CN116217675A - HPV epitope and application thereof - Google Patents

HPV epitope and application thereof Download PDF

Info

Publication number
CN116217675A
CN116217675A CN202211609622.5A CN202211609622A CN116217675A CN 116217675 A CN116217675 A CN 116217675A CN 202211609622 A CN202211609622 A CN 202211609622A CN 116217675 A CN116217675 A CN 116217675A
Authority
CN
China
Prior art keywords
polypeptide
cell
hpv
cancer
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211609622.5A
Other languages
Chinese (zh)
Inventor
李波
黄英
张乐
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Jinuoyin Biotechnology Co ltd
Genoimmune Therapeutics Co Ltd
Original Assignee
Shenzhen Jinuoyin Biotechnology Co ltd
Genoimmune Therapeutics Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Jinuoyin Biotechnology Co ltd, Genoimmune Therapeutics Co Ltd filed Critical Shenzhen Jinuoyin Biotechnology Co ltd
Priority to CN202211609622.5A priority Critical patent/CN116217675A/en
Publication of CN116217675A publication Critical patent/CN116217675A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0635—B lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0645—Macrophages, e.g. Kuepfer cells in the liver; Monocytes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20033—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/01—DNA viruses
    • G01N2333/025—Papovaviridae, e.g. papillomavirus, polyomavirus, SV40, BK virus, JC virus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Urology & Nephrology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)

Abstract

The invention provides an HPV epitope and application thereof, wherein the application of a first amino acid of the HPV epitope in mediating the combination of the HPV epitope and HLA-A 02:01 is disclosed, and the HPV epitope has an amino acid sequence shown as SED IDNO. 1. The inventor finds that the first site of the amino acid sequence shown in SEQ ID NO. 1 can influence the binding activity and immunogenicity of an HPV epitope and HLA-A 02:01 after mutation, the HPV epitope obtained by the mutation of SEQ ID NO. 1 has stronger affinity and immunogenicity than that of the SEQ ID NO. 1, and T2 cells or tumor cells loaded by the HPV epitope generate stronger killing effect, so that the medicament and vaccine prepared by the HPV epitope obtained after mutation can effectively treat various cancers, and have higher safety and smaller side effect.

Description

HPV epitope and application thereof
Technical Field
The invention relates to the field of biotechnology, in particular to an HPV epitope and application thereof, and more particularly relates to application of a first amino acid of the HPV epitope, a method for changing binding activity of the HPV epitope and HLA-A 02:01, application of a reagent in preparation of a kit, application of equipment in preparation of a system, application of an isolated polypeptide, a nucleic acid molecule, an expression vector, an antigen presenting cell, an immune effector cell, application of the reagent in preparation of the kit, application of the kit, the isolated peptide or the expression vector or the antigen presenting cell or the immune cell in preparation of a medicament, the medicament, a vaccine and a diagnostic system.
Background
Human Papillomaviruses (HPV) belong to the genus papilloma vacuole virus a of the family papovaviridae, are spherical DNA viruses, and can cause squamous epithelial proliferation of the human skin mucosa. Different types of HPV can cause different types of infections including visible genital warts and non-visible cervical, vaginal, vulvar, urethral, penile, anal warts, as well as common skin warts. Persistent infection with certain HPV types increases the risk of cervical, vaginal, vulvar, penile, anal and laryngeal cancers, with HPV 16 and HPV 18 being able to cause 70% of cervical and precancerous lesions. Cervical cancer is the fourth most common cancer in women worldwide, and infections are causative agents of almost all invasive cervical cancer and part of the anogenital malignancies and oral cancers. Taking cervical cancer as an example, persistent infection of human papillomavirus is a main causative factor of cervical cancer, and currently has developed into the fourth most common female cancer worldwide, and the second largest female secondary to breast cancer in China has a very serious disease burden.
Cancer immunotherapy is achieved by screening for specific antigens of cancer and then injecting (polypeptide vaccine) or synthesizing antigens (nucleic acid vaccine) in vivo to make the organism produce specific immune cells to attack cancer cells, or producing immune cells capable of targeting and recognizing specific antigens in vitro and then injecting (cell preparation) the immune cells to attack cancer cells.
Because of the high correlation between HPV infection and cervical cancer, polypeptides on HPV viral sequences have the potential to become specific antigen targets. The key to measuring whether a polypeptide is an effective target is whether the polypeptide is naturally presented on the surface of the target cell and stimulates T cell activation, proliferation and killing of the target cell. Previous studies have shown that there are few effective targets on HPV viral sequences, and that this part of targets are not sufficiently immunogenic in experiments and still present challenges in clinical applications. Therefore, the wild type HPV virus peptide is subjected to amino acid point substitution, so that the wild type HPV virus peptide has stronger immunological function, is more suitable for immunotherapy, and becomes an effective scheme. At present, the influence of different mutation modes on different HPV epitopes still needs to be further explored.
Disclosure of Invention
The present invention has been completed based on the following findings by the inventors: HPV therapeutic vaccine is a research hot spot in the field of immunotherapy, wherein obtaining effective HPV virus epitope is extremely critical, the inventor obtains mutated HPV epitope by determining anchor position of HPV epitope and analyzing preferential amino acid of anchor position, wherein the first amino acid of SEQ ID NO. 1 is found to play a role in the binding process of HPV epitope and HLA-A.02:01, thus, mutated HPV epitope is designed, the mutated HPV epitope is detected by utilizing a bioinformatic analysis flow and a large number of experiments, the experimental result proves that the mutated HPV epitope has stronger immunogenicity, and the specific T cell stimulated and induced by the epitope can be used for stronger targeting and killing target cell or tumor cell loaded with wild type epitope, so that the protective value exists.
Thus, in a first aspect of the invention, the invention proposes the use of amino acid 1 of an HPV epitope in mediating binding of the HPV epitope to HLA-A x 02:01. According to the embodiment of the invention, the HPV epitope has an amino acid sequence shown as SED ID NO. 1. After the HPV epitope shown in SEQ ID NO. 1 is subjected to preferential amino acid analysis and subsequent experimental determination in a specific mode, the inventor finds that the 1 st site of the amino acid sequence of the HPV epitope can influence the combination of the HPV epitope and HLA-A 02:01 and influence the immunogenicity of the HPV epitope, and the site has higher application value in preparing medicaments and vaccines for HPV related diseases.
In a second aspect of the invention, the invention provides a method of altering the binding activity of an HPV epitope to HLA-A 02:01. According to an embodiment of the invention, the method comprises contacting the isolated HPV epitope peptide or a nucleic acid encoding the HPV epitope peptide with an agent for mutating the first amino acid of the HPV epitope. As described above, after the preferential amino acid analysis and subsequent experimental determination of the HPV epitope shown in SEQ ID NO. 1, the inventors found that the 1 st position of the amino acid sequence of the HPV epitope affects the combination of the HPV epitope and HLA-A 02:01 and affects the immunogenicity of the HPV epitope, and the site has higher value in preparing medicaments and vaccines for HPV related diseases, so that the 1 st amino acid or the nucleic acid sequence encoding the 1 st amino acid of the HPV epitope is mutated by adopting a reagent to obtain target amino acid or nucleic acid. Wherein the agent is not particularly limited, any agent that can mutate an amino acid or nucleic acid may be used, such as an agent based on at least one of gene editing methods including a gene selected from the group consisting of single base gene editing, zinc finger nucleases, transcription activation-like effector nucleases, CRISPR/Cas9, and CRISPR/Cas9 in combination with iPSC and AAV vector technologies.
In a third aspect of the invention, the invention proposes the use of a reagent in the preparation of a kit. According to an embodiment of the invention, the kit is used for altering the binding activity of HPV epitopes to HLA-A 02:01 and the agent is used for mutating the first amino acid of HPV epitopes. As described above, after the preferential amino acid analysis and subsequent experimental determination of the HPV epitope shown in SEQ ID NO. 1, the inventors found that the 1 st position of the amino acid sequence of the HPV epitope affects the combination of the HPV epitope and HLA-A 02:01 and affects the immunogenicity of the HPV epitope, and the site has higher value in preparing medicaments and vaccines for HPV related diseases, so that the 1 st amino acid or the nucleic acid sequence encoding the 1 st amino acid of the HPV epitope is mutated by adopting a reagent to obtain the target amino acid. The kit provided by the embodiment of the invention can effectively mutate amino acid or nucleic acid so as to obtain target amino acid or nucleic acid. Wherein the agent is not particularly limited, any agent that can mutate an amino acid or nucleic acid may be used, such as an agent based on at least one of the gene editing methods including a gene selected from the group consisting of single base gene editing, zinc finger nucleases, transcription activation-like effector nucleases, CRISPR/Cas9 and CRISPR/Cas9 in combination with iPSC and AAV vector technologies.
In a fourth aspect of the invention, the invention proposes the use of an apparatus in a manufacturing system. According to an embodiment of the invention, the system is used for altering the binding activity of HPV epitopes to HLA-A 02:01 and the device is used for mutating the first amino acid of HPV epitopes. The system according to the embodiment of the invention can effectively change the binding activity of HPV epitope by mutating amino acid.
In a fifth aspect of the invention, the invention provides an isolated polypeptide. According to an embodiment of the invention, the isolated polypeptide has a mutation at amino acid position 1 compared to the amino acid sequence shown in SED ID NO. 1. According to the specific embodiment of the invention, the 2 nd and 10 th amino acids of the obtained HPV epitope are anchoring positions of HLA, the inventor determines a new replacement anchor point based on HLA-A.02:01 typing sequence characteristic research, namely the 1 st amino acid in the HPV epitope shown in SEQ ID NO. 1, and after the 1 st amino acid in the amino acid sequence shown in SEQ ID NO. 1 is substituted, the obtained polypeptide still has the same or related immunogenicity and potential therapeutic effects, namely can be presented by HLA-A.02:01 molecules and can be recognized by CTL cells or TIL cells, and can be presented by presenting cells expressing HLA-A.02:01 molecules to CTL or TIL cells to activate specific T cell immunity, thus forming a physiological target of immune response of HPV positive tumors, and has important value for preventing and treating HPV related diseases by high sensitivity and specificity detection.
In a sixth aspect of the invention, the invention provides a nucleic acid molecule. According to an embodiment of the invention, the nucleic acid molecule encodes an isolated polypeptide as described previously. The isolated polypeptide obtained by encoding the nucleic acid molecules according to the embodiment of the invention can be presented by HLA-A 02:01 molecules, and can be recognized by CTL or TIL cells, namely, the antigen presenting cells expressing the HLA-A 02:01 molecules are presented to the CTL or the TIL cells to activate specific T cell immunity, so that the antigen presenting cell forms a physiological target of immune response of HPV positive tumors, and the antigen presenting cell has important value for preventing and treating HPV related diseases.
In a seventh aspect of the invention, the invention provides an expression vector. According to an embodiment of the invention, the nucleic acid carrying the expression of the isolated polypeptide as described above or the nucleic acid molecule as described above. The expression vector may include optional control sequences operably linked to the nucleic acid or nucleic acid molecule. Wherein the control sequences are one or more control sequences that direct expression of the polypeptide in a host. The expression vector provided by the embodiment of the invention can efficiently express the isolated polypeptide in a proper host cell, and can be further effectively used for specific treatment or prevention of tumors, particularly tumors which simultaneously express HLA-A 02:01 molecules and the wild type HPV epitope or the isolated polypeptide.
In an eighth aspect of the invention, the invention provides a recombinant cell. According to embodiments of the invention, the nucleic acid molecules, expression vectors or isolated polypeptides described previously are carried. The recombinant cells are obtained by transfecting or transforming the expression vector. According to embodiments of the present invention, the host cell may efficiently express the above isolated polypeptide in large amounts under suitable conditions for obtaining the isolated polypeptide in large amounts, and the recombinant cell may be useful for specific treatment or prevention of tumors, in particular tumors expressing both HLA-A 02:01 molecules and the above wild-type HPV epitope or isolated polypeptide.
In a ninth aspect of the invention, the invention provides an isolated antigen presenting cell. According to embodiments of the invention, the cells may present the isolated polypeptides described previously. According to the embodiment of the invention, the antigen presenting cells presenting the isolated polypeptide can effectively cause immune response of a patient against tumor specific antigen-the isolated polypeptide so as to activate CTL specific killing function, and the antigen presenting cells provided by the embodiment of the invention have the functions of presenting the wild type HPV epitope or the isolated polypeptide so as to treat the tumor expressing the isolated polypeptide, and the treatment effect is remarkable and the safety is high.
In a tenth aspect of the invention, the invention provides an isolated immune effector cell. According to embodiments of the invention, the immune effector cell may recognize the isolated polypeptide described above or recognize an antigen presenting cell that presents the isolated polypeptide described above on the cell surface. According to an embodiment of the present invention, the immune effector cells may specifically kill tumor cells co-expressing HLA-A 02:01 molecules and the above-mentioned wild HPV epitopes or isolated polypeptides.
In an eleventh aspect of the invention, the invention provides the use of a reagent for detecting an isolated polypeptide as described hereinbefore in the preparation of a kit. According to an embodiment of the invention, the kit is used for diagnosis of HPV or detection of the therapeutic effect of HPV. The reagent can accurately detect the separated polypeptide, such as detecting whether the separated polypeptide is contained in a biological sample or not, and quantitatively detect the separated polypeptide in the biological sample, and the kit containing the reagent can accurately diagnose whether an individual from which the biological sample is derived is infected by HPV, further, whether the individual is an HPV high risk individual due to the high expression of the separated polypeptide in the tissue infected by HPV. Similarly, the detection of HPV-infected individuals during treatment using the kit allows monitoring of changes in HPV content during treatment, such as exacerbation, slowing or healing. Wherein the kind of the reagent is not particularly limited, and any protein or nucleic acid that can detect the isolated polypeptide or the nucleic acid sequence encoding the isolated polypeptide may be used, such as a corresponding antibody, nucleic acid molecule, primer, etc.
In a twelfth aspect of the invention, the invention provides a kit. According to an embodiment of the invention, reagents suitable for detecting the aforementioned isolated polypeptides are included. The reagent can accurately detect the separated polypeptide, such as detecting whether the biological sample contains the separated polypeptide, and the kit containing the reagent can accurately diagnose whether an individual from which the biological sample is infected by HPV, and further, whether the individual is an HPV high risk individual because the separated polypeptide is highly expressed in HPV infected tissues. Similarly, the detection of HPV-infected individuals during treatment using the kit allows monitoring of changes in HPV content during treatment, such as exacerbation, slowing or healing. The type of the reagent is not particularly limited, and any protein or nucleic acid that can detect the isolated polypeptide or a nucleic acid sequence encoding the isolated polypeptide may be used, such as a corresponding antibody, primer, etc., and may further include an auxiliary detecting substance such as a coating solution.
In a thirteenth aspect of the invention, the invention provides the use of an isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen presenting cell or immune effector cell as described hereinbefore in the manufacture of a medicament. According to an embodiment of the invention, the medicament is for the treatment or prevention of HPV related diseases. As mentioned above, the isolated polypeptide, the nucleic acid molecule encoding the isolated polypeptide, the expression vector, the recombinant cell, the antigen presenting cell or the immune effector cell may be used effectively for the specific treatment or prevention of a tumor, in particular a tumor expressing both the HLA-A 02:01 molecule and the isolated polypeptide, and therefore, a medicament comprising part or all of the above may also have a significant effect for the treatment or prevention of a tumor expressing the HLA-A 02:01 molecule and the isolated polypeptide, with a higher safety and less side effects.
In a fourteenth aspect of the invention, the invention provides a medicament. According to an embodiment of the invention, the isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen presenting cell or immune effector cell as described above is comprised. As mentioned above, the isolated polypeptide, the nucleic acid molecule encoding the isolated polypeptide, the expression vector, the recombinant cell, the antigen presenting cell or the immune effector cell may be used effectively for the specific treatment or prevention of a tumor, in particular a tumor expressing both the HLA-A 02:01 molecule and the isolated polypeptide, and therefore, a medicament comprising part or all of the above may also have a significant effect for the treatment or prevention of a tumor expressing the HLA-A 02:01 molecule and the isolated polypeptide, with a higher safety and less side effects.
In a fifteenth aspect of the invention, the invention provides a vaccine. According to an embodiment of the invention, an isolated polypeptide, nucleic acid molecule, expression vector or antigen presenting cell as described previously is comprised. As described above, the nucleic acid molecule, expression vector or recombinant cell of the embodiments of the present invention expresses the isolated polypeptide described above under suitable conditions, and the antigen presenting cell can express the isolated polypeptide, which when combined with HLA-A 02:01 molecule is presented by the antigen presenting cell for recognition by CTL or TIL cells, i.e. by antigen presenting cell expressing HLA-A 02:01 molecule for presentation to CTL or TIL cells to activate specific T cell immunity. Therefore, the vaccine provided by the embodiment of the invention has obvious effect of treating or preventing tumors expressing HLA-A-02:01 molecules and the isolated polypeptide, and has higher safety and smaller side effect.
In a sixteenth aspect of the invention, the invention provides a method of preventing or treating a disease associated with HPV. According to embodiments of the invention, the subject is administered an isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen presenting cell, immune effector cell, drug or vaccine as described previously. As described above, the method for preventing or treating the tumor expressing HLA-A 02:01 and the isolated polypeptide according to the embodiments of the present invention comprises administering an effective amount of any of the above-described related substances such as the isolated polypeptide.
In a seventeenth aspect of the invention, the invention provides the use of the isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell as described above for the preparation of a kit. According to an embodiment of the invention, the kit is for detecting HLA-A x 02:01. According to the embodiment of the invention, the isolated polypeptide and the substance capable of indirectly obtaining the isolated polypeptide can be combined with HLA, so that the substance can be used for preparing a kit for effectively detecting HLA-A by 02:01, the kit can accurately and qualitatively detect the HLA-A by 02:01 of a biological sample, and further, the HLA-A by 02:01 level in an individual can be detected to judge the state of the individual, for example, the HLA-A by 02:01 level of the individual is obviously lower than or higher than the normal level.
In an eighteenth aspect of the present invention, the present invention provides a kit for detecting HLA-A x 02:01. According to an embodiment of the invention, an isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell as described in the first paragraph are included. As described above, both the isolated polypeptide and the substance from which the isolated polypeptide is indirectly obtained can bind to HLA-A 02:01, and therefore, kits comprising the same can accurately and qualitatively detect HLA-A 02:01 in biological samples, and further, can detect HLA-A 02:01 levels in individuals to determine the status of the individual, such as that the individual has significantly lower or higher HLA-A 02:01 levels than normal. .
In a nineteenth aspect of the invention, the invention provides a method of diagnosing whether a subject contains HPV in vivo. According to an embodiment of the invention, a step is included of detecting whether a biological sample derived from a subject carries the isolated polypeptide, nucleic acid molecule described previously. As described above, the isolated polypeptides and nucleic acid molecules are present in HPV-infected individuals, and thus, by detecting whether a biological sample derived from a subject carries the substance, it is possible to effectively diagnose whether HPV is contained in the subject, and of course, it is also possible to quantitatively detect HPV content in the subject.
In a twentieth aspect of the present invention, a diagnostic system is presented. According to an embodiment of the invention, it comprises: a polypeptide detection device for detecting whether a biological sample derived from a subject carries the isolated polypeptide described above; and a result determination device, coupled to the polypeptide detection device, for determining whether the patient has a tumor based on whether the biological sample carries the isolated polypeptide. As described above, the isolated polypeptide is present in a subject infected with HPV, and the diagnostic system according to the embodiment of the present invention can detect whether the biological sample carries the isolated polypeptide, and thus, the diagnostic system can accurately determine whether the subject from which the biological sample is derived is a tumor patient.
It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.
Drawings
FIG. 1 shows a block diagram of a diagnostic system according to an embodiment of the invention;
FIG. 2 shows an amino acid preference profile of HLA-A02:01 typed binding epitope of an embodiment of the invention;
FIG. 3 is a graph showing the results of in vitro immunogenicity ELISPOTs assays for isolated polypeptides and other polypeptides according to embodiments of the invention;
FIG. 4 shows a graph of the detection results of CTL-specific killing of target cells presenting wild-type HPV epitopes of the examples of the present invention; and
FIG. 5 shows graphs of the results of detection of tumor growth inhibition by isolated polypeptides and wild-type HPV epitopes of an embodiment of the invention.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below by referring to the drawings are illustrative and intended to explain the present invention and should not be construed as limiting the invention.
Furthermore, the terms "first," "second," and the like, are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include at least one such feature. In the description of the present invention, the meaning of "plurality" means at least two, for example, two, three, etc., unless specifically defined otherwise.
The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and are understood to encompass values approaching those ranges or values. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.
In order that the invention may be more readily understood, certain technical and scientific terms are defined below. Unless clearly defined otherwise herein in this document, all other technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The abbreviations for amino acid residues are standard 3-letter and/or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids.
As used herein, an "epitope," also known as an antigenic determinant, refers to a specific structural site of an antigenic molecule recognized by a specific effector molecule or T-and B-lymphocytes in an immune response, thereby inducing cellular and humoral immunity, and producing an immune effect. For example, the HPV epitope in the present application is present in HPV and is capable of binding to the HLA-A 02:01 molecule.
Herein, "anchor location" refers to the structure of an HPV epitope received by an HLA-A-02:01 molecule when the HPV epitope is bound to the HLA-A-02:01 molecule, and is an antigen-binding groove at the distal end of the molecule, and the primary structure of the native HPV epitope is analyzed to find that two or more specific sites are present for binding to the HLA-A-02:01 molecule antigen-binding groove, referred to as anchor locations. The amino acid residue at this position is called an anchor residue (anchor).
As used herein, "antigen presenting cells" refers to a class of immune cells that are capable of uptake, processing, and presentation of processed antigens to T cells. APCs mainly include mononuclear-phagocytes, dendritic cells, B cells, langerhans cells, target cells of viral infection of tumor cells, and the like.
As used herein, "immune effector cells" refer to immune cells that are involved in the clearance of foreign antigens and function as an effector in an immune response.
Herein, "single base gene editing" refers to a gene editing technique capable of causing single base changes on the genome, the basic principle being that cytosine deaminase (apodec) or adenosine deaminase is fused to existing Cas9n (D10A), the single base of 4-7 positions of a target point far from PAM end is modified depending on CRISPR principle.
Herein, "zinc finger ribonuclease (zinc finger nuclease, ZFN)" is composed of a DNA recognition domain consisting of a series of Cys2-his2 zinc finger proteins in tandem, each of which recognizes and binds a specific triplet base, and a non-specific endonuclease (fokl) fused to a domain containing a zinc finger, for example, the most classical zinc finger nuclease naturally cleaves a specific sequence; the excised DNA can be subjected to excision repair by deleting the single stranded portion at the excision site and then re-joining the single stranded portions together, and deletion of specific fragments on the chromosome can be accomplished by this method, thereby achieving the task of constructing mutants or completing the treatment.
Herein, "transcription activator-like effector nucleases (TAL) are enzymes that can targeted modify specific DNA sequences by means of TAL effectors, a natural protein secreted by plant bacteria, to recognize specific DNA base pairs; TAL effectors can be designed to recognize and bind all DNA sequences of interest, and adding a nuclease to the TAL effector generates TALENs; TAL effector nucleases can bind to DNA and cleave DNA strands at specific sites, thereby introducing new genetic material.
The CRISPR/Cas9 system is widely present in prokaryotic genes and is an acquired immune defense mechanism by bacteria and archaea evolving to cope with continuous attack by viruses and plasmids. In these organisms, exogenous genetic material from phage is obtained and integrated into the CRISPR site; these sequence-specific fragments are transcribed into short CRISPR RNA (CRISPR-extended RNA), the crRNA binds to the tracrRNA (trans-activating RNA) by base pairing to form double stranded RNA, and the tracrRNA/crRNA complex then directs Cas9 protein to cleave the double stranded DNA for gene editing.
Human Induced Pluripotent Stem Cells (iPSCs), which can be induced into almost any type of cell, combine iPSCs with CRISPR/Cas9 gene editing technology, repair pathogenic sites in patient-derived iPSCs, and introduce mutations that lead to disease into healthy WT iPSCs.
Adeno-associated virus (AAV) has low immunogenicity, is regarded as the most promising gene therapy vector due to high safety and stable long-acting expression, and can realize high-efficiency gene editing by using AAV to deliver a CRISPR/Cas9 system.
In one aspect, the invention provides the use of amino acid 1 of an HPV epitope in mediating binding of the HPV epitope to HLA-A 02:01. According to some embodiments of the invention, the HPV epitope has the amino acid sequence shown in SED ID NO. 1. The anchors proposed in the prior art are positioned at the 2 nd and the last positions of HPV epitopes, and in the application, the inventor discovers that the 1 st amino acid mutation in SEQ ID NO. 1 can change the binding activity and immunogenicity of the HPV epitopes and HLA-A 02:01, and can effectively treat or prevent HPV related diseases.
In another aspect, the invention provides a method of altering the binding activity of an HPV epitope to HLA-A 02:01. According to some embodiments of the invention, the method comprises contacting the isolated HPV epitope peptide or the encoded HPV epitope peptide with an agent for mutating the first amino acid of the HPV epitope. As described above, after the preferential amino acid analysis and subsequent experimental determination of the HPV epitope shown in SEQ ID NO. 1, the inventors found that the 1 st position of the amino acid sequence of the HPV epitope affects the combination of the HPV epitope and HLA-A 02:01 and affects the immunogenicity of the HPV epitope, and the site has higher value in preparing medicaments and vaccines for HPV related diseases, so that the 1 st amino acid or the nucleic acid sequence encoding the 1 st amino acid of the HPV epitope is mutated by adopting a reagent to obtain target amino acid or nucleic acid. Wherein the agent is not particularly limited, any agent that can mutate an amino acid or nucleic acid may be used, such as an agent based on at least one of gene editing methods including a gene selected from the group consisting of single base gene editing, zinc finger nucleases, transcription activation-like effector nucleases, CRISPR/Cas9, and CRISPR/Cas9 in combination with iPSC and AAV vector technologies.
According to some embodiments of the present invention, the above method for altering HPV epitope binding activity to HLA-A 02:01 may further comprise at least one of the following additional technical features:
according to some embodiments of the invention, the agent is further used to mutate amino acid 2 of HPV epitope.
According to some embodiments of the invention, the agent is further used to mutate amino acid 10 of HPV epitope.
According to some embodiments of the invention, the agent is used to mutate amino acid 1 of an HPV epitope from T to Y.
According to some embodiments of the invention, the agent is further used to mutate amino acid 2 of HPV epitope from I to L.
According to some embodiments of the invention, the HPV epitope has the amino acid sequence shown in SED ID NO. 1.
In yet another aspect, the invention provides the use of a reagent in the preparation of a kit. According to some embodiments of the invention, the kit is for altering the binding activity of HPV epitopes to HLA-A x 02:01 and the agent is for mutating amino acid 1 of HPV epitopes. It will be appreciated by those skilled in the art that mutating the amino acids of an HPV epitope can be performed directly on the protein or on a nucleic acid sequence encoding said HPV epitope, wherein the agent is not particularly limited and any agent that can mutate the protein or nucleic acid sequence to obtain the protein of interest is encompassed within the scope of the present application, such as agents based on at least one of the gene editing methods including gene editing selected from the group consisting of single base gene editing, zinc finger nucleases, transcription activation-like effector nucleases, CRISPR/Cas9 and CRISPR/Cas9 in combination with ipscs and AAV vector technologies.
In one aspect, the invention proposes the use of a device for altering the binding activity of an HPV epitope to HLA-A 02:01 in the preparation of a system for mutating amino acid 1 of an HPV epitope. The system according to the embodiment of the invention can effectively change the binding activity of HPV epitope by mutating amino acid.
According to some embodiments of the invention, the device is an ultraviolet device.
In another aspect, the invention features an isolated polypeptide having a mutation at amino acid position 1 as compared to the amino acid sequence set forth in SED ID NO. 1. According to the specific embodiment of the invention, when the obtained HPV epitope is 10 peptide, the 2 nd and 10 th amino acids of the obtained HPV epitope are anchoring positions of HLA, the inventor finds that the 1 st amino acid in the amino acid sequence shown in SEQ ID NO. 1 has important influence on the immunogenicity, and the immunogenicity and the potential therapeutic effect of the isolated polypeptide obtained after the mutation of part or all of the sites in the anchoring positions and/or the 1 st amino acid in SEQ ID NO. 1 are obviously enhanced, namely, the isolated polypeptide can be presented by HLA-A 02:01 molecules, can be recognized by CTL cells or TIL cells, and can be presented by presenting cells expressing the HLA-A 02:01 molecules to CTL or TIL cells to activate specific T cell immunity, thus forming physiological targets of immune response of HPV positive tumors, and has important value for preventing and treating HPV related diseases.
According to some embodiments of the invention, the isolated polypeptide further comprises at least one of the following additional technical features:
according to some embodiments of the invention, the polypeptide further comprises a mutation at amino acid position 2 compared to the amino acid sequence shown in SED ID NO. 1. As described above, the 2 nd site of the amino acid sequence shown in SEQ ID NO. 1 is an anchor site, and the immunogenicity and therapeutic effect of the isolated polypeptide obtained by mutating the site are improved.
According to some embodiments of the invention, the polypeptide further comprises a mutation at amino acid position 10 compared to the amino acid sequence shown in SED ID NO. 1.
The wild type HPV epitope has the following amino acid sequence:
TIHDIILECV(SEQ ID NO:1)。
according to some embodiments of the invention, the isolated polypeptide has the following mutation sites compared to the amino acid sequence shown in SED ID NO. 1: bit 1 and/or bit 2. As described above, the inventors have performed a preferential amino acid analysis on the amino acid sequence shown in SEQ ID NO. 1, which shows that the preferential amino acids at positions 1, 2 and 10 are Y, L, V, respectively, and thus have undergone mutation only on the first 2 amino acids.
According to some embodiments of the invention, the isolated polypeptide has at least one of the following mutations compared to the amino acid sequence shown in SED ID NO: 1: 1) T at position 1 is mutated to Y; and 2) I at position 2 is mutated to L.
According to some embodiments of the invention, the isolated polypeptide has the sequence of SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.
YLHDIILECV(SEQ ID NO：2)。
Prophylactic or therapeutic composition
In another aspect, the invention provides a nucleic acid molecule encoding an isolated polypeptide as described above. The isolated polypeptide obtained by encoding the nucleic acid molecules according to some specific embodiments of the present invention can be presented by HLA-A 02:01 molecules, recognized by CTL or TIL cells, and further can be presented by presenting cells expressing HLA-A 02:01 molecules to CTL or TIL cells to activate specific T cell immunity, thus forming physiological targets of immune response of HPV positive tumors, performing high-sensitivity and specific detection, and having important value for prevention and treatment of HPV-related diseases.
According to some embodiments of the invention, the nucleic acid molecule has at least one of the nucleotide sequences shown in SEQ ID NO. 3.
Nucleic acids encoding YLHDIILECV (SEQ ID NO: 2) include:
AAUCCAUAUGCUGUAUGUGAUAAA(SEQ ID NO:3)。
It should be noted that, for the nucleic acids mentioned in the present specification and claims, one skilled in the art will understand that either one or both of the complementary double strands are actually included. For convenience, in the present description and claims, although only one strand is shown in most cases, the other strand complementary thereto is actually disclosed. In addition, the gene sequences in this application include either DNA forms or RNA forms, with one being disclosed, meaning the other is also disclosed.
In another aspect, the invention provides an expression vector carrying a nucleic acid expressing an isolated polypeptide as described above or a nucleic acid molecule as described above. The expression vector may include optional control sequences operably linked to the nucleic acid molecule. Wherein the control sequences are one or more control sequences that direct expression of the polypeptide in a host. The expression vectors according to some embodiments of the present invention may be used to efficiently express the isolated polypeptides in suitable host cells and thus may be useful in the specific treatment or prevention of tumors, in particular tumors expressing both HLA-A 02:01 molecules and the above-mentioned wild-type HPV epitopes or isolated polypeptides.
"operably linked" herein refers to the linkage of a foreign gene to a vector such that control elements within the vector, such as transcription control sequences and translation control sequences, and the like, are capable of performing their intended functions of regulating transcription and translation of the foreign gene. In the case of attaching the above-mentioned nucleic acid molecule to a vector, the nucleic acid molecule may be directly or indirectly attached to a control element on the vector, as long as the control element is capable of controlling translation, expression, etc. of the nucleic acid molecule. Of course, these control elements may be directly from the carrier itself or may be exogenous, i.e. not from the carrier itself. It will be appreciated by those skilled in the art that the nucleic acid molecules encoding the antibodies or antigen binding fragments may be inserted separately into different vectors, typically into the same vector.
The type of the expression vector is not particularly limited as long as the aforementioned nucleic acid can be efficiently expressed in the recipient cell, and the expression vector includes eukaryotic expression vectors, prokaryotic expression vectors, viral expression vectors, etc., and the viral expression vectors include retrovirus vectors, lentivirus vectors, and/or adenovirus-associated virus vectors.
In yet another aspect, the invention provides a recombinant cell carrying a nucleic acid molecule or expression vector as described above, or expressing an isolated polypeptide as described above. The recombinant cells are obtained by transfecting or transforming the expression vector. Transformation or transfection may be performed by electrotransfection, viral transfection or competent cell transformation. The manner of transfection or transformation to be used is determined by the nature of the host cell and the nature of the nucleic acid construct or expression vector to be transfected, provided that efficient expression of the aforementioned polypeptides in the host cell can be achieved without significantly affecting the good cellular state of the host cell. According to some embodiments of the present invention, the host cell may efficiently express the above isolated polypeptide under suitable conditions, and the recombinant cell may be effective for specific treatment or prevention of tumors, in particular tumors expressing both HLA-A 02:01 molecules and the above wild-type HPV epitope or isolated polypeptide.
According to some embodiments of the invention, the recombinant cell may further comprise at least one of the following additional technical features:
it should be noted that the recombinant cells of the present invention are not particularly limited, and may be prokaryotic cells, eukaryotic cells, or phage. The prokaryotic cell can be escherichia coli, bacillus subtilis, streptomycete or proteus mirabilis and the like. The eukaryotic cells comprise fungi such as pichia pastoris, saccharomyces cerevisiae, schizosaccharomyces, trichoderma and the like, insect cells such as armyworm and the like, plant cells such as tobacco and the like, and mammalian cells such as BHK cells, CHO cells, COS cells, myeloma cells and the like. In some embodiments, the recombinant cells of the invention are preferably mammalian cells, including BHK cells, CHO cells, NSO cells, or COS cells, and do not include animal germ cells, fertilized eggs, or embryonic stem cells.
According to some embodiments of the invention, the cell is a eukaryotic cell.
According to some embodiments of the invention, the eukaryotic cell is a mammalian cell. According to some embodiments of the invention, the recombinant antibody is expressed more efficiently in eukaryotic cells, such as mammalian cells, when the recombinant cells are used to efficiently express the isolated peptide.
The term "suitable conditions" as used herein refers to conditions suitable for expression of the isolated polypeptides described herein. Those skilled in the art will readily appreciate that conditions suitable for expression of the isolated polypeptide include, but are not limited to, suitable transformation or transfection means, suitable transformation or transfection conditions, healthy host cell status, suitable host cell density, suitable cell culture environment, suitable cell culture time. The "suitable conditions" are not particularly limited, and those skilled in the art can optimize the conditions for optimal expression of the polypeptide according to the specific environment of the laboratory.
In yet another aspect, the invention provides an isolated antigen presenting cell that presents an isolated polypeptide as described above. According to the embodiment of the invention, the antigen presenting cells presenting the isolated polypeptide can effectively cause immune response of patients against tumor specific antigens-the isolated polypeptide so as to activate CTL specific killing function, and the antigen presenting cells provided by the embodiment of the invention have obvious effect of treating tumors expressing the isolated polypeptide, and have obvious treatment effect and high safety.
According to some embodiments of the invention, the antigen presenting cells are obtained by at least one of: contacting a cell having antigen presenting ability with the polypeptide; introducing the nucleic acid or expression vector described above into the cell having antigen presenting ability.
According to some embodiments of the invention, the antigen presenting cell is a dendritic cell, B cell or a mononuclear-phagocyte.
In another aspect, the invention provides an immune effector cell. According to embodiments of the invention, the immune effector cell may recognize the aforementioned isolated polypeptide or recognize an antigen presenting cell presenting the aforementioned polypeptide or the aforementioned HPV epitope or isolated polypeptide on the cell surface. According to an embodiment of the invention, the immune effector cells may specifically kill tumor cells co-expressing HLA-A 02:01 molecules and the wild type HPV epitope or the isolated polypeptide described above.
According to some embodiments of the invention, the immune effector cell is obtained by: the antigen presenting cells described above are contacted with cells having an immunocompetent capacity.
According to some embodiments of the invention, the cells with immunocompetence are T cells, preferably CD8 + T cells. The inventors have found that by contacting antigen presenting cells presenting the isolated polypeptide described above with cells having an immunocompetent capacity, antigen presenting cells can activate non-activated cells having an immunocompetent capacity, present antigen-the polypeptide described above, and thereby activate cells having an immunocompetent capacity, and that immune effector cells having an effect of specifically killing target cells presenting the antigen-the isolated polypeptide are produced in large amounts. CD8 + T cells are more capable of receiving antigen presenting cell activation and obtain CD8 + The specific killing of T cells presents antigen-the effect of the isolated peptide/HPV epitope target cells is greater.
In yet another aspect, the invention provides a medicament. According to an embodiment of the invention, the isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen presenting cell or immune effector cell as described above is comprised. As mentioned above, the isolated polypeptide, the nucleic acid molecule encoding the wild-type HPV epitope or the isolated polypeptide, the expression vector, the recombinant cell, the antigen presenting cell or the immune effector cell may be useful for the specific treatment or prevention of a tumor, in particular a tumor expressing both the HLA-A 02:01 molecule and the isolated polypeptide, and therefore, a medicament comprising part or all of the above may have a significant effect for the treatment or prevention of a tumor expressing both the HLA-A 02:01 molecule and the isolated polypeptide, with a higher safety and less side effects.
The medicament provided according to some embodiments of the present invention may further comprise a pharmaceutically acceptable carrier and an effective amount of the active ingredients of the above substances.
As used herein, the term "effective amount" or "effective dose" refers to an amount that is functional or active in and acceptable to a human and/or animal.
As used herein, a "pharmaceutically acceptable" ingredient is a substance that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic response), commensurate with a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" includes (but is not limited to): water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should be compatible with the mode of administration and will be well known to those of ordinary skill in the art.
The pharmaceutical compositions of the present invention contain a safe and effective amount of the active ingredients of the present invention and a pharmaceutically acceptable carrier. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. Generally, the pharmaceutical preparation should be matched with the administration mode, wherein the administration mode can be oral administration, nasal administration, intradermal administration, subcutaneous administration, intramuscular administration, intravenous administration or intraperitoneal administration, and the dosage form of the medicine is injection, oral preparation (tablet, capsule, oral liquid), transdermal agent or sustained release agent. For example, by using physiological saline or an aqueous solution containing glucose and other auxiliary agents by conventional methods. The medicament is preferably manufactured under aseptic conditions. The isolated polypeptide may be administered by intravenous infusion or injection or intramuscular or subcutaneous injection.
The effective amount of the active ingredient described herein may vary depending upon the mode of administration, the severity of the condition being treated, and the like. The selection of the preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the active ingredient such as bioavailability, metabolism, half-life etc.; the severity of the disease to be treated in the patient, the weight of the patient, the immune status of the patient, the route of administration, etc. For example, separate doses may be administered several times per day, or the dose may be proportionally reduced, as dictated by the urgent need for the treatment of the condition.
Meanwhile, the inventor finds that cervical cancer, vulva cancer, vagina cancer, anus cancer, penis cancer, head and neck cancer, cervical intraepithelial neoplasia, vulva intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penis intraepithelial neoplasia, oral cancer, laryngeal cancer, esophagus cancer, intranasal cancer or tonsil cancer, especially cervical cancer tissue-specifically expresses the isolated polypeptide or HPV epitope, and further the effectiveness of the drug treatment is further improved when the tumor is the tumor.
In yet another aspect, the invention provides a vaccine. According to an embodiment of the invention, an isolated polypeptide, nucleic acid molecule, expression vector or antigen presenting cell as described previously is comprised. As described above, the nucleic acid molecule, expression vector or recombinant cell of the embodiments of the present invention expresses the isolated polypeptide described above under suitable conditions, and the antigen presenting cell can express the isolated polypeptide, which when bound to the HLA-A 02:01 molecule is presented by the antigen presenting cell, so that it is recognized by the CTL or TIL cell, i.e. the antigen presenting cell expressing the HLA-A 02:01 molecule is presented to the CTL or TIL cell to activate specific T cell immunity. Therefore, the vaccine provided by the embodiment of the invention has obvious effect of treating or preventing tumors expressing HLA-A-02:01 molecules and the isolated polypeptide, and has higher safety and smaller side effect. Meanwhile, the inventor finds that the vaccine can effectively treat or prevent cervical cancer, vulva cancer, vagina cancer, anus cancer, penis cancer, head and neck cancer, cervical intraepithelial neoplasia, vulva intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penis intraepithelial neoplasia, oral cancer, laryngeal cancer, esophagus cancer, intranasal cancer or tonsil cancer, and especially cervical cancer tissue-specific high-expression of the isolated polypeptide, HPV epitope or isolated polypeptide, so that when the tumor is the cervical cancer, the effectiveness of the drug treatment is further improved.
According to some embodiments of the invention, the vaccine is in a form suitable for administration by inhalation or injection.
According to some embodiments of the invention, the vaccine further comprises at least one adjuvant.
Use of the same
In one aspect, the invention provides the use of a reagent for detecting an isolated polypeptide as hereinbefore described in the preparation of a kit for diagnosis of HPV or detection of the therapeutic effect of HPV. The reagent can accurately detect the separated polypeptide, such as detecting whether the biological sample contains the separated polypeptide, and the kit containing the reagent can accurately diagnose whether an individual from which the biological sample is infected by HPV, and further, whether the individual is an HPV high risk individual because the separated polypeptide is highly expressed in HPV infected tissues. Similarly, the detection of HPV infected individuals during treatment using the kit can detect changes in HPV during treatment, such as exacerbation, slowing or healing.
In another aspect, the invention provides the use of the isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen presenting cell or immune effector cell described above in the preparation of a medicament. According to an embodiment of the invention, the medicament is for the treatment or prevention of HPV-induced related diseases. As mentioned above, the isolated polypeptide, the nucleic acid molecule encoding the isolated polypeptide, the expression vector, the recombinant cell, the antigen presenting cell or the immune effector cell may be used effectively for the specific treatment or prevention of a tumor, in particular a tumor expressing both the HLA-A 02:01 molecule and the isolated polypeptide, and therefore, a medicament comprising part or all of the above may also have a significant effect for the treatment or prevention of a tumor expressing the HLA-A 02:01 molecule and the isolated polypeptide, with a higher safety and less side effects.
According to some embodiments of the invention, the HPV-associated disease comprises at least one of the following: cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, intranasal cancer, and tonsillar cancer. The inventor finds that the medicament can effectively treat or prevent the diseases, especially cervical cancer tissue-specific high-expression of the separated polypeptide, HPV epitope or separated polypeptide, and further improves the effectiveness of the medicament treatment when the diseases are the cervical cancer.
In one aspect, the invention provides the use of an isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen presenting cell, immune effector cell or drug as described above in the preparation of a composition. According to an embodiment of the invention, the composition is for use in the treatment or prevention of HPV-related diseases. As mentioned before, the isolated polypeptide, the nucleic acid molecule encoding the wild-type HPV epitope or the isolated polypeptide or encoding the isolated polypeptide, the expression vector, the recombinant cell, the antigen presenting cell or the immune effector cell may be useful for the specific treatment or prevention of a tumor, in particular a tumor expressing both the HLA-A 02:01 molecule and the isolated polypeptide, and therefore, a pharmaceutical composition comprising part or all of the above may have a significant effect on the treatment or prevention of a tumor expressing both the HLA-A 02:01 molecule and the isolated polypeptide, with a higher safety and less side effects. The composition is a food or pharmaceutical composition.
In a further aspect, the invention proposes the use of the isolated polypeptide, nucleic acid molecule, expression vector or recombinant cell as described above for the preparation of a kit for detecting HLA-A x 02:01. Isolated peptides, HPV epitopes, isolated polypeptides and their corresponding substances according to some embodiments of the invention may bind to HLA-A 02:01 and thus the above substances may be used for the preparation of a kit for the efficient detection of HLA-A 02:01.
Kit for detecting a substance in a sample
In one aspect, the invention provides a kit comprising reagents suitable for detecting the isolated polypeptides described above. The reagent can accurately detect the separated polypeptide, such as detecting whether the biological sample contains the separated polypeptide, and the kit containing the reagent can accurately diagnose whether an individual from which the biological sample is infected by HPV, and further, whether the individual is an HPV high risk individual because the separated polypeptide is highly expressed in HPV infected tissues. Similarly, the detection of HPV infected individuals during treatment using the kit can detect changes in HPV during treatment, such as exacerbation, slowing or healing. The agent includes an antagonist of the isolated polypeptide, a receptor protein, an antibody or the like, a protein capable of specifically binding to the isolated polypeptide or a nucleic acid molecule thereof, or the like.
In yet another aspect, the invention provides a kit for detecting HLA-A x 02:01, comprising an isolated polypeptide, nucleic acid molecule, expression vector or recombinant cell as described above. As previously described, the isolated polypeptides and their corresponding substances can bind to HLA, and therefore kits comprising the same can be used to effectively detect HLA qualitatively or quantitatively.
Method of prevention or treatment
In one aspect, the invention provides a method of preventing or treating a disease associated with HPV, administering to a subject an isolated polypeptide, nucleic acid molecule, expression vector, recombinant cell, antigen presenting cell, immune effector cell, vaccine or drug as described above. As previously mentioned, the methods of prevention or treatment according to some embodiments of the present invention comprise administering an effective amount of any of the isolated polypeptides or the like described above, which are effective in treating or preventing tumors expressing HLA-A 02:01 molecules and the wild-type HPV epitope or isolated polypeptide.
According to some embodiments of the invention, the HPV-associated disease comprises at least one of the following: cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, intranasal cancer, and tonsillar cancer.
Various modes of administration are contemplated, including peritoneal, intravenous, intramuscular, subcutaneous, cortical, oral, topical, nasal, pulmonary and rectal, but the invention is not limited to these exemplified modes of administration. However, since the active ingredient of an orally administered drug or composition should be coated or formulated to prevent it from being degraded in the stomach upon oral administration. Preferably, the medicament or composition of the invention may be administered as an injectable formulation. In addition, the medicaments or compositions of the present invention may be administered using a specific device that delivers the active ingredient to the target cell.
The frequency and dosage of administration of the isolated polypeptides, nucleic acids, expression vectors, recombinant cells, antigen presenting cells, immune effector cells, drugs, vaccines in embodiments of the invention may be determined by a number of relevant factors including the type of disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient and the type of drug as an active ingredient. According to some embodiments of the invention, the daily dose may be divided into 1 dose, 2 doses or more in a suitable form to be administered 1, 2 or more times over the whole period of time, as long as a therapeutically effective amount is achieved.
The term "therapeutically effective amount" refers to an amount sufficient to significantly ameliorate some of the symptoms associated with a disease or disorder, i.e., an amount that provides a therapeutic effect for a given disorder and dosing regimen. The term "treatment" is used to refer to obtaining a desired pharmacological and/or physiological effect. As used herein, "treating" encompasses administering an isolated polypeptide, nucleic acid, expression vector, recombinant cell, vaccine, antigen presenting cell, immune effector cell, or drug in embodiments of the invention to an individual for treatment, including but not limited to administering to an individual in need thereof as described herein.
Diagnostic method
In one aspect, the invention provides a method of diagnosing whether a subject contains HPV in the subject, comprising the step of detecting whether a biological sample derived from the subject carries an isolated polypeptide or nucleic acid molecule as described above. As previously described, the isolated polypeptide or nucleic acid molecule is present in an individual infected with HPV, and thus, by detecting whether a biological sample from the subject carries the agent, it is possible to effectively diagnose whether HPV is present in the subject, and further, to stage the HPV-associated disease in the subject based on the detected HPV content in the subject, or to prognosis a patient with HPV-associated disease before or after treatment, and a decrease in HPV content in the subject after treatment is indicative of a good prognosis in the subject.
The term "subject" or "individual" as used herein refers generally to mammals, such as primates and/or rodents, and in particular humans, monkeys or mice.
Diagnostic system
Finally, the invention proposes a diagnostic system. According to an embodiment of the invention, referring to fig. 1, the diagnostic system comprises: a polypeptide detection device 100; the result determination means 200. Wherein the polypeptide detection device 100 is used for detecting whether a biological sample derived from a subject carries the isolated polypeptide as described above, and the determining device 200 is connected to the peptide detection device 100 for determining whether the patient has a tumor based on whether the biological sample carries the isolated polypeptide. Such as: a mass spectrometer can be used to detect the presence or absence of the isolated polypeptide in the serum of a subject, and a mass spectrometry data analysis device can be used to determine whether the isolated polypeptide is present in the serum of the subject and whether the patient has a tumor. The inventor finds that the isolated polypeptide is specifically and highly expressed in tumor tissues, and the diagnosis system provided by the embodiment of the invention can be used for effectively determining tumor patients with the specific and highly expressed isolated polypeptide.
In addition, the inventors found that cervical cancer, vulva cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulva intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, intranasal cancer or tonsil cancer specifically express the polypeptide, and the diagnostic system provided by the embodiments of the present invention further improves the diagnostic accuracy of the above-mentioned tumor.
Meanwhile, the inventors found that HLA-A 02:01 molecules have a strong affinity to the isolated polypeptide, which elicits a series of immune responses by binding to cell surface HLA-A 02:01 molecules. Thus, the diagnostic system presented in the examples of the present invention has a higher probability of diagnosing tumor patients simultaneously expressing HLA-A 02:01 molecules and the isolated polypeptide.
It should be noted that the isolated polypeptides and uses thereof, nucleic acids encoding the isolated polypeptides, expression vectors, recombinant cells, drugs, antigen presenting cells, immune effector cells, vaccines, kits, methods and systems for treating and diagnosing HPV according to the embodiments of the present invention were discovered and completed by the inventors of the present application through laborious creative and optimization efforts.
The invention will now be described with reference to specific examples, which are intended to be illustrative only and not limiting in any way. The specific techniques or conditions are not noted in the examples and are carried out according to the techniques or conditions described in the literature in the art (for example, refer to J. Sam Brookfield et al, code Huang Peitang et al, molecular cloning Experimental guidelines, third edition, scientific Press) or according to the product specifications. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
Example 1 obtaining a polypeptide
This example was used to synthesize the polypeptide of interest, and the inventors have publicly reported the application of the literature to HPV viral peptide targets of HPV-associated cancers (Doran S L,
Figure BDA0003999137850000151
S,Adhikary S,et al.T-cell receptor gene therapy for human papillomavirus–associated epithelial cancers:a first-in-human,phase I/II study[J]journal ofClinical Oncology,2019,37 (30): 2759.), amino acids TIHDIILECV (SEQ ID NO:1, polypeptide 1, wild-type peptide) of HPV 16E6 protein were mutated to attempt to optimize its immune function, the experimental procedure comprising:
the typing of HLA-A02:01 was selected as the target typing, and the typed epitope was collected from the IEDB public database (http:// www.iedb.org /), whereby the amino acid sequence shown in SEQ ID NO:1 was obtained and analyzed for sequence conservation characteristics to confirm that the preferential amino acids at the 1 st, 2 nd and final (10 th) positions were Y, L, V, respectively, wherein the amino acid preference characteristics of the binding epitope of the typing of HLA-A02:01 are shown in FIG. 2. Although the amino acid at position 4 also has a preferential amino acid, this site is near the middle of the sequence and may be a potential TCR anchor, with NO modification, the inventors mutated TIHDIILECV to Y at position 1 and L at position 2, resulting in polypeptide YLHDIILECV (SEQ ID NO:2, polypeptide 2, replacement peptide).
Example 2 presentation and affinity detection of Polypeptides
This example predicts the typing affinity and presentation of HLA-A02:01, respectively, for polypeptides 1 and 2 obtained in example 1, and the specific experimental procedure is as follows:
software affinity was predicted using netMHCpan 4.1 (http:// www.cbs.dtu.dk/services/netMHCpan /). The sequence of the polypeptide to be predicted and the corresponding HLA typing are input into software. The input HLA typing is reduced in software, only specific binding related sites are reserved to form a false sequence, so that adverse effects of irrelevant site information on a model are reduced, a polypeptide sequence is changed into 9 peptide (namely the main length of HLAI class molecule binding) through insertion or deletion to form a binding core, BLOSUM coding is used to reserve similarity information among amino acids, and meanwhile, other additional information of peptide segment coding comprises insertion and deletion of length and the like, and the method is used for adopting different input neurons according to different lengths to improve software learning prediction effects. netMHCpan is able to make BA (BindingAffinity) mode predictions to obtain IC50 values (units: nM) measured in routine experiments, the lower the IC50 value the higher the affinity of the peptide fragment.
Antigen presentation was predicted using EPIP (http:// ep. Genemics. Cn /). The sequence of the polypeptides to be predicted and the corresponding HLA typing are input into software, and the corresponding expression level of each polypeptide takes a default value, namely TPM=4. The epid software models the three features obtained by calculation (site-specific scoring matrix scoring, gene expression level and sequence length) by logistic regression (Logistic Regression, LR) and calculates a normalized antigen presentation probability characterization, i.e. a presentation ability score. The fraction is between 0 and 1, and is an antigen presentation probability characterization. The closer the EPIP score is to 1, the higher the likelihood that the antigen will be presented by the corresponding HLA class.
The experimental results are shown in table 1, which demonstrate that both peptide fragments have high affinity and antigen presenting capacity.
Table 1: presence of polypeptide sequences and HLA alleles and affinity predictive scores
SEQ ID Category(s) Polypeptide sequence HLA typing Rendering scoring values Affinity scoring value
NO:1 Polypeptide 1 TIHDIILECV HLA-A02:01 0.91 315.90
NO:2 Polypeptide 2 YLHDIILECV HLA-A02:01 0.98 7.10
Example 3 validation of polypeptide T2 affinity
In this example, the polypeptides 1 and 2 used in examples 1 and 2 were taken and added to 2X 10 5 Into individual T2 cells, human β2 microglobulin (final concentration, 3. Mu.g/mL, available from bioovision) was added, cultured in 24-well plates, and incubated in an incubator (37 ℃,5% CO) 2 ) Is cultured overnight. The experiment set up 2 duplicate wells: t2 cells without polypeptide were used as background control, and CMV polypeptide (NLVPMVATV, SEQ ID NO:4, purchased from GenScript) was added as positive control. Cells were collected by centrifugation for 5 min at 200 g. After washing the cells twice with PBS, the cells were directly incubated with FITC-labeled anti-HLA-A02:01 monoclonal antibody, and maintained at 4℃for 30 minutes. Then using a flow cytometer (BD FACSJazz) TM ) And its software detects and analyzes its average fluorescence intensity. The experimental results are shown in table 2, and the optimized and modified polypeptide 2 has higher affinity than the polypeptide 1.
Table 2: detection of affinity of polypeptide sequences to HLA alleles
Figure BDA0003999137850000161
Figure BDA0003999137850000171
EXAMPLE 4ELISPOTs validation polypeptide CD8 + T cell immune response
4.1 antigen-specific CD8 + T cell preparation
PBMC cells of healthy volunteers of type HLA-A02:01 were taken and adjusted to a concentration of 2X 10 6 Separating mononuclear cells (attached for 3 h) by an attaching method, and separating CD8 by a CD8 magnetic bead method to obtain CD8 + T cells, the isolation of cells, are routine experimental procedures in the art. IL-4 (1000) using GM-CSF (1000U/mL)U/mL), and then inducing the adherent mononuclear cells to be immature DC, and then inducing the adherent cells to develop into mature DC cells by using IFN-gamma (100U/mL), LPS (10 ng/mL) and polypeptide 2. Irradiating mature DC cells loaded with polypeptide 2 and with volunteer CD8 + Co-culturing T cells, adding IL-21, culturing for 3 days, supplementing IL-2 and IL-7 once on 5 th and 7 th days, counting co-cultured cells on 10 th day, and collecting polypeptide 2 specific CD8 + T cells. Preparation of polypeptide 1-specific CD8 according to the same protocol + T cells.
Table 3: CD8 + T cell preparation results
SEQ ID Category(s) Polypeptides Total number of cells before culture Total number of cells after culture
NO:1 Polypeptide 1 TIHDIILECV 2.0×10^6 5.21×10^6
NO:2 Polypeptide 2 YLHDIILECV 2.0×10^6 8.98×10^6
NO:3 Positive control peptide NLVPMVATV 2.0×10^6 1.05×10^7
4.2 verification of CD8 + T cell immune response
Specific CD8 of replacement peptide + T cells and T2 loaded with wild-type peptide or unrelated peptide were each incubated in elispot plates for 20 hours and then assayed for elispot (see kit instructions). Detection of wild-peptide-specific CD8 according to the same protocol + Immune response of T cells. The positive control group was cultured by adding CMV antigen-specific T cells and T2 loaded with CMV antigen peptide or irrelevant peptide to ELISPOTs plate, respectively, and the test method is the same as above, and the experimental results are shown in FIG. 3 and Table 5.
Table 5: stimulation of specific CD8+ T cells by the polypeptide to secrete IFN-gamma interferon results
SEQ ID Category(s) Polypeptide sequence Experimental peptide spot count Number of irrelevant peptide spots Multiple (experiment/irrelevant)
NO:1 Polypeptide 1 TIHDIILECV 77+56 15+16 4.3
NO:2 Polypeptide 2 YLHDIILECV 252+261 26+31 9.0
NO:3 Positive control peptide NLVPMVATV 227+224 27+31 7.8
EXAMPLE 5CFSE and 7-AAD double labelling techniques to test the killing ability of CTL cells
Taking T2 cells in logarithmic growth phase, dividing into polypeptide-loaded (polypeptide 1) group and polypeptide-unloaded group, and extracting at 37deg.C and 5% CO 2 The incubator was incubated overnight. The T2 cells cultured overnight were washed, added with 0.5. Mu.M CFSE solution, and treated at 37℃for 20min. Immediately after the completion of staining, the stained cells were removed, stopped, washed 2-3 times with DPBS, counted, and resuspended to 2X 10 5 And each mL. Mixing CTL cells with T2 cells loaded with antigen peptide or not loaded with antigen peptide according to a certain effective target ratio, co-culturing at 37 ℃ and 5% CO 2 After incubation in an incubator for 20-22 hours, the cell mixture is blown out for resuspension, taken out completely, added with 7-ADD and dyed for 5 minutes in a dark place, and used for marking dead cells, and the killing rate is detected by a flow cytometer. CSFE + 7-AAD + Double positive thinCells are target cells to be killed, CFSE + 7-ADD - The cells were target cells that were not killed, and the killing activity of the target cells to kill T2 was calculated based on these ratios. Detection of polypeptide 2-specific CD8 according to the same protocol + Killing activity of T cells. Killing rate (%) = (ratio of dead cells in target cells of experimental group-ratio of dead cells in target cells of negative control group)/(ratio of dead cells in target cells of 1-negative control group). The specific experimental results are shown in Table 6 and FIG. 4.
Table 6: t cell specific recognition and killing of target cells presenting the experimental polypeptide
Figure BDA0003999137850000181
EXAMPLE 6 pharmacodynamics study of specific T cell intravenous injection on tumor-bearing mouse model of human cervical cancer Caski cells
Polypeptide 1-specific T cells and polypeptide 2-specific T cells were prepared separately as in example 4, and in vivo efficacy evaluation was performed in mice. Construction of a subcutaneous tumor model Using 64 immunodeficient NOG mice 7-9 weeks old and cervical cancer cell lines Caski cells, each mouse was inoculated subcutaneously 2X 10 6 And (3) individual Caski cells. After inoculation, the tumor growth of the mice is observed periodically and the tumor volume is monitored until the tumor grows to 50-100mm 3 The mice were then randomly grouped according to tumor size and body weight for tail vein administration.
A total of 8 groups were divided according to the mode of administration: 1) PBS group adjuvant group, 2) polypeptide 1 specific T cell low dose group, 3) polypeptide 1 specific T cell medium dose group, 4) polypeptide 1 specific T cell high dose group, 5) polypeptide 2 specific T cell low dose group, 6) polypeptide 2 specific T cell medium dose group, 7) polypeptide 2 specific T cell high dose group, 8) Mock-T cell high dose group (i.e., replacement of the polypeptide loaded DC stimulated activated T cells in example 4 with CKT3 and CD28 stimulated activated T cells, each 8 were routinely practiced in the art). Wherein the high dose group of injected cells is 2X 10 7 Dose, medium dose group 7X 10 6 Dose, low dose group 2X 10 6 Dose/dose, 2 times total, 7 after the end of the first administrationThe second administration was performed after the day. IL-2 (5 ten thousand IU/dose, 3 doses per day) was combined simultaneously.
The results are shown in FIG. 5. The tumor length and width are measured every 2 days after tumor formation (5-8 days after inoculation), the tumor volume is calculated, and the relative tumor inhibition rate is calculated to complete the efficacy evaluation. The results show that the TGI of the low, medium and high dose groups of the polypeptide 2 are 37%, 68% and 82% respectively by day 31 after 5 days of tumor formation, wherein the medium and high dose groups can significantly inhibit the growth of CaSki tumors in NOG mice, and exhibit a quantitative relationship, the TGI of the low, medium and high dose groups of the polypeptide 1 are 5%,24% and 39% respectively, and the TGI of the Mock-T group is less than 20%.
Furthermore, the terms "first," "second," and the like, are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include at least one such feature. In the description of the present invention, the meaning of "plurality" means at least two, for example, two, three, etc., unless specifically defined otherwise.
In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, the different embodiments or examples described in this specification and the features of the different embodiments or examples may be combined and combined by those skilled in the art without contradiction.
While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

Claims (30)

  1. Use of amino acid 1 of an HPV epitope having an amino acid sequence as shown in SED ID No. 1, for mediating binding of the HPV epitope to HLA-A x 02:01.
  2. 2. A method of altering the binding activity of an HPV epitope to HLA-A 02:01, comprising contacting an isolated HPV epitope peptide or a nucleic acid encoding an HPV epitope peptide with an agent for mutating amino acid 1 of the HPV epitope.
  3. 3. The method of claim 2, wherein the agent is further used to mutate amino acid 2 and/or 10 of an HPV epitope.
  4. 4. The method of claim 2, wherein the agent is used to mutate amino acid 1 of an HPV epitope from T to Y.
  5. 5. The method of claim 2, wherein the agent is further used to mutate amino acid 2 of an HPV epitope from I to L.
  6. 6. Use of a reagent for altering the binding activity of an HPV epitope to HLA-A x 02:01 for the preparation of a kit for mutating amino acid 1 of an HPV epitope.
  7. 7. Use of a device for altering the binding activity of an HPV epitope to HLA-A 02:01 for the preparation of a system for mutating amino acid 1 of an HPV epitope;
    optionally, the device is an ultraviolet device.
  8. 8. An isolated polypeptide having a mutation at amino acid position 1 compared to the amino acid sequence set forth in SED ID No. 1.
  9. 9. The polypeptide of claim 8, further comprising a mutation at amino acid position 2 and/or 10.
  10. 10. The polypeptide of claim 9, wherein the polypeptide has the following mutation sites compared to the amino acid sequence set forth in SED ID No. 1: bit 1 and/or bit 2.
  11. 11. The polypeptide of claim 10, wherein the polypeptide has at least one of the following mutations compared to the amino acid sequence set forth in SED ID No. 1:
    1) T at position 1 is mutated to Y; and
    2) The I at position 2 is mutated to L.
  12. 12. The polypeptide of any one of claims 8-11, wherein the polypeptide has the amino acid sequence of SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.
  13. 13. A nucleic acid molecule encoding the polypeptide of any one of claims 8-12.
  14. 14. An expression vector carrying a nucleic acid for expressing the polypeptide of any one of claims 8-12.
  15. 15. An isolated antigen presenting cell, wherein the cell presents the polypeptide of any one of claims 8-12.
  16. 16. The antigen presenting cell of claim 15, wherein the antigen presenting cell is obtained by at least one of:
    contacting a cell having antigen presenting ability with the polypeptide;
    introducing the expression vector of claim 14 into said cells having antigen presenting capabilities.
  17. 17. The antigen presenting cell of claim 16, wherein the cell having antigen presenting ability is a dendritic cell, a B cell or a mononuclear-phagocyte.
  18. 18. An isolated immune effector cell, wherein the immune effector cell specifically recognizes the polypeptide of any one of claims 8-12 or recognizes an antigen presenting cell that presents the polypeptide of any one of claims 8-12 on the surface of a cell.
  19. 19. The immune effector cell of claim 18, wherein the immune effector cell is obtained by:
    contacting the antigen presenting cell of any one of claims 15 to 17 with a cell having an immunocompetent capacity.
  20. 20. The immune effector cell of claim 19, wherein the cell having an immune effector capability is a T cell.
  21. 21. The immune effector cell of claim 19, wherein the cell having an immune effector capacity is CD8 + T cells.
  22. 22. Use of a reagent for detecting a polypeptide according to any one of claims 8 to 12 in the preparation of a kit for diagnosis of HPV or detection of HPV.
  23. 23. A kit comprising reagents suitable for detecting the polypeptide of any one of claims 8-12.
  24. 24. Use of the polypeptide of any one of claims 8-12, the nucleic acid molecule of claim 13, the expression vector of claim 14, the antigen presenting cell of any one of claims 15-17, or the immune effector cell of any one of claims 18-21 in the preparation of a medicament for preventing or treating an HPV-related disease.
  25. 25. The use according to claim 24, wherein the HPV-related disease comprises at least one of: cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, intranasal cancer, and tonsillar cancer.
  26. 26. A medicament comprising the polypeptide of any one of claims 8-12, the nucleic acid molecule of claim 13, the expression vector of claim 14, the antigen presenting cell of any one of claims 15-17, or the immune effector cell of any one of claims 18-21.
  27. 27. A vaccine comprising the polypeptide of any one of claims 8-12, the nucleic acid molecule of claim 13, the expression vector of claim 14, and the antigen presenting cell of any one of claims 15-17.
  28. 28. The vaccine of claim 27, further comprising at least one adjuvant.
  29. 29. A diagnostic system, comprising:
    a polypeptide detection device for detecting whether a biological sample derived from a subject carries the polypeptide of any one of claims 8-12;
    And a result determination device, coupled to the polypeptide detection device, for determining whether the subject has a tumor based on whether the biological sample carries the isolated polypeptide.
  30. 30. The diagnostic system of claim 29, wherein the tumor is cervical cancer, vulvar cancer, vaginal cancer, anal cancer, penile cancer, head and neck cancer, cervical intraepithelial neoplasia, vulvar intraepithelial neoplasia, vaginal intraepithelial neoplasia, anal intraepithelial neoplasia, penile intraepithelial neoplasia, oral cancer, laryngeal cancer, esophageal cancer, intranasal cancer, or tonsillar cancer.
CN202211609622.5A 2022-12-14 2022-12-14 HPV epitope and application thereof Pending CN116217675A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211609622.5A CN116217675A (en) 2022-12-14 2022-12-14 HPV epitope and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211609622.5A CN116217675A (en) 2022-12-14 2022-12-14 HPV epitope and application thereof

Publications (1)

Publication Number Publication Date
CN116217675A true CN116217675A (en) 2023-06-06

Family

ID=86577593

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211609622.5A Pending CN116217675A (en) 2022-12-14 2022-12-14 HPV epitope and application thereof

Country Status (1)

Country Link
CN (1) CN116217675A (en)

Similar Documents

Publication Publication Date Title
US20110158952A1 (en) Compositions and methods for treating human papillomavirus-mediated disease
CA2305683C (en) Immunogenic peptides from the hpv e7 protein
US6235523B1 (en) Vectors for DNA immunization against cervical cancer
Cheung et al. Plasmid encoding papillomavirus Type 16 (HPV16) DNA constructed with codon optimization improved the immunogenicity against HPV infection
Peng et al. Efficient delivery of DNA vaccines using human papillomavirus pseudovirions
WO2023184861A1 (en) Hpv epitope and identification method therefor, and application thereof
JP2006503914A5 (en)
CN116970058B (en) Tumor neoantigen polypeptide aiming at TP53 gene R249S mutation and application thereof
Peng et al. Characterization of human papillomavirus type 11‐specific immune responses in a preclinical model
WO2021095838A1 (en) Nucleic acid lipid particle vaccine encapsulating hpv mrna
WO2021042947A1 (en) Minicircle dna vaccine design and use
CN105985984A (en) PAP (prostatic acid phosphatase)-antigen-gene-carrying recombinant adeno-associated virus (rAAV) vector, and establishment method and application thereof
WO2007033533A1 (en) Use of nocardia rubra cell wall skeleton to produce medicaments for resisting human papilloma virus hpv
WO2023184862A1 (en) Hpv epitope, identification method therefor, and application thereof
WO2023137945A1 (en) Use of cxcl14
KR100904844B1 (en) A DNA Vaccine for treating or preventing cervical cancer comprising a gene encoding HPV protein
CN116217675A (en) HPV epitope and application thereof
CN115850377A (en) Tumor neoantigen polypeptide based on NRAS gene Q61K mutation and application thereof
Simões et al. Papillomavirus: Viral vectors in the gene therapy and new therapeutic targets
CN112891526A (en) HPV (human papillomavirus) virus vaccine based on personalized modified dendritic cells
KR20050050115A (en) Dna vaccine encoding at least two nonstructural early proteins of papillomavirus
CN115443287A (en) Improved vaccines for recurrent respiratory papillomatosis and methods of use thereof
CN115569189A (en) Vaccine combinations for the treatment of HPV infections
Li et al. Prevention and treatment of HPV‐related cancer through a mRNA vaccine expressing APC‐targeting antigen
CN117903264A (en) Novel coronavirus SARS-CoV-2 HLA-A2 restriction epitope peptide and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination