 7, wherein the fluorescent PCR amplification system further comprises Mix and DNA polymerase.

9. The method of any one of claims 6-8, wherein the amplification procedure of fluorescent PCR amplification comprises:

(1) Reverse transcription (2) at 50-55deg.C for 5-10min and pre-denaturation at 93-95deg.C for 4-5 min; (3) 94-95 ℃ for 10-15s;58-60 ℃ for 30-60s;40-45 cycles.

10. The method of any one of claims 6-9, wherein the melting curve procedure for fluorescent PCR amplification is: 93-95 ℃ for 10-25s;30-45 ℃ for 60-120s; the temperature is raised to 95 ℃ at a rate of 0.5% -1%.