CN116211896B - Application of akkermansia muciniphila JF3 in intervention of radioactive rectal diseases for improving tissue fibrosis and repairing mucous membrane damage - Google Patents

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of akkermansia muciniphila JF3 in improving tissue fibrosis and repairing mucous membrane damage in the intervention of radioactive rectal diseases. According to the research, the colistin ackermanni JF3 can effectively improve rectal fibrosis, rectal mucosa damage, anus damage and colorectal inflammation caused by radioactive rectal diseases. Thus, the novel strain JF3 of akkermansia muciniphila can be used as a potential safe live bacterial drug for the treatment of rectal fibrosis, rectal mucosa breakdown, anal injury and colorectal inflammation caused by radiorectal disease.

Description

Application of akkermansia muciniphila JF3 in intervention of radioactive rectal diseases for improving tissue fibrosis and repairing mucous membrane damage

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of akkermansia muciniphila JF3 in improving tissue fibrosis and repairing mucous membrane damage in the intervention of radioactive rectal diseases.

Background

Cancer is an urgent global public health problem, the second leading cause of death worldwide. It is counted that at least 70% of cancer patients use radiation therapy. However, radiation therapy also causes acute or chronic hematopoietic and gastrointestinal radiation syndromes, severely affecting quality of life and even leading to death, the most important treatment disorder for oncology patients. Although some studies have shown a potential correlation between intestinal flora and radiation-induced damage, the detailed basis of this relationship is still unclear. Furthermore, despite decades of rigorous research, medical intervention to combat radiation injuries remains a global challenge.

Radiotherapy is an important place in the integrated treatment of rectal cancer, but radiotherapy also produces some adverse effects, especially in the intestinal health, causing early and/or delayed radiation intestinal diseases. At the same time, radiation during radiotherapy can also cause inflammation, fibrosis changes in the rectal tissue and dysregulation of intestinal microbiota. Therefore, it has become urgent to explore the mechanisms associated with chronic radiation proctitis and to discover new therapies. In addition, radiorectal lesions (RP) are one of the most important complications in radiotherapy of pelvic malignant tumors such as rectal cancer, prostate cancer, bladder cancer, cervical cancer, testicular cancer, and uterine cancer. About 75% of patients receiving radiation treatment experience acute RP symptoms such as diarrhea and nausea, and may recover after radiation treatment, while up to 20% of patients experience chronic RP and experience long-term symptoms including fistulae, urinary incontinence, rectal bleeding, and the like. Clinical results for Chronic RP (CRP) are poor due to the lack of effective treatment. CRP is also a good model for studying enteritis, but since the underlying mechanisms of CRP occurrence and progression are currently still unclear, more studies on CRP pathogenesis, progression and treatment are needed. Furthermore, the many pathological features of radiorectal disease and the different pathological features may be different for the drugs, resulting in few available treatment options, and thus there is a strong need for novel and effective treatments to alleviate radiation-induced intestinal damage.

The intestinal microbiome of human body can effectively maintain the dynamic balance of intestinal microecology, and has important influence on digestion, nutrition, immunity and the like of the whole organism through complex interaction with a host. Disorders of the intestinal flora are closely related to the occurrence and development of many diseases in the human body. Therefore, the composition of intestinal microorganisms is precisely controlled to achieve microecological balance, so that effective intervention of various human diseases is realized, and the method is a research direction with important market prospect. Currently, only 36 probiotics are approved for food, and it is particularly important to mine more probiotic resources. Achroman mucin Akkermansia muciniphila (A. Muciniphila) as a next generation probiotic has been demonstrated to improve obesity, type II diabetes, inflammatory Bowel Disease (IBD), hypertension, premature senility, atherosclerosis, appendicitis, autism, etc., however, its indication and mechanism of action have yet to be studied further.

The intestinal flora can respond to changes rapidly, so that the intestinal flora becomes a physiological control center which is easier to access and regulate and control, and plays an important role in maintaining human health. Changes in intestinal microorganisms are observed in patients with radiation enteropathy, and homeostasis of colonising intestinal flora is broken, resulting in imbalance of intestinal flora. Suggesting intervention of the intestinal flora to restore microecological balance may protect the intestinal tract from radiation damage. Therefore, the digging of the Acremonium muciniphilum capable of interfering with the radioactive rectal disease has important application prospect.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention provides the application of the mucin-philin Ackermans JF3 in the aspects of treating rectal fibrosis, rectal mucosa damage, anal injury and colorectal inflammation caused by radioactive rectal diseases, and the application of the mucin-philin Ackermans JF3 in the aspects of indicating directions for the adaptive drugs with different pathological characteristics of the radioactive rectal diseases.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

the invention provides an application of a mucin-philin Acremonium JF3 in preparing a radioactive rectal fibrosis drug, wherein the preservation number of the mucin-philin Acremonium JF3 is CCTCC No: m20221499.

The invention also provides application of the mucin-philin Acremonium JF3 in preparing a medicament for treating rectal mucosa damage of radioactive rectal diseases, wherein the preservation number of the mucin-philin Acremonium JF3 is CCTCC No: m20221499.

The invention also provides application of the mucin-philin Acremonium JF3 in preparing a radioactive rectal disease anus injury drug, wherein the preservation number of the mucin-philin Acremonium JF3 is CCTCC No: m20221499.

The invention also provides application of the mucin-philin Achroman JF3 in preparing a medicament for improving colorectal inflammation of radioactive rectal diseases, wherein the preservation number of the mucin-philin Achroman JF3 is CCTCC No: m20221499.

Because of the many pathological features of radiorectal disease and the potential for different pathological features to accommodate drugs, there is still a lack of effective treatments. According to the invention, research shows that the mucin-philin Acremonium (Akkermansia muciniphila) JF3 is a strain of different strains of the same species of Acremonium, has no acute toxicity, is safe to eat, can be planted in intestinal tracts, and has good planting capacity. The gastric mucin-impregnated Ackermannia JF3 can down regulate the expression of proinflammatory factors IL1 beta, IL6 and TNF alpha in serum of a radioactive rectus mice, so that anus dehairing and tissue edema caused by radiation can be recovered, rectal mucosa breakage of the radioactive rectus mice can be obviously repaired, rectal submucosa fibrosis of the radioactive rectus mice can be obviously relieved, and the direction is indicated for adaptive drugs with different pathological characteristics of the radioactive rectus.

The invention also provides a medicine for treating the radioactive rectal disease, which takes the mucin Acremonium JF3 as a main active ingredient, and the preservation number of the mucin Acremonium JF3 is CCTCC No: m20221499; the treatment includes down-regulating the expression of pro-inflammatory factors IL1 beta, IL6 and TNF alpha, improving the anorectal damage of the radiorectal disease, repairing the damage of the rectal mucosa of the radiorectal disease, and reducing the rectal fibrosis of the radiorectal disease.

Preferably, a pharmaceutically acceptable carrier and/or excipient is also included.

More preferably, the above excipients refer to diluents, binders, lubricants, disintegrants, co-solvents, stabilizers, etc. and some pharmaceutically acceptable bases which are useful in the pharmaceutical field. The carrier is a functional pharmaceutical adjuvant available in the pharmaceutical field and comprises a surfactant, a suspending agent, an emulsifying agent and a plurality of novel pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid and the like.

Preferably, the dosage forms of the medicine comprise injection, tablet, granule, capsule, dripping pill, sustained release agent and oral liquid preparation.

More preferably, the above-mentioned dosage forms refer to clinically usual dosage forms. Pharmaceutical formulations may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically), and if some drugs are unstable under gastric conditions, they may be formulated as enteric coated tablets.

Preferably, the composition also comprises other active ingredients which are compatible with the akkermansia muciniphila JF3 and have synergistic effect.

Other active ingredients which are compatible with the akkermansia muciniphila JF3 and act synergistically mean probiotics or bioactive substances which can be matched with the akkermansia muciniphila JF3 and also can be suitable for treating rectal fibrosis, rectal mucosa damage, anus injury and colorectal inflammation caused by radioactive rectal diseases, and the drug effect of the active ingredients after being compatible with the akkermansia muciniphila JF3 is higher than that of the active ingredients when the akkermansia muciniphila JF3 is singly used, at least the drug effect of the active ingredients is not lower than that of the active ingredients when the akkermansia muciniphila JF3 is singly used.

Compared with the prior art, the invention has the beneficial effects that:

aiming at the problems that the current radioactive rectal diseases have high incidence, multiple pathological features and complex symptoms, and different symptoms are not suitable for medicines, and lack of safe and effective clinical medicines, the invention discovers that the mucin-philin Ackermans JF3 can effectively improve rectal fibrosis, rectal mucosa damage, anus injury and colorectal inflammation caused by the radioactive rectal diseases. Therefore, the mucin-philin Ackermans JF3 is expected to be prepared into medicines and the like to be applied to the treatment of rectal fibrosis, rectal mucosa breakage, anus injury and colorectal inflammation caused by the radioactive rectal disease, and the directions of the medicines adapting to different pathological characteristics of the radioactive rectal disease are indicated. Moreover, the novel mucin-philin Acremonium jF3 strain belongs to beneficial bacteria which are safe to eat, is safe to eat, and can be used as a potential safe medicine for targeted treatment of rectal fibrosis, rectal mucosa damage, anal injury and colorectal inflammation caused by radioactive rectal diseases.

Drawings

FIG. 1 is a morphological observation and identification of the mucin-philic Acremonium JF 3;

FIG. 2 is a phylogenetic tree of Acremonium muciniphilum JF3 and other Acremonium muciniphilum strains;

FIG. 3 shows the results of an acute toxicity test of Alkermansia muciniphila JF 3;

FIG. 4 is a diagram showing the pathological features of radiation-induced proctitis in mice;

FIG. 5 shows the effect of the gastric mucin-impregnated Acremonium JF3 on the improvement of colorectal inflammation in radiorectal mice;

FIG. 6 shows the effect of the gastric mucin-impregnated Acremodelling strain JF3 on the improvement of anal lesions in radiorectal mice;

FIG. 7 shows the effect of gastric lavage JF3 strain on improvement of mucosal breakage in radiorectal mice;

FIG. 8 shows the effect of gastric lavage JF3 strain on improvement of radiorectal fibrosis in mice.

Detailed Description

The following describes the invention in more detail. The description of these embodiments is provided to assist understanding of the present invention, but is not intended to limit the present invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.

The experimental methods in the following examples, unless otherwise specified, are conventional, and the experimental materials used in the following examples, unless otherwise specified, are commercially available.

Example 1 acquisition of Acremonium muciniphilum JF3

Isolation of a mucin-philic Acremonium strain Akkermansia muciniphila JF from faeces of a healthy male volunteer from Guangdong province, china: a sample collecting pipe with good air tightness is used for collecting a fecal sample with proper weight, the sample is prevented from being stained with urine during sampling, the inner part of the middle section of the sample is rapidly collected, then a bottle opening is screwed up, the sample is placed into an anaerobic bag, and the sample is rapidly transferred into an anaerobic workstation. The harvested samples were diluted and plated in an anaerobic bench. After picking 0.5g samples and mixing them well in 2mL PBS containing 0.5% cysteine hydrochloride (which has been equilibrated in anaerobic environment for 48 h), 10-fold gradient dilutions were performed and spread on BHI-M plates for daily observation. And (3) carrying out plate streak purification on the single colonies which grow out for more than three times, and then picking the single colonies to a liquid culture medium for expansion culture. When the liquid culture medium is observed to have turbidity visible to the naked eye, 500 mu L of bacterial liquid is taken into a freezing tube filled with 500 mu L of 60% glycerol, and after being fully mixed, the liquid culture medium is transferred to a refrigerator at the temperature of minus 80 ℃ for preservation, and is named as JF3 strain.

JF3 colonies were identified as strictly anaerobic bacteria by streak isolation and as non-motile, sporulated oval colonies (FIG. 1A) were cultured in BHI-M broth for 20-24h to stationary phase. The morphology of JF3 cells was observed under an optical microscope (fig. 1B), JF3 was oval, gram-stained mauve, identified as gram-negative bacteria (fig. 1C); the length of the cells was 0.6-1. Mu.m, and the bacteria were generally single or two in pairs, and showed little growth of clusters (FIG. 1D), which was consistent with that reported in the literature (Derrien M, vaughan EE, plugge CM, et al, akkermansia muciniphila gen. Nov., sp. Nov., a human intestinal mucin-degrading bacteria. International Journal of Systematic and Evolutionary Microbiology 2004; 54:1469-76).

After colony 16S conserved gene sequences are compared and identified through 16S rDNA, the full genome sequencing of the Akkera muciniphila JF3 strain is carried out by Beijing Baimeike biotechnology Co., ltd, and the 16S rDNA sequence obtained by the sequencing result is used for constructing an evolutionary tree with other Akkera muciniphila, and the evolutionary tree has an relatedness with A.muciniphila BAA-835 (figure 2), so that the JF3 is confirmed to be the same type of different strain of Akkera muciniphila.

Finally, strain JF3 was preserved in China center for type culture Collection (address: university of Chinese, wuhan) at 2022, 9 and 27 days with a preservation number of CCTCC No: m20221499, which is inoculated into a BHI liquid culture medium containing mucin, is subjected to stationary culture in an anaerobic working table for 48 hours to obtain a JF3 bacterial liquid.

16S rDNA sequence of JF3 Strain:

CTTAGGACCCTGCCTCCTTGCGGTTGGCTTCAGATACTTCGGGTGCGACCGGCTTCCATGATGTGACGGGCGGTGTGTACAAGACCCGGGAACGTATTCACGGCGCCGTAGCTGATGCGCCATTACTAGCGATTCCGGCTTCGTGTAGGCGGGTTGCAGCCTACAGTCCGAACTGGGCCCAGTTTTTAGGATTTCCTCCGCCTCGCGGCTTCGGCCCCCTCTGTACTGGGCATTGTAGTACGTGTGCAGCCCTGGGCATAAGGGCCATACTGACCTGACGTCGTCCCCACCTTCCTCCCAGTTGATCTGGGCAGTCTCGCCAGAGTCCCCACCTTCACGTGCTGGTAACTGGCAACAGGGGTTGCGCTCGTTGCTGGACTTAACCAAACATCTCACGACACGAGCTGACGACGGCCATGCAGCACCTGTGTAACGCCTCCGAAGAGTCGCATGCTTTCACATGTTGTTCATTACATGTCAAGCCCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAGCCACATACTCCACCGCTTGTGCGGGTCCCCGTCAATTTCTTTGAGTTTTAATCTTGCGACCGTACTCCCCAGGCGGCACGCTTAACGCGTTAGCTCCGGCACGCAGGGGGTCGATTCCCCGCACACCAAGCGTGCACCGTTTACTGCCAGGACTACAGGGGTATCTAATCCCTTTCGCTCCCCTGGCCTTCGTGCCTCAGCGTCAGTTAATGTCCAGGAACCCGCCTTCGCCACGAGTGTTCCTCTCGATATCTACGCATTTCACTGCTACACCGAGAATTCCGGTTCCCCCTCCATTACTCTAGTCTCGCAGTATCATGTGCCGTCCGCGGGTTGAGCCCGCGCCTTTCACACACGACTTACGAAACAGCCTACGCACGCTTTACGCCCAGTGATTCCGAACAACGCTTGAGACCTCTGTATTACCGCGGCTGCTGGCACAGAGTTAGCCGTCTCTTCCTCTTGTGGTACTATCTTTTTAATTTGCTCCCACATGACAGGGGTTTACAATCCGAAGACCTTCATTCCCCCACGCGGCGTCGCACCATCAGGGTTTCCCCCATTGTGAATGATTCTCGACTGCTGCCACCCGTAGGTGTCTGGACCGTGTCTCAGTTCCAGTGTGGCCGGACATCCTCTCAGACCGGCTACCCGTCATCGCCTTGGTGAGCCGTTACCTCACCAACTAACTAATAGGCCGCGAGCCCATCCCCAAGCGCATTGCTGCTTTAATCTTTCGATACTATGCGGTATTAATCCCAGTTTCCCAGGGCTATCCCGCTCTCGGGGGCAGGTTACTCACGTGTTACTCACCCGTGCGCCACTAGAGAATTATTAGCAAGCTAGCAATTCTCTCGTTCGACTTGCATTCTATGCACGCCCCAATTC。

example 2 action of Acremonium muciniphilum JF3 in the intervention of radiorectal disease

1. JF3 culture and gastric lavage

(1) Preparing mucin liquid culture medium (BHI-M): 36.0g of brain-heart infusion dry powder (BHI), 4.0g of mucin, distilled water to a volume of 1L, and sterilizing at 121 ℃ for 20min after adjusting the pH value to 6.5 by HCl/NaOH. Cooling the culture medium, adding filtered sterilized L-cysteine hydrochloride (5 mg/L), mixing, and rapidly placing in anaerobic workbench (10% CO) ₂ ，10％H ₂ ，80％N ₂ ) The culture medium is subjected to 48h of equilibration, and can be used for JF3 culture.

(2) Preparation of mucin plate (BHI-M): 36.0g of brain heart infusion dry powder (BHI), 4.0g of mucin, 15.0g of agar powder and distilled water to 1L, adjusting the pH value to 6.5 by using HCl/NaOH, sterilizing at 121 ℃ for 20min, adding L-cysteine hydrochloride (5 mg/L) after filtration sterilization, preparing into a BHI-M flat plate, and placing in an anaerobic workbench for 48h for balancing for later use.

(3) Bacterial culture: JF3 was inoculated into 50mL of BHI-M liquid medium, and the culture was allowed to stand at 37℃for 48 hours, and the procedure was completed in an anaerobic working table.

(4) Preparing bacterial gastric lavage liquid: the cultured bacteria were collected, centrifuged at 6000 Xg for 5min at 4℃and the culture supernatant was discarded, washed twice with Phosphate Buffer (PBS), and finally prepared into a bacterial suspension with a proper volume of PBS for the gastric lavage experiment of mice.

2. jF3 live bacteria acute toxicity experiment

As a next generation probiotic, akkermansia muciniphila is required to be food safe. Thus, acute toxicity experiments were performed by feeding normal diet fed C57BL/6J mice. Large doses of JF3 live bacteria (dose: 1.5X10) ¹² CFU/kg) and the control group is filled with the blank culture medium with the same volume as the control group (+JF3), and the mental state, the growth state, the defecation condition and the like of the mice are observed in 14 d; after 14d, the experiment is finished, and whether abnormality exists in each organ of the JF3 gastric lavage group mice or not is observed. The specific experimental method is as follows:

(1) Gastric lavage experiment: 20C 57BL/6J mice, 22+ -4 g in weight, male and female halves. Control and JF3 gavage groups each had 10 mice (5 male 5 female). Before the stomach is irrigated with viable bacteria, the mice are fasted for 4-6 hours and drink water freely. Then according to 1.5X10 ¹² The CFU/kg dose was divided into 3 times for 24 hours with a 6-hour interval for gastric lavage. After each gastric lavage, the feed is fasted for 1.5 hours and then normal.

(2) And (3) observing the indexes: after the completion of the stomach irrigation, 14d was observed, and the weight and the food intake were measured every day, and the state of the mice such as mental state, growth, respiration and defecation were observed, and whether or not the abnormal phenomena such as fight and hair drop were observed. After 14d, the experiment is finished, the mice are dissected, the pathological changes of all organs are observed, relevant biochemical indexes, organ indexes and the like are measured, and the acute toxicity of the mucin-philin Acremonium JF3 is comprehensively evaluated.

(3) The defecation condition of the mice was observed: mice were placed in clean cages, and the number of faeces particles and total mass of faeces were observed and recorded in 6h in the same cage mice (5).

3. JF3 and metabolite intervention experiments

SPF class 8 week old (18-20 g) female C57BL/6J mice were purchased from Peking Vitre laboratory animal technologies Co. Raising in SPF environment of experimental animal center of sixth hospital attached to Zhongshan university, and lighting/darkness for 12 hr at 22+ -1deg.C for normal diet. Every 4 mice are one cage, and each cage of mice can eat and drink water freely. After one week of adaptive feeding, the mice except the control group were irradiated (25 Gy) with RS2000 equipment, and the mice were covered with a lead cover (4 mm thick) to expose the subpelvic region (1 cm) containing the rectum in the middle ² ) Radiation was applied 3 times a week at intervals, and a radioactive rectal disease mouse model was constructed.

Mice were then grouped: (1) normal control (WT), (2) radiorectal mice (CRP), (3) radiorectal mice were perfused with PBS (+pbs) at a daily intragastric dose of 200 uL/per mouse, (4) radiorectal mice were perfused with a.mucinia JF3 (+jf3) group at a daily intragastric dose of a.mucinia JF3 of akamania mucin (a.mucinia JF 3): 10 ⁸ CFU/mL,200 uL/L. All mice were treated for 30 days.

Fresh feces were collected from each mouse using a clean sterile squirrel cage prior to the end of the experiment. When collecting the excrement, the excrement is prevented from being stained with hair and urine, every three excrement is divided into 1 pipe, 3 pipes are collected, marked and temporarily frozen in liquid nitrogen, and the liquid nitrogen is transferred to a refrigerator at the temperature of minus 80 ℃ for preservation. At the end of the experiment, mice were anesthetized, eyeballs were removed, whole blood was collected using a clean centrifuge tube, and serum was collected by standing at room temperature. After blood collection, the mice are killed by cervical dislocation, the mice are dissected to collect specimens such as colon and rectum, the colon length and the rectum weight are photographed and weighed, and relevant data are recorded. Dividing the sample into two parts, wherein one part is stored in 4% paraformaldehyde and placed at normal temperature; the remaining part is frozen in a liquid nitrogen tank and transferred to a refrigerator at the temperature of minus 80 ℃ for preservation.

Taking a fecal sample from each group of mice, and determining and analyzing intestinal flora of the fecal sample by using a 16S rDNA sequencing standard procedure by Nostoc induced biotechnology limited company; and taking a serum sample, and measuring serum immune factor expression by Shanghai you Ning vitamin technology Co., ltd through MSD standard flow.

In addition, the histopathology of mice was observed using hematoxylin-eosin (H & E) staining. The method mainly comprises the following steps: 1) Tissue material drawing and fixing: samples of fresh liver, fat, ileum and colon were taken and rapidly fixed in 4% paraformaldehyde fixative. 2) Tissue embedding section: paraffin embedding and slicing the fixed tissue at a certain angle. 3) Dewaxing and washing paraffin sections: sequentially placing the slices into xylene I (20 min) -xylene II (20 min) -absolute ethyl alcohol I (5 min) -absolute ethyl alcohol II (5 min) -75% alcohol (5 min), and finally washing with tap water. 4) Hematoxylin staining: the sections are sequentially subjected to hematoxylin dye (3-5 min) dyeing, tap water cleaning, differentiation liquid differentiation, tap water cleaning, blue returning liquid blue returning and running water flushing.

5) Eosin staining: the slices are sequentially put into 85 percent and 95 percent gradient alcohol to be dehydrated for 5 minutes respectively, and then are put into eosin dye solution to be dyed for 5 minutes. 6) And (3) removing the water sealing piece: sequentially slicing, adding absolute ethyl alcohol I (5 min) -absolute ethyl alcohol II (5 min) -absolute ethyl alcohol III (5 min) -dimethyl I (5 min) -xylene II (5 min) to transparent, and sealing with neutral resin.

4. Experimental results

(1) Acremonium muciniphilum JF3 is safe to eat and free of acute toxicity

1) Compared with the mice in the control group, the daily intake (fig. 3A), the body weight (fig. 3B) and the Lee's index (fig. 3C) of the mice in 14 d/after were not significantly changed, indicating that the treatment with the JF3 strain did not lead to weight loss and food intake reduction of the mice.

2) Referring to national standard of acute toxicity test (GB 15193.3-2014), in 14d observation period, JF3 gastric lavage group mice have no abnormal expression of mental state, good growth state, stable respiration, no occurrence of death condition, smooth defecation (figures 3D and E) and no obvious hair falling phenomenon, so that the treatment of JF3 does not affect the general signs of the mice and does not cause the poisoning expression of the mice.

3) After dissecting the mice, the JF3 treated mice had no obvious lesions in each organ (fig. 3F), no significant differences in heart, liver, spleen and kidney indices (fig. 3G), and no abnormalities in the levels of three aminotransferases associated with liver function (glutamate-pyruvate aminotransferase ALT, glutamate-oxaloacetic aminotransferase AST, gamma glutamyl transferase GGT) (fig. 3H) compared to the control group.

4) H & E pathological sections of organs of male and female mice were observed, and the organs of the JF3 treated group were observed under a 200-fold microscope without abnormal changes, and cells in the heart, liver, spleen and kidney were free of lesions such as swelling and necrosis, and the boundaries were clear without congestion phenomenon, which was consistent with that observed in the control group mice (FIG. 3I).

Therefore, treatment of the mucin-philin Acremonium JF3 can not cause acute toxicity and pathological changes of various organs of the mice, and the JF3 is safe to eat.

(2) The colorectal tissue of the radioactive rectally diseased mice has inflammation, and the expression of proinflammatory factors IL1 beta, IL6 and TNF alpha is obviously increased

Compared to control mice, the irradiated mice had significantly shorter colon (fig. 4A-B), significantly thicker rectum (fig. 4C), and significantly increased expression of pro-inflammatory factors il1β, IL6, and tnfα (fig. 4D), indicating that the radiation resulted in inflammation in the colorectal of the mice, and that the mouse model of the present invention successfully recaptured the pathological features of clinically radiorectal patients.

(3) Gastric mucin-filling Ackermansis JF3 significantly improves colorectal inflammation of radioactive rectopathic mice, down regulates expression of pro-inflammatory factors IL1 beta, IL6 and TNF alpha

Compared with the control group mice with gastric lavage PBS, the radioactive rectopathic mice were perfused with the gastric JF3 strain (FIG. 5A), and successful colonization of the strain was detected (FIG. 5D), indicating that the strain had better intestinal colonization ability.

Compared with the control mice with gastric lavage PBS, the colon of the mice with gastric lavage JF3 strain is obviously prolonged (figure 5B), the rectum is obviously lightened (figure 5C), and the expression of proinflammatory factors IL1 beta, IL6 and TNF alpha is obviously reduced (figure 5E), which shows that gastric lavage mucin Ackermansis JF3 can obviously improve the colorectal inflammation of the mice caused by radioactive radiation.

(4) Gastric lavage mucin Ackermansis JF3 significantly improves the anal injury of radioactive rectal disease mice

Compared to control mice, the skin hair folds of the irradiated mice were matt, anus was dehaired, tissue edema, demonstrating that the radioactive irradiation resulted in anal injury in the mice (fig. 6).

Compared with the control mice of the lavage PBS, the skin hair of the mice of the lavage JF3 strain is bright and colored, the anal dehairing is obviously recovered, and the tissue edema is obviously relieved (figure 6), which shows that the lavage JF3 strain can obviously improve the anal injury of the radioactive radiation mice.

(5) Gastric mucin-impregnated Ackermansis JF3 for obviously repairing rectal mucosa damage of radioactive rectal disease mice

Mucosal breakdown is an important factor affecting clinical radiorectal patients, and causes penetration of intestinal substances into the host, such as LPS, harmful substances secreted by intestinal bacteria, etc., thereby aggravating the host's disease. It can be seen from the HE staining of the rectum that the radioactive irradiation resulted in the damage of the rectal mucosa of the mice, whereas the gastric gavage JF3 strain was effective in ameliorating the damage of the mucosa of the radioactive rectal disease (fig. 7).

(6) Gastric mucin-impregnated Ackermansis JF3 significantly reduced rectal fibrosis in radiorectal mice

Fibrotic lesions are an important cause of poor healing of radiorectal diseases. Radiofibrosis is an important feature and pathological mechanism of radiation advanced injury. It can be seen from Masson staining of rectal tissue that radioactive irradiation resulted in exacerbation of fibrosis (blue) in radiorectal mice, while akkermansia muciniphila JF3 significantly reduced rectal fibrosis in radiorectal mice (fig. 8).

In conclusion, the colistin Ackermana JF3 is expected to be applied to the treatment of rectal fibrosis, rectal mucosa breakage, anal injury and colorectal inflammation caused by radioactive rectal diseases, and the direction is indicated for the adaptive drugs with different pathological characteristics of the radioactive rectal diseases.

The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, and yet fall within the scope of the invention.

Claims (8)

1. The application of the akkermansia muciniphila (Akkermansia muciniphila) JF3 in preparing a medicament for treating rectal fibrosis of a radioactive rectal disease is characterized in that the preservation number of the akkermansia muciniphila JF3 is CCTCC No: m20221499.

2. The application of the akaman (Akkermansia muciniphila) JF3 in preparing a medicament for treating the rectal mucosa damage of the radioactive rectal disease is characterized in that the preservation number of the akaman adaman JF3 is CCTCC No: m20221499.

3. The application of the mucin-philin Acremonium (Akkermansia muciniphila) JF3 in preparing a medicine for treating the anus injury of the radioactive rectal disease is characterized in that the preservation number of the mucin-philin Acremonium JF3 is CCTCC No: m20221499.

4. The application of the akkermansia muciniphila (Akkermansia muciniphila) JF3 in preparing a medicament for improving colorectal inflammation of radioactive rectal diseases is characterized in that the preservation number of the akkermansia muciniphila JF3 is CCTCC No: m20221499.

5. A medicament for treating radiorectal disease, which is characterized in that the medicament takes mucin ackermannin JF3 as a main active ingredient, and the preservation number of mucin ackermannin JF3 is CCTCC No: m20221499; the treatment includes down-regulating the expression of pro-inflammatory factors IL1 beta, IL6 and TNF alpha, improving the anorectal damage of the radiorectal disease, repairing the damage of the rectal mucosa of the radiorectal disease, and reducing the rectal fibrosis of the radiorectal disease.

6. A medicament for the treatment of radiorectal disease according to claim 5, further comprising pharmaceutically acceptable carriers and/or excipients.

7. The medicine for treating radiorectal disease according to claim 5, wherein the dosage form of the medicine comprises injection, tablet, granule, capsule, dripping pill, sustained release agent, and oral liquid preparation.

8. The medicament for the treatment of radiorectal disease according to claim 5, further comprising other active principles acting synergistically in combination with the mucin-philin ackerman JF 3.