CN116179575A

CN116179575A - Cultivation method of rice with high resistant starch content

Info

Publication number: CN116179575A
Application number: CN202310372559.6A
Authority: CN
Inventors: 刘巧泉; 黄李春; 张昌泉; 李钱峰; 肖颖; 赵微
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2023-04-10
Filing date: 2023-04-10
Publication date: 2023-05-30

Abstract

The invention belongs to the field of rice molecular breeding, and particularly relates to a cultivation method of rice with high resistant starch content; construct (A)SS3aAndSS3bco-knockout vector of gene is created and screened by using agrobacterium-mediated method to obtain simultaneous knockoutSS3aAndSS3bnovel germplasm of the rice with the gene; sequencing results of PCR amplification products show that the target rice is inSS3aAndSS3bthe frame shift mutation of the genes occurs, and the functions are completely lost; digestion Properties and physicochemical Property analysis resultsIt is shown that the display is provided with a display,SS3aandSS3bthe resistant starch content of the gene co-knockout rice is obviously improved, the digestion rate is obviously reduced, the physicochemical quality is also obviously changed, and the nutrition, health and quality of the rice are obviously improved. The method for cultivating the rice with high resistant starch content and the related genetic materials are applied to rice breeding practice, and are expected to bring new breakthrough for breeding new varieties of rice with nutrition and health.

Description

Cultivation method of rice with high resistant starch content

Technical Field

The invention belongs to the field of rice molecular breeding, and particularly relates to a cultivation method of rice with high resistant starch content.

Background

In recent years, the incidence of chronic diseases associated with diet and energy metabolism, such as overweight, obesity, type II diabetes, etc., has increased substantially worldwide, and high consumption of finished starch-based foods is a major contributor to these conditions. Conventional starch is high in energy generally, and is easy to digest, absorb and convert into blood sugar in human small intestine after being eaten; resistant Starch (RS) is a special type of starch that is hardly enzymatically hydrolyzed to glucose in the human small intestine, but is only fermented to beneficial short chain fatty acids in the human large intestine. Therefore, eating the food rich in RS can effectively reduce Glycemic Index (GI), increase satiety and prevent blood sugar related diseases, and can also help to prevent colon cancer and other intestinal related diseases by improving intestinal (large intestine) microenvironment, reducing colon pH value and the like.

Rice is an important staple food crop and is also the main starch intake source for most people worldwide, particularly asian populations. However, the RS content in conventional cultivated rice is typically less than 1%, well below the daily recommended RS intake for humans. Therefore, the breeding of RS-enriched rice is an important direction for rice variety improvement.

Starch is the most main component in rice endosperm, and accounts for more than 80% of endosperm dry weight, and consists of amylose and amylopectin in different proportions. Endosperm amylose and amylopectin composition and structure are key factors in determining rice quality. Starch synthesis in rice endosperm is regulated by a number of enzymes whose genes encoding these enzymes are collectively known as starch synthesis-related genes (Starch synthesis related gene, SSRG). Currently, there have been some successful cases of increasing RS content in rice endosperm by regulating the expression of two SSRG types encoding Starch Branching Enzyme (SBE) and soluble Starch Synthase (SS). For example, the RS content of rice can be remarkably improved by inhibiting or knocking out the expression of SBE3/SBEIIb genes; the SBE1/SBEI gene mutation or the inhibition of the expression of the SBE1/SBEI gene has no obvious effect on the RS level of rice, but the expression of SBE1 and SBE3 genes can be simultaneously inhibited or knocked out, so that the RS content can be further improved by about 15% on the basis of single mutation of SBE3, and the functional redundancy of the two genes in RS formation is shown; in Wx with high amylose content and strong GBSSI enzyme activity ^a Under the allele background, the SS3a/SSIIIa/SSIII-2 gene mutation can obviously improve the RS content of rice to 5% -6%. In addition, the ALK/SSIIa/SSII-3 gene controlling the gelatinization temperature is also an important gene affecting the RS content, and the high-activity SSIIa protein is beneficial to the formation of RS. Apart from these several genes, the role and genetic effects of most SSRG in RS formation are not yet clear. For example, soluble starch synthase III (SSIII or SS 3) referred to herein has two isozymes in rice, encoded by the SS3a/SSIIIa/SSIII-2 and SS3b/SSIIIb/SSIII-1 genes, respectively. The functions of the SS3b gene, the influence on the RS, the interaction with the SS3a gene and the redundancy have not been reported before. The function of further analyzing SSRG is expected to bring new breakthrough for improving the RS content of rice.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a cultivation method of rice with high resistant starch content, and a method for improving the resistant starch content of rice, reducing the starch digestion rate and further improving the nutrition and health quality of rice by knocking out related starch synthesis genes SS3a and SS3b by utilizing a genome editing technology; the rice obtained by the method has obviously reduced digestion rate and better nutrition and health quality.

The aim of the invention is realized by the following technical scheme:

in a first aspect, the present invention provides a soluble starch synthase gene, said soluble starch synthase gene being SS3a and SS3b; gene numbers RAP Locus of SS3a and SS3b are Os08g0191433 and Os04g0624600, respectively.

In a second aspect, the present invention provides an application of a soluble starch synthase gene in cultivating high resistant starch content rice.

The application method comprises the following steps: constructing a common knockout vector of soluble starch synthase genes SS3a and SS3b, introducing the common knockout vector into rice by using an agrobacterium-mediated method, and screening to obtain rice with SS3a and SS3b genes knocked out simultaneously.

Preferably, the co-knockout vector comprises genes SS3a and SS3b, the vector system is CRISPR/Csa9, and the system comprises an intermediate vector SK-gRNA and a final vector pC1300-Cas9.

Preferably, the specific steps of constructing the co-knockout vector of the soluble starch synthase genes SS3a and SS3b are as follows:

step (a): the method comprises the steps of taking an SS3a gene fragment with a sequence shown as SEQ ID NO.1 and an SS3b gene fragment with a sequence shown as SEQ ID NO.2 as target sites, respectively adding GGCA in front of forward sequences of the two target sites, adding AAAC in front of reverse complementary sequences, and artificially synthesizing two pairs of complementary primers shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6; the primers were as follows:

step (b): annealing the primers in the step (a) by a PCR instrument to form a DNA double chain with a sticky end, and respectively connecting the DNA double chain with the sticky end to an intermediate carrier SK-gRNA which is cut by Aar I enzyme; the SK-gRNA vector containing the target site is digested separately, the gRNA fragment is recovered and simultaneously linked into a final vector pC1300-Cas9 by means of a homotail enzyme system.

Preferably, the fragment of the SS3a gene having the sequence SEQ ID NO.1 in step (a) is located on exon 1 of the SS3a gene; the fragment of the SS3b gene with the sequence shown in SEQ ID NO.2 is located on exon 10 of the SS3b gene.

Preferably, the method uses Agrobacterium-mediated methodsThe method comprises the following specific steps of introducing the co-knockout vector into rice: transferring the co-knockout vector into an EHA105 agrobacterium strain, and transfecting the rice callus by adopting an agrobacterium-mediated genetic transformation method; culturing and screening to obtain T ₀ Plants; primers are designed on the sequences of the SS3a and SS3b genes, the target site editing condition of the SS3a and SS3b genes is detected by sequencing after PCR amplification, and the rice with the SS3a and SS3b genes knocked out simultaneously is obtained by screening.

Preferably, the primers are designed on the SS3a and SS3b gene sequences, and the primers are as follows:

sequence name	Sequence(s)	Sequence numbering
			T1 Test-F	GTCAGGACAGTGCAAAACTCCA	SEQ ID NO.9
T1 Test-R	AGAAGGACGAACACTTGGTGGA	SEQ ID NO.10
			T2 Test-F	GCTTCCACCCTTCTCATACACA	SEQ ID NO.11
T2 Test-R	AACAGAACACGGCCAGGTCA	SEQ ID NO.12

。

The resistant starch content in the rice flour prepared by the application of cultivating the rice with high resistant starch content provided by the invention reaches 9.54% -9.73%, which is far higher than 0.58% of that of wild rice.

The invention constructs a co-knockout vector of rice soluble starch synthase genes SS3a and SS3b, introduces the co-knockout vector into a rice variety Nippon sunny, and detects that target sites of the SS3a and SS3b genes are mutated in various types through PCR amplification and sequencing means, which indicates that the co-knockout vector is successfully introduced into a rice receptor and plays a role.

The invention has the following beneficial effects: the invention uses genome editing technology to knock out starch synthesis related genes SS3a and SS3b, and the common gene knockout of SS3a and SS3b can obviously improve the content of resistant starch in rice, obviously reduce the digestion rate, and obviously change the physicochemical quality, thereby obviously improving the nutrition, health and quality. The method for cultivating the rice with high resistant starch content and the related genetic materials are applied to rice breeding practice, and are expected to bring new breakthrough for breeding new varieties of rice with nutrition and health.

Drawings

FIG. 1 is a CRISPR/Cas9 vector construction and mutant material target site sequence alignment. A is a T-DNA structure diagram of a CRISPR/Cas9 vector for co-knocking out SS3a and SS3b genes; b is the alignment of the SS3a and SS3B homozygous mutant lines with sequences near the target sites T1 and T2 in the wild type control (WT). "UTR" means a non-coding sequence; "Exon" means an Exon; "Intron" means an Intron; "Target site" means a Target site; "PAM" means protospacer adjacent region; "WT" means wild-type.

FIG. 2 is an agronomic trait comparison of SS3a and SS3b homozygous mutant lines with wild type control (WT). A is the plant form in the grouting period; b is polished rice grains; C-H is the grain length, grain width, grain thickness, thousand grain weight, chalky grain rate and chalky whiteness, respectively. The scale bars of figures a and B are 10 cm and 5 mm respectively. "x" indicates statistically significant differences at P < 0.01.

FIG. 3 shows comparison of digestion characteristics in SS3a and SS3b homozygous mutant lines versus wild type control (WT) mature rice flour. A-C are the resistant starch content, total digestible starch content and digestion curve, respectively. "x" indicates statistically significant differences at P < 0.01.

FIG. 4 is a comparison of physicochemical properties of the SS3a and SS3b homozygous mutant lines compared to wild type control (WT) mature rice flour. a-D are total starch content, apparent amylose content, triglyceride content and amylose-lipid complex content, respectively; e is RVA viscosity map. "x" indicates statistically significant differences at P < 0.01.

The specific embodiment is as follows:

the invention is further illustrated by the following examples, which are not intended to limit the invention.

The instruments, reagents, materials, etc. used in the examples described below are conventional instruments, reagents, materials, etc. known in the art, and are commercially available in a conventional manner unless otherwise specified. The experimental methods, detection methods, and the like in the examples described below are conventional experimental methods, detection methods, and the like in the prior art unless otherwise specified. Example 1: novel germplasm of high-resistance starch content rice by co-knocking out SS3a and SS3b through CRISPR/Cas9 technology

1. Rice material

A conventional japonica rice (Oryza sativa subsp.geng) variety Nipponbare (hereinafter abbreviated as WT), and 2 SS3a and SS3b genes created with Nipponbare as receptors were co-knocked out of rice material (designated as SS3a-SS3b-1 and SS3a-SS3b-2, respectively). Gene numbers RAP Locus of SS3a and SS3b are Os08g0191433 and Os04g0624600, respectively.

2. Vector construction

The classical CRISPR/Csa9 system was used for gene editing in this study. The T1 sequence located on exon 1 of the SS3a gene and the T2 sequence located on exon 10 of the SS3B gene were selected as target sites, respectively (FIG. 1B). The specific target site sequences are:

T1(SEQ ID NO.1)CAGGCTGAAGGTCGTCATC；

T2(SEQ ID NO.2)AAATGGACTGTCAAATGGG；

the target sites are designed as primers according to the CRISPR/Cas9 system requirements used. The specific operation is that GGCA is added before the forward sequence of the target site, AAAC is added before the reverse complementary sequence, and the target site is synthesized by biological company, and the specific primer sequence is as follows:

T1-F(SEQ ID NO.3)ggcaCAGGCTGAAGGTCGTCATC；

T1-R(SEQ ID NO.4)aaacGATGACGACCTTCAGCCTG；

T2-F(SEQ ID NO.5)ggcaAAATGGACTGTCAAATGGG；

T2-R(SEQ ID NO.6)aaacCCCATTTGACAGTCCATTT；

the target site primer was mixed and denatured to form fragments with cohesive ends, which were ligated into the intermediate vector SK-gRNA digested with Aar I enzyme (Fermentas). The ligation products (SK-gRNA-T1 and SK-gRNA-T2) were transformed into E.coli, respectively, and then sequenced using the universal primer T3. The intermediate vector, which was sequenced correctly, carrying the SS3a and SS3b gene target sites was digested separately with the homotail enzyme system, while being ligated into the final vector pC1300-Cas9 digested with Kpn I and BamH I. The ligation product (pC 1300-Cas 9-T1-T2) was transformed into E.coli and then sequenced using vector primer pC1300-F (FIG. 1A).

T3(SEQ ID NO.7)ATTAACCCTCACTAAAGGGA；

pC1300-F(SEQ ID NO.8)ACACTTTATGCTTCCGGCTC。

3. Genetic transformation

The recombinant vector plasmid pC1300-Cas9-T1-T2 with correct sequencing is transferred into an EHA105 agrobacterium strain, and the agrobacterium-mediated genetic transformation method is adopted to infect rice callus. After 3 days of co-cultivation, the cells were cultured on a screening medium containing hygromycin for 2 weeks. Culturing the selected resistant callus on a pre-differentiation medium for about 10 days, transferring the pre-differentiated callus to a differentiation medium for culturing, and obtaining the resistant transgenic T about one month ₀ And (5) replacing plants.

4. Detection and screening of mutant plants

Taking T ₀ The genome DNA of the tender leaves of the tissue culture Miao You is rapidly extracted by a CTAB method and is used for mutation type detection. Primers were designed on the SS3a and SS3b gene sequences, PCR amplified DNA fragments containing the target sites, and the products were sequenced by company. The sequencing result is mapped by using an online decoding website DSDecodeM (http:// skl. Scau. Edeu. Cn/dsDecode /) or manual decoding modeAnd analyzing to obtain mutation information. The mutant individual was further planted, homozygous lines were screened, and the transgenic traces were removed using hygromycin primer detection.

The sequences of the amplification primer and the hygromycin detection primer (Hyg-1/2) for detecting the mutation condition of the target sites of SS3a (T1 Test-F/R) and SS3b (T2 Test-F/R) are respectively as follows:

T1 Test-F(SEQ ID NO.9)GTCAGGACAGTGCAAAACTCCA；

T1 Test-R(SEQ ID NO.10)AGAAGGACGAACACTTGGTGGA；

T2 Test-F(SEQ ID NO.11)GCTTCCACCCTTCTCATACACA；

T2 Test-R(SEQ ID NO.12)AACAGAACACGGCCAGGTCA；

Hyg-1(SEQ ID No.13)GCTTCTGCGGGCGATTTGTGT；

Hyg-2(SEQ ID No.14)GGTCGCGGAGGCTATGGATGC；

through multiple generations of screening, we obtained 2 homozygous lines with both SS3a and SS3b genes knocked out, designated SS3a-SS3b-1 and SS3a-SS3b-2, respectively. In SS3a-SS3b-1, one T base is inserted at the SS3a gene target site, and 4 bases (AAAT) are deleted at the SS3b gene target site; in SS3a-SS3b-2, one A base is inserted at the SS3a gene target site, and 2 bases (AA) are deleted at the SS3b gene target site. In both SS3a-SS3B-1 and SS3a-SS3B-2, both the SS3a and SS3B genes were frame-shift mutated and functional SS3a and SS3B proteins could not be synthesized (FIG. 1B).

5. Agronomic trait investigation

Plant morphology and seed morphology were examined for ss3a-ss3b-1, ss3a-ss3b-2 and wild type controls. The results showed that the plant morphology, grain length and grain width of ss3a-ss3b-1 and ss3a-ss3b-2 were not significantly changed compared to the wild type control, but the grain thickness and thousand grain weight were significantly reduced, the chalkiness and chalkiness were significantly increased (fig. 2, table 1).

Table 1. Agronomic traits of ss3a-ss3b mutants compared with wild type controls.

All data are mean ± standard deviation, n >2, "x" indicates very significant differences, and no indication indicates no significant differences.

6. Analysis of digestion Properties

Digestion characteristics in ss3a-ss3b-1, ss3a-ss3b-2 and wild-type control mature rice flour were analyzed using a digestion and resistant starch detection kit (Megazyme, cat# K-DSTRS) and an in vitro digestion assay. The results showed that the resistant starch content in ss3A-ss3b-1 and ss3A-ss3b-2 rice flour was significantly increased to 9.54% -9.73% far above 0.58% for wild type rice (FIG. 3A, table 2); at the same time the total digestible starch content was significantly reduced (fig. 3B, table 2) and the digestion curve was significantly slowed down (fig. 3C, table 3). These results indicate that co-knockout of SS3a and SS3b genes can significantly improve the nutritional health quality of rice.

Table 2.Ss3a-ss3b mutants were compared to the resistant starch content and total digestible starch content of the wild-type control.

All data are mean ± standard deviation, n=3, "×" indicating very significant differences, no indication indicating no significant differences.

Table 3. Digestibility of ss3a-ss3b mutants compared to wild type control at different time points.

7. Physical and chemical quality analysis

To further clarify the effect of SS3a and SS3b gene co-knockout on rice quality, we analyzed the total starch content, apparent amylose content, triglyceride content, amylose-lipid complex content and viscous profile in SS3a-SS3b-1, SS3a-SS3b-2 and wild-type control mature rice flour. The results showed that the total starch content in the ss3a-ss3b-1 and ss3a-ss3b-2 rice flour was significantly reduced and the apparent amylose content, triglyceride content, amylose-lipid complex content were all significantly increased (fig. 4A-D, table 4); rapid Viscosity Analysis (RVA) profile showed a significant drop in the viscous curves of ss3a-ss3b-1 and ss3a-ss3b-2 overall (figure 4E). These results all indicate that the physicochemical quality of the SS3a and SS3b gene co-knockout rice is significantly changed.

Table 4. Comparison of rice physicochemical properties of ss3a-ss3b mutants with wild type control.

In conclusion, we successfully created co-knocked rice material of SS3a and SS3b genes in Japanese sunny background of japonica rice variety by using CRISPR/Cas technology, so that functions of the two genes are completely lost. The digestion characteristics and physicochemical quality analysis results show that the resistant starch content of the SS3a and SS3b gene co-knocked-out rice is obviously improved, the digestion characteristics are obviously improved, and simultaneously, the physicochemical quality is also obviously changed.

The above examples are provided to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. Various changes and modifications made by those skilled in the art in light of the present disclosure are intended to be included within the scope of the appended claims without departing from the scope and spirit of the present disclosure.

Claims

1. A soluble starch synthase gene, characterized in that the soluble starch synthase gene is SS3a and SS3b; gene numbers RAP Locus of SS3a and SS3b are Os08g0191433 and Os04g0624600, respectively.

2. Use of the soluble starch synthase gene according to claim 1 for breeding high resistant starch content rice.

3. The application according to claim 2, characterized in that the method of application is as follows: constructing a common knockout vector of soluble starch synthase genes SS3a and SS3b, introducing the common knockout vector into rice by using an agrobacterium-mediated method, and screening to obtain rice with SS3a and SS3b genes knocked out simultaneously.

4. The use according to claim 3, wherein the co-knockout vector comprises genes SS3a and SS3b, the vector system is CRISPR/Csa9, and the system comprises intermediate vector SK-gRNA and final vector pC1300-Cas9.

5. The use according to claim 3, wherein the specific steps for constructing the co-knockout vector of soluble starch synthase genes SS3a and SS3b are as follows:

sequence name Sequence(s) Sequence numbering T1-F ggcaCAGGCTGAAGGTCGTCATC SEQ ID NO.3 T1-R aaacGATGACGACCTTCAGCCTG SEQ ID NO.4 T2-F ggcaAAATGGACTGTCAAATGGG SEQ ID NO.5 T2-R aaacCCCATTTGACAGTCCATTT SEQ ID NO.6

；

6. The use according to claim 5, wherein the fragment of the SS3a gene of step (a) having the sequence shown in SEQ ID No.1 is located on exon 1 of the SS3a gene; the fragment of the SS3b gene with the sequence shown in SEQ ID NO.2 is located on exon 10 of the SS3b gene.

7. The use according to claim 3, characterized in that the specific procedure for introducing the co-knockout vector into rice by means of agrobacterium-mediated method is as follows: transferring the co-knockout vector into an EHA105 agrobacterium strain, and transfecting the rice callus by adopting an agrobacterium-mediated genetic transformation method; culturing and screening to obtain T ₀ Plants; primers are designed on the sequences of the SS3a and SS3b genes, the target site editing condition of the SS3a and SS3b genes is detected by sequencing after PCR amplification, and the rice with the SS3a and SS3b genes knocked out simultaneously is obtained by screening.

8. The use according to claim 7, wherein primers are designed on the SS3a and SS3b gene sequences as follows:

。