CN116218998A - Nucleic acid reagent, kit and multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA - Google Patents
Nucleic acid reagent, kit and multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA Download PDFInfo
- Publication number
- CN116218998A CN116218998A CN202310148863.2A CN202310148863A CN116218998A CN 116218998 A CN116218998 A CN 116218998A CN 202310148863 A CN202310148863 A CN 202310148863A CN 116218998 A CN116218998 A CN 116218998A
- Authority
- CN
- China
- Prior art keywords
- dna
- human
- ribosomal
- ribosomal dna
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108020001027 Ribosomal DNA Proteins 0.000 title claims abstract description 64
- 238000001514 detection method Methods 0.000 title claims abstract description 25
- 239000012445 acidic reagent Substances 0.000 title claims abstract description 19
- 108020004707 nucleic acids Proteins 0.000 title claims abstract description 19
- 102000039446 nucleic acids Human genes 0.000 title claims abstract description 19
- 150000007523 nucleic acids Chemical class 0.000 title claims abstract description 19
- 238000003753 real-time PCR Methods 0.000 title claims abstract description 14
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 44
- 108060003196 globin Proteins 0.000 claims abstract description 15
- 108020004414 DNA Proteins 0.000 claims description 46
- 238000000034 method Methods 0.000 claims description 19
- 230000003321 amplification Effects 0.000 claims description 17
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 17
- 238000006243 chemical reaction Methods 0.000 claims description 12
- 239000008280 blood Substances 0.000 claims description 9
- 210000004369 blood Anatomy 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 8
- 239000000126 substance Substances 0.000 claims description 7
- 238000001917 fluorescence detection Methods 0.000 claims description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 5
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 3
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 3
- 230000003172 anti-dna Effects 0.000 claims description 3
- 239000011535 reaction buffer Substances 0.000 claims description 3
- UHZZMRAGKVHANO-UHFFFAOYSA-M chlormequat chloride Chemical compound [Cl-].C[N+](C)(C)CCCl UHZZMRAGKVHANO-UHFFFAOYSA-M 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 5
- 230000009897 systematic effect Effects 0.000 abstract description 2
- 239000000523 sample Substances 0.000 description 24
- 239000012087 reference standard solution Substances 0.000 description 10
- 239000012488 sample solution Substances 0.000 description 7
- 239000000243 solution Substances 0.000 description 4
- 238000011144 upstream manufacturing Methods 0.000 description 4
- 238000003556 assay Methods 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 238000002844 melting Methods 0.000 description 3
- 230000008018 melting Effects 0.000 description 3
- 230000004544 DNA amplification Effects 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 102000018146 globin Human genes 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 108700039887 Essential Genes Proteins 0.000 description 1
- 208000031448 Genomic Instability Diseases 0.000 description 1
- 102100021519 Hemoglobin subunit beta Human genes 0.000 description 1
- 108091005904 Hemoglobin subunit beta Proteins 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 230000005856 abnormality Effects 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 230000032683 aging Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000002902 bimodal effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 230000003915 cell function Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000002255 enzymatic effect Effects 0.000 description 1
- 210000003527 eukaryotic cell Anatomy 0.000 description 1
- 230000020978 protein processing Effects 0.000 description 1
- 230000009467 reduction Effects 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 108020004418 ribosomal RNA Proteins 0.000 description 1
- 210000003705 ribosome Anatomy 0.000 description 1
- 230000028710 ribosome assembly Effects 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The disclosure relates to the biotechnology field, in particular to a nucleic acid reagent, a kit and a multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA. The nucleic acid reagent comprises a primer capable of specifically amplifying human 5S ribosomal DNA and a primer capable of specifically amplifying a globin gene. The nucleic acid reagent, the kit and the detection method provided by the disclosure take the globin gene as an internal reference gene, are used for detecting the copy number of the human 5S ribosomal DNA, are simple and convenient to operate, have small systematic errors, high accuracy and high sensitivity, and are suitable for rapid detection of large-sample-number and large-age-span people.
Description
Technical Field
The disclosure relates to the biotechnology field, in particular to a nucleic acid reagent, a kit and a multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA.
Background
Ribosomal DNA (rDNA) is the most abundant and important housekeeping gene in cells and is mainly used to encode ribosomal RNA, thereby completing subsequent ribosome assembly and protein processing. Ribosomal DNA plays an important role in maintaining genomic stability due to the nature of its repetitive sequences and is one of the most fragile regions in the genome of eukaryotic cells, affecting cellular function. More and more studies have shown that abnormalities in ribosome biosynthesis, including increases in the number of ribosomes, are closely related to aging and the development of tumors. Therefore, it is important to perform detection of the copy number of human 5S ribosomal DNA. However, the current high throughput detection methods for human 5S ribosomal DNA copy number detection are few, and the accuracy and sensitivity of the methods remain to be improved.
Disclosure of Invention
The invention aims to overcome the defects that the high-throughput detection method for detecting the copy number of the human 5S ribosomal DNA in the prior art is less and the accuracy and the sensitivity of the method still need to be improved, and provides a nucleic acid reagent, a kit and a detection method for detecting the copy number of the human 5S ribosomal DNA.
In order to achieve the above object, the present disclosure provides a nucleic acid reagent for human 5S ribosomal DNA copy number detection, which includes a primer capable of specifically amplifying human 5S ribosomal DNA, and a primer capable of specifically amplifying a globin gene.
Alternatively, the primer capable of specifically amplifying human 5S ribosomal DNA comprises the primer shown as SEQ ID NO. 1-2;
and/or the primer capable of specifically amplifying the globin gene comprises a primer shown as SEQ ID NO. 3-4.
Optionally, the mol ratio of the primer shown in SEQ ID NO.1, the primer shown in SEQ ID NO.2, the primer shown in SEQ ID NO.3 and the primer shown in SEQ ID NO.4 is (1-1.5) to (0.01-0.015).
Alternatively, the primer shown in SEQ ID NO.1 is an upstream primer (5S-F) for specifically amplifying human 5S ribosomal DNA, the primer shown in SEQ ID NO.2 is a downstream primer (5S-R) for specifically amplifying human 5S ribosomal DNA, the primer shown in SEQ ID NO.3 is an upstream primer (beta-globin-F) for specifically amplifying a globin gene, and the primer shown in SEQ ID NO.4 is a downstream primer (beta-globin-R) for specifically amplifying a globin gene.
Alternatively, the primer shown in SEQ ID NO.1 is TCGTCTGATCTCGGAAGCTAA; the primer shown in SEQ ID NO.2 is AAGCCTACAGCACCCGGTAT; the primer shown in SEQ ID NO.3 is CGGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG; the primer shown in SEQ ID NO.4 is GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT.
The disclosure also provides a kit for detecting the copy number of the human 5S ribosomal DNA, which contains the nucleic acid reagent.
Optionally, the kit further comprises a PCR amplification premix, a reference standard, a reference dye and enzyme-free water;
optionally, the PCR amplification premix comprises a reaction buffer,
Green I、dNTPs、Mg 2+ 2 x premix of rTaq DNA polymerase and anti-DNA polymerase antibody;
optionally, the reference standard comprises a human whole blood DNA extract;
alternatively, the human whole blood DNA extract is obtained by mixing whole blood DNA of not less than 3000 persons; optionally, the age span of the population from which the human whole blood DNA extract is derived is 20 to 60 years;
optionally, the reference dye comprises ROX reference dye;
alternatively, the PCR amplification pre-mix is used in an amount of more than 100 times, preferably 500 times, the amount of the reference dye by volume.
When the kit provided by the disclosure is used for detecting the copy number of the human 5S ribosomal DNA, a reference standard substance can be diluted and configured into a series of standard substance reagents with a standard series of concentration according to the concentration of the DNA of the sample to be detected, so that the concentration of the DNA of the sample to be detected is contained in the range of the standard series of concentration gradients, and then a primer, a premixed solution for real-time quantitative PCR amplification, a reference dye, non-enzymatic water, the standard substance with each concentration and the sample to be detected are respectively mixed according to a given sample adding amount to form an amplification reaction system for PCR reaction.
The disclosure also provides a multiplex fluorescent quantitative PCR detection method for the copy number of the human 5S ribosomal DNA for non-diagnostic purposes, comprising the following steps:
(1) Amplifying and fluorescence detecting a DNA sample of a sample to be detected by adopting a multiplex fluorescence quantitative PCR method, and determining a Ct value Ct corresponding to human 5S ribosomal DNA in the DNA sample 1 And Ct value Ct corresponding to the reference gene 2 Wherein the reference gene is a globin gene;
(2) Ct value Ct based on the corresponding Ct value of the human 5S ribosomal DNA in the DNA sample 1 And a first preset standard curve, determining the relative content R of the human 5S ribosomal DNA in the DNA sample; ct value Ct based on the corresponding Ct value of the internal reference gene in the DNA sample 2 Determining the relative content S of the reference gene in the DNA sample according to a second preset standard curve;
wherein the first preset standard curve indicates a Ct value Ct corresponding to the human 5S ribosomal DNA in the reference standard 1 ' correlation with the relative content of human 5S ribosomal DNA in the reference standard; the second preset standard curve indicates the Ct value Ct corresponding to the reference gene in the reference standard substance 2 ' correlation with the relative content of reference genes in the reference standard;
(3) Determining the relative copy number R/S of the human 5S ribosomal DNA and the reference gene in the DNA sample based on the relative content R of the human 5S ribosomal DNA and the relative content S of the reference gene in the DNA sample.
Optionally, in step (1), the DNA sample of the sample to be detected is amplified and fluorescence detected by using a multiplex fluorescent quantitative PCR method based on the nucleic acid reagent or the kit described above.
Optionally, the reaction system for amplification and fluorescence detection comprises:
optionally, the reaction process of amplification and fluorescence detection comprises:
95℃15min；
96 ℃ 13s,35 cycles;
58℃30s；
measuring Ct value corresponding to human 5S ribosomal DNA at 72 ℃ for 30S;
and (3) measuring Ct value corresponding to the reference gene at 85 ℃ for 30 s.
Optionally, the standard curve is obtained based on a reference standard of at least 5 concentration gradients;
optionally, the lowest concentration of the at least 5 concentration gradients is not higher than the concentration of the DNA sample, and the highest concentration is not lower than the concentration of the DNA sample;
optionally, the lowest two concentrations of the at least 5 concentration gradients are less than the concentration of the DNA sample and the highest two concentrations are greater than the concentration of the DNA sample;
alternatively, the DNA sample has a concentration of 0.625-40 ng/. Mu.L.
The beneficial effects of the present disclosure are:
1. the nucleic acid reagent, the kit and the detection method provided by the disclosure take the globin gene as an internal reference gene, are used for detecting the copy number of the human 5S ribosomal DNA, are simple and convenient to operate, have small systematic errors, high accuracy and high sensitivity, and are suitable for rapid detection of large-sample-number and large-age-span people.
2. The nucleic acid reagent, the kit and the detection method provided by the disclosure have stable peaks of both the human 5S ribosomal DNA and the internal reference gene, smooth dissolution curves and no obvious nonspecific amplification product.
3. According to the nucleic acid reagent, the kit and the detection method, the proportion of the primers is optimized, so that each primer has higher amplification efficiency aiming at a target gene; through optimizing primer concentration and primer PCR sample loading quantity, the primer finally reaches a specific ratio in a reaction system, and experimental results show that on one hand, under the specific primer ratio condition of the disclosure, the PCR reaction can keep the amplification efficiency at 90.00% -110.00% and obtain a more ideal (more than 0.990) standard curve linear R 2 The method comprises the steps of carrying out a first treatment on the surface of the On the other hand, the use of the specific primer ratios of the present disclosure enables a significant reduction in PCR melt kojiThe difference between the peak values of two peaks of the human 5S ribosomal DNA and the reference gene in the line is obviously observed by observing the melting curves of the two genes.
4. The nucleic acid reagent, the kit and the detection method provided by the disclosure use the specific reaction process of amplification and fluorescence detection, are beneficial to effectively collecting signals of two genes and reduce mutual interference. In the early cycle of the PCR reaction program, when the PCR temperature is 72 ℃, the Ct value of the human 5S ribosomal DNA is already collected, the signal of the reference gene is still at a base line at the moment, when the PCR temperature is 85 ℃, the Ct value of the reference gene is collected, and the 5S ribosomal DNA product is not collected because the PCR temperature is completely melted, so that the signal interference is reduced.
Additional features and advantages of the present disclosure will be set forth in the detailed description which follows.
Drawings
In order to more clearly illustrate the embodiments of the present disclosure or the prior art, the drawings that are required in the detailed description or the prior art will be briefly described, it will be apparent that the drawings in the following description are some embodiments of the present disclosure, and other drawings may be obtained according to the drawings without inventive effort for a person of ordinary skill in the art.
FIG. 1 is a graph showing amplification of single copy genes (globin) in a standard series of standards in the assay of example 2 of the present disclosure;
FIG. 2 is a graph showing amplification of 5S ribosomal genes in a standard series of standards in the test method of example 2 of the present disclosure;
FIG. 3 is a graph showing melting curves of 5S ribosomal genes in a standard series of standards in the detection method of example 2 of the present disclosure, wherein the left peak is a 5S signal and the right peak is an internal reference gene signal;
FIG. 4 is an electrophoresis chart of PCR products of 5S ribosomal genes in the standard series of the standard sample in the detection method of example 2 of the present disclosure, wherein the lower band is 5S and the upper band is the reference gene;
FIG. 5 shows amplification efficiencies of the 5S ribosomal gene (a) and the reference gene (b) in the standard series of standards in the detection method of example 2 of the present disclosure.
Detailed Description
The following examples are provided for a better understanding of the present disclosure and are not limited to the preferred embodiments described, but are not intended to limit the disclosure and the scope of protection, and any product that is the same or similar to the present disclosure, either in light of the present disclosure or by combining the present disclosure with other prior art features, falls within the scope of protection of the present disclosure.
The specific experimental procedures or conditions are not noted in the examples and may be followed by the operations or conditions of conventional experimental procedures described in the literature in this field. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.
Example 1
The embodiment provides a kit for detecting copy number of human 5S ribosomal DNA, which comprises 8 products in total, and specifically comprises:
1. reference standard 1:
the concentration of human whole blood DNA in the reference standard is 90 ng/. Mu.L, and a sample is obtained from 3000 human whole blood DNA mixed samples (the ages of 20-60 years);
2. primer 4:
respectively comprises an upstream primer and a downstream primer for specifically amplifying the human 5S ribosomal gene (ddH with corresponding volume is added according to the pipe body prompt 2 Concentration 100. Mu.M after O) and upstream and downstream primers for specific amplification of single copy gene (globin gene) (adding ddH of corresponding volume according to the tube body prompt) 2 post-O concentration of 10 μm), the specific primer sequences were as follows:
3. PCR amplification premix 1:
contains reaction buffer solution,
Green I、dNTPs、Mg 2+ 2X premix of rTaq DNA polymerase and anti-DNA polymerase antibody;
4. reference dye (ROX reference dye) 1 branch;
5. enzyme-free water ddH 2 O1 branch.
Example 2
A method for detecting copy number of human 5S ribosomal DNA for non-diagnostic purposes using the kit described in example 1, comprising the steps of:
1. extracting genome DNA to be detected, and preparing a sample solution to be detected with the DNA concentration of 5 ng/. Mu.L.
2. And preparing a reference standard substance solution of a standard series concentration gradient according to the concentration of DNA in the sample solution to be detected by taking a reference standard substance in the kit, so that the concentration of the DNA in the sample solution to be detected is contained in the standard series concentration gradient, wherein the standard series concentration gradient in the embodiment is 40 ng/mu l, 20 ng/mu l, 10 ng/mu l, 5 ng/mu l, 2.5 ng/mu l, 1.25 ng/mu l and 0.625 ng/mu l.
3. Detecting the sample solution to be detected and the series of reference standard solutions by using a multiplex real-time fluorescence quantitative PCR (RT-PCR) method respectively, and respectively measuring Ct value Ct corresponding to human 5S ribosomal DNA in the sample solution to be detected by using a globin (beta-globin) gene as an internal reference gene 1 Ct value Ct corresponding to reference gene 2 And Ct value Ct corresponding to human 5S ribosomal DNA in each reference standard solution 1 ' Ct value Ct corresponding to reference Gene 2 ′。
The reaction system of the multiplex real-time fluorescent quantitative PCR (RT-PCR) method is shown in Table 1.
TABLE 1 reaction System for multiplex real-time fluorescent quantitative PCR (RT-PCR) method
The reaction procedure for multiplex real-time fluorescent quantitative PCR (RT-PCR) method was set as follows:
Stage 1(hold stage)：1cycle：95℃15min；
stage 2 (PCR Stage): 35cycle: 13s at 96 ℃;58 ℃ for 30s; measuring Ct value corresponding to human 5S ribosomal DNA at 72 ℃ for 30S; and (3) measuring Ct value corresponding to the reference gene at 85 ℃ for 30 s.
4. Detecting Ct value Ct corresponding to human 5S ribosomal DNA in each obtained reference standard solution 1 ' Ct value Ct corresponding to reference Gene 2 ' as shown in table 2.
TABLE 2 Ct of reference standard solutions 1 ' value and Ct 2 ' value
| Reference standard solution | Ct value of human 5S ribosomal DNA Ct 1 ′ | Internal reference gene Ct value Ct 2 ′ |
| 0.625ng/μl | 22.602 | 31.131 |
| 1.25ng/μl | 21.685 | 30.170 |
| 2.5ng/μl | 20.869 | 29.242 |
| 5ng/μl | 19.866 | 28.225 |
| 10ng/μl | 18.831 | 27.189 |
| 20ng/μl | 17.718 | 26.088 |
| 40ng/μl | 16.945 | 25.175 |
Based on the data in Table 2, ct values Ct corresponding to human 5S ribosomal DNA in the respective reference standard solutions were calculated 1 ' Ct value Ct corresponding to reference Gene 2 ' is the ordinate, respectively takes the log corresponding to each reference standard solution 10 (R)、log 10 And (S) drawing a first standard curve and a second standard curve by taking the abscissa as the R, wherein R is the content of human 5S ribosomal DNA, and S is the content of internal reference gene DNA. The first standard curve is shown in fig. 5a, and the expression is: ct is (Ct) 1 ′＝-3.21×log 10 (R)+22.035，R 2 =0.997; the second standard curve is shown in fig. 5b, and the expression is: ct is (Ct) 2 ′＝-3.34×log 10 (S)+30.507，R 2 ＝0.999。
As can be seen from FIGS. 5a and 5b, in the range of the DNA content of the reference standard solutions of 0.625 ng/. Mu.l to 40 ng/. Mu.l, the Ct value corresponding to the human 5S ribosomal DNA and the Ct value corresponding to the internal reference gene in each reference standard solution correspond to the log of each reference standard solution, respectively 10 (R)、log 10 (S) is in a linear relationship, which shows that the method has better sensitivity.
5. Detecting the average Ct of Ct values corresponding to the human 5S ribosomal DNA in the obtained sample solution to be detected 1 = 19.854; average Ct of Ct values corresponding to reference genes 2 = 28.274; carrying out calculation by taking the sample into the first standard curve and the second standard curve to obtain the phase of the human 5S ribosomal DNA in the sample solution to be detectedThe R/S ratio was 4.78/4.66=1.03 for the copy number.
6. The detection effect is as follows: example 2 the results of the assay show that the single copy gene (globin gene) and the standard system of the human 5S ribosomal gene in the reference standard obtained using the kit of example 1 using the assay method of example 2 show stable peaks (see fig. 1, fig. 2), smooth melting curves with little bimodal differences (see fig. 3), no significant non-specific amplification products, and no significant non-specific amplification products in the electropherograms (see fig. 4).
As can be seen from FIG. 4, in the agarose gel electrophoresis analysis result of the PCR product, the size of the target gene amplification product band is the same as the design size, the band is clear, the size of the internal reference gene amplification product band is the same as the design size, the band is clear, and no other amplification product bands exist in the product, which indicates that the specificity of the method is better.
The preferred embodiments of the present disclosure have been described in detail above, but the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solutions of the present disclosure within the scope of the technical concept of the present disclosure, and all the simple modifications belong to the protection scope of the present disclosure.
In addition, the specific features described in the foregoing embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, the present disclosure does not further describe various possible combinations.
Moreover, any combination between the various embodiments of the present disclosure is possible as long as it does not depart from the spirit of the present disclosure, which should also be construed as the disclosure of the present disclosure.
Claims (10)
1. A nucleic acid reagent for copy number detection of human 5S ribosomal DNA, comprising a primer capable of specifically amplifying human 5S ribosomal DNA and a primer capable of specifically amplifying a globin gene.
2. The nucleic acid reagent according to claim 1, wherein the primer capable of specifically amplifying human 5S ribosomal DNA comprises the primer shown in SEQ ID No. 1-2;
and/or the primer capable of specifically amplifying the globin gene comprises a primer shown as SEQ ID NO. 3-4.
3. The nucleic acid reagent according to claim 2, wherein the molar ratio of the primer shown in SEQ ID NO.1, the primer shown in SEQ ID NO.2, the primer shown in SEQ ID NO.3 and the primer shown in SEQ ID NO.4 is (1 to 1.5): 0.01 to 0.015.
4. A kit for the detection of copy number of human 5S ribosomal DNA, characterized in that it comprises a nucleic acid reagent according to any one of claims 1 to 3.
5. The kit of claim 4, further comprising a PCR amplification premix, a reference standard, a reference dye, and enzyme-free water;
optionally, the PCR amplification premix comprises a reaction buffer,
Green I、dNTPs、Mg 2+ 2 x premix of rTaq DNA polymerase and anti-DNA polymerase antibody;
optionally, the reference standard comprises a human whole blood DNA extract;
alternatively, the human whole blood DNA extract is obtained by mixing whole blood DNA of not less than 3000 persons;
optionally, the reference dye comprises ROX reference dye;
alternatively, the PCR amplification pre-mix is used in an amount of more than 100 times, preferably 500 times, the amount of the reference dye by volume.
6. A multiplex fluorescent quantitative PCR method for detecting the copy number of human 5S ribosomal DNA for non-diagnostic purposes, comprising the steps of:
(1) Amplifying and fluorescence detecting a DNA sample of a sample to be detected by adopting a multiplex fluorescence quantitative PCR method, and determining a Ct value Ct corresponding to human 5S ribosomal DNA in the DNA sample 1 And Ct value Ct corresponding to the reference gene 2 Wherein the reference gene is a globin gene;
(2) Ct value Ct based on the corresponding Ct value of the human 5S ribosomal DNA in the DNA sample 1 And a first preset standard curve, determining the relative content R of the human 5S ribosomal DNA in the DNA sample; ct value Ct based on the corresponding Ct value of the internal reference gene in the DNA sample 2 Determining the relative content S of the reference gene in the DNA sample according to a second preset standard curve;
wherein the first preset standard curve indicates a Ct value Ct corresponding to the human 5S ribosomal DNA in the reference standard 1 ' correlation with the relative content of human 5S ribosomal DNA in the reference standard; the second preset standard curve indicates the Ct value Ct corresponding to the reference gene in the reference standard substance 2 ' correlation with the relative content of reference genes in the reference standard;
(3) Determining the relative copy number R/S of the human 5S ribosomal DNA and the reference gene in the DNA sample based on the relative content R of the human 5S ribosomal DNA and the relative content S of the reference gene in the DNA sample.
7. The method according to claim 6, wherein in the step (1), the DNA sample of the sample to be detected is amplified and fluorescence detected by a multiplex fluorescent quantitative PCR method based on the nucleic acid reagent according to any one of claims 1 to 3 or the kit according to claim 4 or 5.
8. The method of claim 7, wherein the reaction system for amplification and fluorescence detection comprises:
4-5 mu L of PCR amplification premix;
1 to 1.5 mu L of a primer shown as SEQ ID NO.1 with 100 mu M;
1 to 1.5 mu L of a primer shown as SEQ ID NO.2 with 100 mu M;
10 mu M of primer shown in SEQ ID NO.3 is 0.1-0.15 mu L;
10 mu M of primer shown in SEQ ID NO.4 is 0.1-0.15 mu L;
0.01-0.02 mu L of reference dye;
1-2 mu L of DNA sample;
the enzyme-free water was supplemented to 10. Mu.L.
9. The method according to claim 7 or 8, wherein the reaction process of amplification and fluorescence detection comprises:
95℃15min；
96 ℃ 13s,35 cycles;
58℃30s；
measuring Ct value corresponding to human 5S ribosomal DNA at 72 ℃ for 30S;
and (3) measuring Ct value corresponding to the reference gene at 85 ℃ for 30 s.
10. The detection method according to any one of claims 6-9, wherein the standard curve is obtained based on a reference standard of at least 5 concentration gradients;
optionally, the lowest concentration of the at least 5 concentration gradients is not higher than the concentration of the DNA sample, and the highest concentration is not lower than the concentration of the DNA sample;
optionally, the lowest two concentrations of the at least 5 concentration gradients are less than the concentration of the DNA sample and the highest two concentrations are greater than the concentration of the DNA sample;
alternatively, the DNA sample has a concentration of 0.625-40 ng/. Mu.L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310148863.2A CN116218998A (en) | 2023-02-22 | 2023-02-22 | Nucleic acid reagent, kit and multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310148863.2A CN116218998A (en) | 2023-02-22 | 2023-02-22 | Nucleic acid reagent, kit and multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116218998A true CN116218998A (en) | 2023-06-06 |
Family
ID=86588734
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310148863.2A Pending CN116218998A (en) | 2023-02-22 | 2023-02-22 | Nucleic acid reagent, kit and multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116218998A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296113A (en) * | 2011-08-12 | 2011-12-28 | 杨楠 | Method for measuring absolute length of chromosome telomere by monochrome multiplex quantitative PCR method |
| WO2016106113A1 (en) * | 2014-12-23 | 2016-06-30 | Ge Healthcare Uk Limited | Methods and reagents for reverse-transcription polymerase chain reaction |
| CN114317693A (en) * | 2021-12-31 | 2022-04-12 | 中国疾病预防控制中心职业卫生与中毒控制所 | Human 5S ribosome DNA copy number detection kit and detection method |
-
2023
- 2023-02-22 CN CN202310148863.2A patent/CN116218998A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296113A (en) * | 2011-08-12 | 2011-12-28 | 杨楠 | Method for measuring absolute length of chromosome telomere by monochrome multiplex quantitative PCR method |
| WO2016106113A1 (en) * | 2014-12-23 | 2016-06-30 | Ge Healthcare Uk Limited | Methods and reagents for reverse-transcription polymerase chain reaction |
| CN114317693A (en) * | 2021-12-31 | 2022-04-12 | 中国疾病预防控制中心职业卫生与中毒控制所 | Human 5S ribosome DNA copy number detection kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2011023131A1 (en) | Composite amplification kits of 20 short tandem repeats | |
| CN111020031A (en) | Method for detecting tumor gene mutation by combining sequence specific blocker with specific PCR (polymerase chain reaction) program | |
| CN106011230A (en) | Primer composition for detecting fragmentized DNA target area and application thereof | |
| CN114317693A (en) | Human 5S ribosome DNA copy number detection kit and detection method | |
| CN112592972B (en) | Early screening method and kit for diffuse toxic goiter susceptibility genes | |
| CN116218998A (en) | Nucleic acid reagent, kit and multiplex fluorescence quantitative PCR detection method for detecting copy number of human 5S ribosomal DNA | |
| CN113637799B (en) | RPA detection method for chrysanthemum B virus | |
| CN113862343A (en) | Human telomere length detection kit and detection method for non-diagnosis purpose | |
| CN114032293A (en) | Quantitative detection method and application of nitrifying bacillus bacteria in sludge | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers | |
| CN114317692A (en) | Human 45S ribosome DNA copy number detection kit and detection method | |
| CN111118223A (en) | Method for detecting nucleic acid in sample by isothermal amplification technology and kit thereof | |
| CN110951857A (en) | Digital PCR-based noninvasive prenatal detection method and kit for trisomy 21, 18 and 13 syndromes of fetus | |
| CN116555402B (en) | Telomere detection kit and telomere length detection method for non-disease diagnosis purpose | |
| CN106676163B (en) | Primer and method for detecting pichia pastoris cell DNA | |
| CN116479105A (en) | Nucleic acid reagent, kit and multiplex fluorescence quantitative PCR detection method for human mitochondrial DNA copy number detection | |
| CN110042165B (en) | Macaque ABO blood type genotyping method | |
| CN114480615B (en) | Primer group and kit for detecting HLA-B5101 alleles | |
| CN118207338B (en) | Multiple hypersensitive somatic mutation detection method based on nucleic acid mass spectrum | |
| CN112831558B (en) | Early screening method and kit for Crohn disease susceptibility genes | |
| CN114107569B (en) | Primer, probe and kit for rapidly identifying vaccinia virus | |
| CN117904263A (en) | Primer pair and method for specifically amplifying target gene by OTARMS system | |
| CN114164279A (en) | Primer group for screening human LncROR gene content polymorphism and detection method | |
| CN118599991A (en) | Primer, probe, kit and platform for detecting genotyping of human MTHFR | |
| CN113981058A (en) | Primer group, probe, kit and method for detecting human HLA-B8 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |