CN116179760A - Quick detection reagent and kit for influenza virus H10N3 based on RPA and use method - Google Patents

Abstract

The invention relates to the technical field of biomedical detection, and provides an influenza virus H10N3 rapid detection reagent, a kit and a use method based on RPA. The RPA primer and the probe for detecting various infectious respiratory viruses can be used for finishing detection of screening various nosocomial infectious respiratory viruses for clinical patients or outpatients; the invention has the characteristics of specificity, low cost, sensitivity, portability, use and the like; the kit can effectively and specifically detect various nosocomial infection respiratory viruses with single reaction copy number and above. The RPA primer and the probe are used for detection, one or more different fluorescent signals can be detected in one reaction, the system design is effectively simplified, and the problems of inaccuracy and the like caused by different optical detection time of samples are avoided.

Description

Quick detection reagent and kit for influenza virus H10N3 based on RPA and use method

Technical Field

The invention relates to the technical field of biomedical detection, in particular to a rapid influenza virus H10N3 detection kit based on a Recombinase Polymerase Amplification (RPA) technology.

Background

Influenza is a respiratory disease that causes seasonal outbreaks that infect 5% to 15% of the population worldwide each year, one of the leading causes of high mortality worldwide. Influenza viruses are classified into A, B, C, D (a, b, c, and d) types according to the difference between nucleoprotein and matrix protein. In contrast, there are 131 of the 198 subtypes currently infecting humans, mainly the H1N1, H3N2 subtypes and b in influenza a virus, according to 18 different Hemagglutinins (HA) and 11 different Neuraminidases (NA) permutations of CDC reports. The diversity of influenza virus strains prevents their specific detection, and therefore there is a need to develop a rapid, selective and sensitive diagnostic method for rapid detection of influenza virus. Especially, in recent two months, the case report of the people infected by the H10N3 influenza virus appears at home and abroad, and the attention should be paid. At present, a plurality of influenza detection methods exist, the traditional method for identifying influenza viruses is to separate viruses according to the conventional method of national clinical examination operation rules, and the detection methods not only need professional technicians and complicated equipment and instruments, but also have long time consumption (more than 48 h) in the identification process, complex operation and low sensitivity. There is a great clinical need to develop a method for rapidly and effectively detecting influenza virus.

Numerous methods for clinical detection of influenza viruses have been developed, with virus culture being most common. However, detection of the target virus using cell culture requires up to 14 days. Direct fluorescent immunoassays based on detection of viral surface antigens have been used to rapidly identify influenza viruses, however, antibodies used in immunoassays cannot be simultaneously and effectively typed for influenza viruses due to their cross-reactivity and low detection sensitivity. In order to accurately identify influenza virus types, molecular real-time diagnostic methods including RT-PCR (Reverse Transcription-Polymerase Chain Reaction) are commonly used. However, fluorescent quantitative PCR is the preferred protocol for current-stage virus detection, but it has the following limitations: (1) The aerosol pollution is easy to generate, so that false positive results appear, and technicians, professional PCR certification laboratories and expensive temperature transformation control analysis instruments which are specially trained and used for performing PCR on duty are required to be equipped; (2) The traditional fluorescent quantitative PCR sample nucleic acid extraction and amplification detection are carried out in two steps, and at least more than 2-3 hours are needed from sampling to detecting results. Although multiplex PCR real-time amplification techniques have recently been developed through a single target gene, amplification detection processes of up to 90 to 120 minutes and the stringent requirements for experimental equipment and laboratory personnel are clearly unsuitable for rapid detection.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides an RPA-based influenza virus H10N3 rapid detection reagent, a kit and a use method thereof, and the kit has the characteristics of high accuracy and high detection speed, and can specifically detect the influenza virus H10N3.

In order to achieve the above object of the present invention, the present invention adopts the following technical solutions or combinations:

firstly, the invention provides an RPA-based influenza virus H10N3 rapid detection reagent, which comprises a primer group and a probe for detecting influenza virus A H10N 3; compared with the existing fluorescent quantitative PCR detection method, the method has the advantages of high accuracy and high detection speed.

The primer set comprises an upstream primer and a downstream primer, wherein,

the nucleotide sequence of the upstream primer is shown as SEQ ID No.1,

SEQ ID No.1：AGAGAGAGACAATTCTATTGCCTACTGTTACC；

the nucleotide sequence of the downstream primer is shown as SEQ ID No.2,

SEQ ID No.2：GTTGTACCATCGTCCAATGGAAATCAATCC；

the probe is a modified fluorescent probe, the sequence of which is shown as SEQ ID No.3,

SEQ ID No.3：

GGAGTTCTACTTATCAAAACAACTTTGTGCC[int-dT-FAM][THF][BHQ1]GGTGGGAGCAAGACC(C3 Spacer)。

preferably, the primers and probes are used to detect the HA gene of influenza virus H10N3.

Preferably, in the fluorescent probe, FAM is a fluorescent group, BHQ1 is a quenching group, THF tetrahydrofuran is modified at a site, and Spacer C3 is modified by a 3' -terminal space.

Further, the fluorophore may also be one or more of Texas Red, TAMRA, ROX, HEX and JOE.

On the basis, the invention provides an influenza virus H10N3 rapid detection kit based on RPA, which contains the reagent, and also comprises a buffer solution, an RPA amplification reaction system and an RNA extraction kit. The kit can be used for detecting H10N3, and has high accuracy and high speed, and the result can be obtained in about 30 minutes.

Preferably, the RPA amplification reaction system comprises, in 50 μl:

1.0-10 mu L of influenza virus H10N3 template DNA;

1.0 to 5.0 mu L of upstream primer;

1.0 to 5.0 mu L of a downstream primer;

probe primer 0.5-5 mu L;

29.5. Mu.L of rehydration buffer (Rehydration Buffer);

0.5 to 2.5 mu L of magnesium acetate;

a dry powder enzyme;

RNase-free water sterilized deionized water was added to 50. Mu.L;

in the invention, the finished kit is generally preserved at-20 ℃, and Mg2+ (magnesium acetate) is added when the kit is used.

Wherein the initial concentration of the upstream primer and the downstream primer is 1-10 mmol/L, and the initial concentration of the magnesium acetate is 50-280 mmol/L.

The invention also provides a use method of the kit, which comprises the following steps:

(1) Extracting an RNA template: extracting RNA in a sample to be detected;

(2) RPA amplification reaction: taking the RNA extracted in the step (1) as a template, adopting an RPA primer and a probe in a kit, performing RPA amplification reaction in an RPA reaction tube, and adding Mg2+ (magnesium acetate) before the amplification reaction;

(3) And (5) analyzing the RPA amplification product by fluorescence detection.

Further, the sample to be tested comprises at least one of H10N3 ribonucleic acid (HIN 1 RNA) liquid indoor quality control.

Further, the sample to be tested comprises at least one of nasopharyngeal swab preservation solution, oropharyngeal swab preservation solution and sputum.

Further, the PRA amplification is multi-enzyme isothermal amplification, the temperature of the amplification reaction is 25-42 ℃, the amplification time is 1-60 min, preferably 39 ℃, and the amplification is 3-15 min.

In the invention, any instrument capable of identifying and collecting fluorescent signals can be used for fluorescence detection analysis, and the luminescent genes comprise, but are not limited to FAM channels, and also comprise all series of fluorescence detection groups such as Cy3, cy5, texas Red, alexa flow, ROX, JOE and the like.

More preferably, the isothermal reaction may be performed by any means capable of controlling temperature, including, but not limited to, a water bath, an incubator, etc.

Compared with the prior art, the invention has the beneficial effects that:

(1) The invention designs RPA detection primers and probes by taking a hemolysin gene (HA) of H10N3 as a detection target, and further establishes a combined detection method based on isothermal amplification.

(2) The RPA primer and the probe for detecting various infectious respiratory viruses can be used for finishing detection of screening various nosocomial infectious respiratory viruses for clinical patients or outpatients; the kit has the characteristics of specificity, low cost, sensitivity, portability, use and the like; the kit can effectively and specifically detect various nosocomial infection respiratory viruses with single reaction copy number and above.

(3) The RPA primer and the probe can be used for detecting one or more different fluorescent signals in one reaction, and can also be used for simultaneously detecting a plurality of samples, so that the system design is effectively simplified, and the problems of inaccuracy and the like caused by different optical detection times of samples are avoided.

(4) Compared with 'gold standard' real-time fluorescence quantitative PCR, the kit provided by the invention is used for detection by an RPA method, the sensitivity of the primer and the probe is high, the detection accuracy is high, the sensitivity is high, and the detection can be completed within 30 minutes.

(5) The invention adopts the H10N3 hemolysin gene (HA) as a detection target to carry out RPA detection primer and probe design, and the accuracy of detection is higher.

(6) The invention adopts multienzyme to optimize the proportion and freeze-dries to form dry powder enzyme and an amplification tube, the reverse transcription process is reduced, the detection time and the operation steps are optimized, and the method is simpler and more convenient.

(7) The RPA primer and the probe have been proved by the detection of the throat swab sample of a clinical true patient, the coincidence rate is 100%, the accuracy and the specificity are very high, and the RPA primer and the probe have the convincing effect of clinical application test.

In conclusion, the rapid detection kit for influenza virus H10N3 based on the Recombinase Polymerase Amplification (RPA) provided by the invention can be widely applied to the detection of influenza virus H10N3 in clinic. The multiple real-time RT-RPA (Reverse Transcription-Recombinase Polymerase Amplification) detection technology is based on RPA rapid detection, quantitatively detects a plurality of samples to be detected in a single system, and has the advantages of high accuracy and high detection speed. In addition, the primer probe group is integrated in a single amplification system, so that the real-time rapid amplification detection system is miniaturized, technical support is provided for identification of unknown influenza viruses, and early typing, early discovery and early treatment are realized.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is a plot of the sensitivity measurements of H10N3 real-time RT-RPA in example 3;

FIG. 2 is a graph of the specificity of H10N3 real-time RT-RPA assay in example 3.

Detailed Description

The technical solutions of the present invention will be clearly and completely described in connection with the embodiments, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

In the examples of the present invention, unless clearly defined, the term target gene should be understood as a whole gene fragment, and the gene is not limited to the fragment to which the primer probe refers, but may be other primer-designable regions of the gene.

In the present invention, the fluorescent probe is not limited to FAM, but may be other fluorescent excitation groups such as GFP, texas Red, DAPI, alexa Fluor@488, FITC, cy3, cy5, cy7, ROX, JOE, alexa Fluor@750, etc.;

in the present invention, the detection sample may be at least one of a viral nucleic acid template, a pharyngeal swab, a viral culture solution, sputum containing a influenza virus and an influenza virus, and an alveolar lavage fluid. The specific meaning of the terms in the present invention can be understood by those skilled in the art or the related detection personnel according to the specific circumstances.

In the present invention, the dry powder enzyme component: bst DNA polymerase, single-stranded DNA binding protein SSB, recombinase Cre capable of binding single-stranded nucleic acid (oligonucleotide primer) and reverse transcriptase are all commercially available products.

In the following examples, reagents, instruments and the like used are commercially available.

Example 1 primer and Probe design

According to the base sequence of the influenza virus H10N3 genome which is already disclosed by NCBI, searching and comparing the base sequence of the HA gene, artificially creatively designing primers according to the primer design principle, and respectively verifying the GC content and other parameters of the designed primers to ensure that the primers reach the optimal range. Meanwhile, corresponding probes are respectively designed according to the design principle of the RPA probe primer.

In the invention, the core point of the design probe is the site search of a fluorophore, and the site of Tetrahydrofuran (THF) needs to be searched and determined when the probe is designed, in the invention, a probe primer is used for screening a base sequence with the length of 48-53bp, 3-5 nucleotides, preferably cytosine are adopted at the 5' end, the recombination of a gene sequence can be promoted, the designed THF site is not less than 30bp away from the 5' end and not less than 15bp away from the 3' end, and the THF site can not be contained any more.

Wherein 3 nucleotides at the 3' end are G or C, which is helpful for the stability of polymerase, and the content of G and C is 30-70%, thereby avoiding the formation of secondary structure or hairpin structure, and the target region is avoided from repeating elements. Primers and probes for the HA gene of influenza virus H10N3 were obtained as follows:

the primer and the probe can be used for detecting the HA gene of the influenza virus H10N3.

And (3) delivering the designed multiple groups of primers to a biological engineering (Shanghai) stock company for synthesis, and adding RNase-free water to dilute the primers to 10 mmol/mu L for later use after obtaining the primers.

Example 2 RPA amplification System

A recombinase polymerase amplification technology (RPA) based influenza virus H1N3 detection kit comprising the primers and probes of example 1;

the kit also comprises a rehydration buffer, magnesium acetate, RNase-free water, sterilized deionized water, an RNA extraction kit (QIAamp Viral RNA Kits (50)), and dry powder enzyme; the dry powder enzyme is freeze-dried powder of BST DNA polymerase, single-stranded DNA binding protein SSB and recombinase Cre capable of binding single-stranded nucleic acid (oligonucleotide primer) according to a certain proportion.

The RNA extraction kit is used for extracting RNA in a sample to be detected as a template; as the RNA extraction kit, a conventional commercially available RNA extraction kit can be used, and in this example, the RNA extraction kit used is QIAGEN RNA extraction kit QIAamp Viral RNA Kits.

The kit of this example comprises the following RPA amplification reaction system:

an RPA amplification reaction system for detecting influenza virus H10N3, the reaction system comprising the primer probe set for detecting influenza virus H10N3 of example 1;

the RPA amplification system for detecting influenza virus H10N3 comprises, in 50. Mu.L:

template DNA 1.0-10 mu L;

1.0 to 5.0 mu L of upstream primer;

1.0 to 5.0 mu L of a downstream primer;

probe primer 0.5-5 mu L;

29.5. Mu.L of rehydration buffer (Rehydration Buffer);

0.5 to 2.5 mu L of magnesium acetate;

a dry powder enzyme;

RNase-free water sterilized deionized water was added to 50. Mu.L.

The application method of the kit comprises the following steps:

(1) Extracting an RNA template: extracting RNA in a sample to be detected, and taking RNase-free deionized water as negative control;

(2) RPA amplification reaction: and (3) taking the RNA extracted in the step (1) as a template, and adopting an RPA primer and a probe in a kit to perform RPA amplification reaction in an RPA reaction tube.

Example 3 sensitive detection of RPA primers

(1) The kit of example 2 was provided, and the addition of each reagent was performed according to the following reaction system, specifically including:

2.1. Mu.L of the upstream primer, 2.1. Mu.L of the downstream primer, 0.6. Mu.L of the probe, 29.5. Mu.L of a rehydration buffer (Rehydration Buffer) and 3.2. Mu.L of RNase-free water sterilized deionized water are added to an MIA amplification tube (containing dry powder enzyme), 10. Mu.L of a template is added after the dry powder in the amplification tube is completely dissolved, and the mixture is subjected to instantaneous centrifugation at 2,000rpm, and 2.5. Mu.L of an activator magnesium acetate is added.

(2) The reaction tube was immediately placed in an instrument capable of collecting fluorescent signals, which was set in advance, under MIA reaction conditions of 39 ℃ for 10 minutes, and fluorescent signals were collected every 30S.

The specific sensitivity detection fluorescent signal diagram is shown in fig. 1, the influenza virus H10N3 amplified fluorescent signal can be detected within 4.5 minutes, and the detection sensitivity can be 10 copies/. Mu.L within 10 minutes.

EXAMPLE 4 specific detection of RPA primers

And selecting influenza virus H10N3 and PBS buffer solution as templates to carry out specificity verification of the RPA primer. Directly extracting H10N3 template RNA of influenza virus with purchased kit, measuring its concentration, converting into copy number, and diluting into serial concentration gradient including 10 times ⁶ copies/μL，10 ⁵ copies/μL，10 ⁴ copies/μL，10 ³ copies/μL，10 ² copies/ ^μL 10 copies/. Mu.L and 1 copy/. Mu.L.

The kit of example 2 was provided, and the addition of each reagent to the sample was performed according to the following reaction system, specifically including: 2.1. Mu.L of the upstream primer, 2.1. Mu.L of the downstream primer, 0.6. Mu.L of the probe primer, 29.5. Mu.L of rehydration buffer (Rehydration Buffer), 3.2. Mu.L of RNase-free water sterilized deionized water are added to the MIA amplification tube, 10. Mu.L of template is added after the dry powder in the amplification tube is completely dissolved, and the mixture is subjected to instantaneous centrifugation at 2,000rpm, and 2.5. Mu.L of activator magnesium acetate is added.

The reaction tube is put into an instrument which is set in advance and can collect fluorescent signals, RPA reaction conditions are 39 ℃, the reaction is carried out for 10 minutes, and the fluorescent signals are collected every 30 seconds.

Specific specificity detectionAs shown in Table 1, the identified common bacteria and viruses isolated from oral sputum, respiratory tract, etc., including H1N1, H3N2, rhinovirus, respiratory syncytial virus, etc. (see Table 1 in detail) were selected for conventional culture, and finally concentration was measured, and nucleic acid was extracted and converted to copy number to give a concentration of 10 ⁶ The copies/. Mu.L was extracted using the genome extraction kit produced by Qiagen, and the nucleic acid template was then extracted and the concentration of the nucleic acid template was uniformly adjusted to 10 by Nanodrop measurement ⁶ Non-specific amplification assays were performed using the kit and RPA amplification method described in example 2. As can be seen from Table 1, the influenza virus primer amplification detection only detected influenza virus H10N3, and all the other were negative, and no nonspecific amplification occurred.

Table 1:

nucleic acid type	Judging
		H10N3	+
H3N2	-
		H1N1	-
Rhinovirus virus	-
		Respiratory syncytial virus	-

In the above table "+" indicates that amplification occurred and "-" indicates that no amplification occurred.

Example 5 comparative verification of RPA method and fluorescent quantitative PCR method

Selection of influenza virus H10N3 (10) ⁶ copies/. Mu.L) as a template for performing the correlation verification of RPA amplification and the fluorescent quantitative PCR method.

The RPA reaction is carried out by adding each reagent according to a reaction system in which each gene detection primer and probe are not mixed and added, and amplification is carried out separately, and specifically comprises: 2.1. Mu.L of the upstream primer, 2.1. Mu.L of the downstream primer, 0.6. Mu.L of the probe primer, 29.5. Mu.L of rehydration buffer (Rehydration Buffer), 3.2. Mu.L of RNase-free water sterilized deionized water are added to the MIA amplification tube, 10. Mu.L of template is added after the dry powder in the amplification tube is completely dissolved, and the mixture is subjected to instantaneous centrifugation at 2,000rpm, and 2.5. Mu.L of activator magnesium acetate is added.

The RPA reaction tube is put into an instrument which is set in advance and can collect fluorescent signals, the MIA reaction condition is 39 ℃, the reaction is carried out for 30 minutes, and the fluorescent signals are collected every 30S.

Fluorescent quantitative PCR reaction, according to the detection primer and probe recommended by the world health organization, and amplifying by using a commercial quantitative detection kit, wherein the reaction system is as follows:

m gene:

/>

the reaction conditions are as follows: PCR enzyme activation (pre-denaturation) 15min 95 ℃;

and (3) cyclic amplification:

FIG. 2 shows the sensitivity analysis of the RPA method of this embodiment for detecting influenza B virus, wherein the presence of virus H10N3 can be detected within 5 minutes of the method as shown in FIG. 2, and the single virus gene detection can be completed within 10 minutes; analysis of accuracy fitness results of quantitative PCR amplification results shows that the RPA detection results and the fluorescent quantitative PCR detection results of the embodiment have no significant difference, the fitting rate is 100%, and the current nucleic acid detection gold standard is also the fluorescent quantitative PCR, so that the detection efficiency of the established method is the same as the detection accuracy of the fluorescent quantitative PCR, but the detection time is greatly shortened.

Application example 1 RPA method clinical sample test analysis

Selecting 60 cases of clinical samples to extract nucleic acid (pharyngeal swabs);

clinical samples were tested using the kit of example 2, and the specific results were as follows, no amplified bands were seen, and the samples tested were confirmed to contain no H10N3 by gold standard PCR identification.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.

Claims (10)

1. An RPA-based influenza virus H10N3 rapid detection reagent, which is characterized by comprising a primer group and a probe for detecting influenza virus A H10N 3;

the primer set comprises an upstream primer and a downstream primer, wherein,

the nucleotide sequence of the upstream primer is shown as SEQ ID No.1,

SEQ ID No.1：AGAGAGAGACAATTCTATTGCCTACTGTTACC；

the nucleotide sequence of the downstream primer is shown as SEQ ID No.2,

SEQ ID No.2：GTTGTACCATCGTCCAATGGAAATCAATCC；

the probe is a modified fluorescent probe, the sequence of which is shown as SEQ ID No.3,

SEQ ID No.3：

GGAGTTCTACTTATCAAAACAACTTTGTGCC[int-dT-FAM][THF][BHQ1]

GGTGGGAGCAAGACC(C3 Spacer)。

2. the rapid detection reagent for influenza virus H10N3 based on RPA according to claim 1, wherein the primer and probe are used for detecting HA gene of influenza virus H10N3.

3. The rapid detection reagent for influenza virus H10N3 based on RPA according to claim 1, wherein in the fluorescent probe, FAM is a fluorescent group, BHQ1 is a quenching group, THF tetrahydrofuran modification site, and Spacer C3 is 3' terminal steric modification.

4. An influenza virus H10N3 rapid detection kit based on RPA, which is characterized in that the kit contains the reagent of any one of claims 1-3, and further comprises a buffer solution, an RPA amplification reaction system and an RNA extraction kit.

5. The rapid detection kit for influenza virus H10N3 based on RPA according to claim 4, wherein the RPA amplification reaction system comprises, in 50 μl:

1.0-10 mu L of influenza virus H10N3 template DNA;

1.0 to 5.0 mu L of upstream primer;

1.0 to 5.0 mu L of a downstream primer;

probe primer 0.5-5 mu L;

29.5. Mu.L of rehydration buffer (Rehydration Buffer);

0.5 to 2.5 mu L of magnesium acetate;

a dry powder enzyme;

RNase-free water sterilized deionized water was added to 50. Mu.L;

wherein the initial concentration of the upstream primer and the downstream primer is 1-10 mmol/L, and the initial concentration of the magnesium acetate is 50-280 mmol/L.

6. The method of using the rapid detection kit for influenza virus H10N3 based on RPA according to claim 4 or 5, wherein the method of using the kit comprises the following steps:

(1) Extracting an RNA template: extracting RNA in a sample to be detected;

(2) RPA amplification reaction: taking the RNA extracted in the step (1) as a template, and adopting an RPA primer and a probe in a kit to perform RPA amplification reaction in an RPA reaction tube;

(3) And (5) analyzing the RPA amplification product by fluorescence detection.

7. The method of claim 6, wherein the sample to be tested comprises at least one of an H10N3 liquid chamber quality control.

8. The method of claim 6, wherein the sample to be tested comprises at least one of nasopharyngeal swab holder, oropharyngeal swab holder, and sputum.

9. The method according to claim 6, wherein the PRA amplification reaction is carried out at a temperature of 25℃to 42℃for a period of 1 to 60 minutes.

10. The method of claim 6, wherein the PRA amplification reaction is carried out at a temperature of 39℃for a period of 3 to 15 minutes.

Images