CN116179570A - Pathogen-specific nucleic acid gene of Proteus mirabilis and detection method - Google Patents

Abstract

The invention discloses a pathogen-specific nucleic acid gene of Proteus mirabilis and a detection method, wherein the nucleotide sequence of the gene is at least one part of any one sequence of sequence table Seq ID No. 4-Seq ID No. 10 or the complementary sequence thereof. Carrying out PCR reaction by taking clinical sample DNA as a template, wherein forward primers in amplification primers used in the PCR reaction are SEQ ID NO:1, a step of; the reverse primer is SEQ ID NO:2; the target sequence SEQ ID NO of crRNA used with the primer pair: 3 is shown in the figure; detection was performed using LbCas12a, crRNA and ssDNA-reporter. The pathogen-specific nucleic acid fragment provided by the invention can be used for rapidly identifying the Proteus mirabilis pathogen, and has high accuracy and short detection period in clinical application.

Description

Pathogen-specific nucleic acid gene of Proteus mirabilis and detection method

Technical Field

The invention relates to a pathogen-specific nucleic acid gene of Proteus mirabilis and a detection method, and belongs to the technical field of genetic engineering.

Background

Clinical antibiotic use relies on the identification of pathogenic bacteria, providing doctors with targeted medication guidelines. The current traditional method for detecting pathogenic bacteria clinically is a culture method, which is used for identifying pathogenic bacteria species by collecting body fluid of a patient and performing colony culture, and is also a gold standard for the current clinical microbiological test. The culture method is complex to operate, 1) a body fluid sample of a patient is collected by aseptic operation; 2) Transferring the body fluid sample into a corresponding sterile culture bottle for culture, and inoculating to a flat-plate culture dish; 3) Selecting a monoclonal to carry out color-dyeing inspection and observation, and carrying out differential growth experiments or various biochemical tests on a selective medium; 4) Identification is achieved according to the phenotypic characteristics and physiological characteristics of pathogenic bacteria, and data is provided to clinicians. The traditional culture method is long in time (the process requires 2-5 days), meanwhile, certain pathogenic bacteria have strict requirements on culture conditions, and the culture can fail, so that detection fails. In addition, contamination often occurs during bacterial culture and isolation, leading to the appearance of false positive results. The above-described false positive and false negative conditions often lead to misdiagnosis and antibiotic misuse.

Among the major pathogenic enterobacteriaceae, proteus mirabilis is one of the least studied pathogenic bacteria to date. For a long time researchers have considered that Proteus mirabilis belongs to a conditional pathogen, and can cause symptomatic infections of the urinary tract, including cystitis and pyelonephritis, and are present in asymptomatic cases of mycouria, especially in elderly and type 2 diabetics. These infections can also cause sepsis and develop into potentially life threatening uremia. In addition, in addition to urinary tract infections, the species can cause infections of the respiratory tract, eyes, ears, nose, skin, throat, burns and wounds, and are associated with neonatal meningoedema, pulmonary oedema and osteomyelitis. Certain studies suggest that Proteus mirabilis is also associated with rheumatoid arthritis. For departments such as ICU, the rapid and accurate acquisition of etiology information is urgently needed to timely and reasonably develop antibacterial treatment so as to improve clinical characterization of patients and increase treatment rate. However, the current technology for detecting clinical pathogenic bacteria, the traditional culture method, is far from meeting the requirements of clinical diagnosis and treatment.

Disclosure of Invention

The invention aims to: in order to overcome the defects in the prior art, the invention provides a pathogen-specific nucleic acid gene of Proteus mirabilis and a detection method.

The technical scheme is as follows: in order to achieve the above purpose, the invention adopts the following technical scheme:

a pathogen-specific nucleic acid gene of Proteus mirabilis, whose nucleotide sequence is at least a part of any one of the sequences SEQ ID No. 4-SEQ ID No. 10 of the sequence Listing, or the complement thereof.

Preferably: the primers for amplification include SEQ ID NO:1 and SEQ ID NO:2, and a sequence shown in seq id no.

Preferably: at least part of the sequence of the amplified product is taken as crRNA of target sequence, the target sequence of crRNA comprises SEQ ID NO: 3.

A method for the specific detection of a pathogen-specific nucleic acid gene of proteus mirabilis, comprising the steps of:

s101, specificity test: respectively carrying out cross PCR reaction on the amplified primer and the corresponding crRNA;

the forward primer in the amplification primer is SEQ ID NO:1, a step of; the reverse primer in the amplification primer used is SEQ ID NO:2; the target sequence SEQ ID NO of crRNA used with the primer pair: 3 is shown in the figure;

s102, detecting through agarose electrophoresis after the PCR reaction is finished, and judging the specificity of the primer according to whether the result of the gel diagram shows that the apparent bright band of the size of the target DNA exists.

A method for testing a pathogen-specific nucleic acid gene of proteus mirabilis, comprising the steps of:

step 1, extracting clinical sample DNA with Proteus mirabilis;

step 2, performing cross PCR reaction by taking the clinical sample DNA obtained in the step 1 as a template to obtain unpurified PCR reaction stock solution, wherein forward primers in amplification primers used in the PCR reaction are SEQ ID NO:1, a step of; the reverse primer in the amplification primer used is SEQ ID NO:2;

step 3, detecting unpurified PCR reaction stock solution by using LbCAs12a, crRNA and ssDNA-reporter, and using target sequence SEQ ID NO:3 is shown in the figure; the detection result is then determined based on the fluorescent signal.

A kit for detecting a pathogen having a pathogen-specific nucleic acid gene of proteus mirabilis, comprising amplification primers for use in a PCR reaction having forward primers of SEQ ID NO:1, a step of; the reverse primer in the amplification primer used is SEQ ID NO:2; the target sequence SEQ ID NO of crRNA used with the primer pair: 3, a step of;

crRNA having trans-cleavage activity of a Crispr/Cas family nuclease, targeting at least part of the sequence of the amplification product, and a single-stranded DNA reporter molecule having a fluorescent group and a quencher group at the 5 'and 3' ends, respectively, wherein the proteus mirabilis pathogen-specific nucleic acid fragment is selected from the group consisting of SEQ ID NOs: 4-10, or a complement thereof.

Preferably: the Crispr/Cas family nuclease is LbCAs12.

Compared with the prior art, the invention has the following beneficial effects:

the pathogen-specific nucleic acid fragment provided by the invention can be used for rapidly identifying pathogens, and has high positive detection rate and short detection period (for example, less than 3 hours) when being clinically applied.

Drawings

FIG. 1 is a flow chart of a method of obtaining pathogen-specific nucleic acid fragments as described herein.

Fig. 2 is a schematic diagram showing trans-cleavage activity of Cas12a.

FIG. 3 shows the primers set forth in SEQ ID NO:1 and SEQ ID NO:2 electrophoresis results of amplified products after conventional PCR amplification of DNA templates of various clinically common pathogens are tested.

FIG. 4 shows the fluorescent signal results of detection of different amplification products using LbCAs12a and crRNA.

Detailed Description

The present invention is further illustrated in the accompanying drawings and detailed description which are to be understood as being merely illustrative of the invention and not limiting of its scope, and various equivalent modifications to the invention will fall within the scope of the appended claims to the skilled person after reading the invention.

A method for obtaining a pathogen-specific nucleic acid gene of Proteus mirabilis, as shown in FIG. 1, comprises the following steps:

1) Obtaining the whole genome sequence: the whole genome sequences of hundreds of common microorganisms are obtained from public databases such as NCBI.

2) Obtaining the intra-species common sequence of the same bacteria.

3) Obtaining the specific sequence between the seeds.

4) Removal of the repeated sequence: the repeated sequence is overlaid using a RepeatMasker et al tool.

In this way, we obtained the nucleotide sequences of Proteus mirabilis shown in SEQ ID NO: 4-10.

After the sequences of these pathogen-specific nucleic acid fragments are obtained, they can be conveniently used to detect various pathogens in a patient or patient sample. The sequences of these pathogen-specific nucleic acid fragments may themselves be included in some detection kits, for example, as positive controls. It is understood that the full length of the specific nucleic acid fragment (SEQ ID NO: 4-10) for Proteus mirabilis provided by the present invention can be detected during the detection; alternatively, only a partial fragment thereof is detected.

The CRISPR/Cas system is the most widely used gene editing system at present, has the potential of targeted cutting of nucleic acid molecules, and achieves the aim of site-directed editing. Currently, cas protein families have identified a number of proteins that contain editing potential, with CRISPR/Cas9 and CRISPR/Cas12a being the most widely used. The CRISPR/Cas system has simple composition, consists of Cas protein and crRNA which play the role of nucleic acid cleavage, and the guide RNA contains a specific nucleic acid sequence of a target gene. By replacing target gene sequences in crRNA, editing of different sites can be realized, and simultaneous editing of multiple sites can be realized by connecting different crRNAs in series. Cas protein is guided to a target site by crRNA, the target site is cut by the Cas protein, a break is generated on a DNA chain, and then a corresponding DNA repair mechanism is activated, so that mutation and the like are introduced to damage the target site.

In recent years, cas12a was found to have both 1) cis (cis) cleavage activity targeted to cleave DNA and 2) trans (trans) cleavage activity non-specifically cleaving any single-stranded DNA (see fig. 2). When the Cas12a-crRNA complex binds to the target site, the trans-cleaving activity of Cas12a will be stimulated, and Cas12a has the ability to cleave any surrounding single-stranded DNA molecule, and this activity is independent of the sequence of the single-stranded DNA. The presence of the target molecule can be demonstrated by detecting the presence of single-stranded DNA by cleavage of the single-stranded DNA with trans-cleavage activity after Cas12a binds to the target molecule. The flow is as follows: 1) Enriching specific nucleic acid fragments of the Proteus mirabilis in the sample to be detected by using a nucleic acid amplification technology, and improving the specificity; 2) The amplified product is detected using Cas12a and crRNA and a single stranded reporter DNA, and if a proteus mirabilis specific nucleic acid fragment is in the amplified product, cas12a will cleave the reporter DNA, producing a fluorescent signal.

In some embodiments, the crRNA used in conjunction with Cas12crRNA consists of a backbone region (backbone) of 21nt and a seed region (seed region/spacer) of 20-24 nt for identifying the target sequence of interest. In a more specific embodiment, the sequence of the crRNA synthesized by in vitro transcription is: 5'-AAUAGAACAUUCUAUCUUCAAUCUACACUUAGUAGAAAUUACCUAUAGUGAGUCGU AUUA-3' (SEQ ID NO: 11). In some embodiments, the corresponding crRNA can be obtained by in vitro transcription using T7 RNA polymerase using DNA as a template, and pure crRNA can be obtained by purification.

The single-stranded reporter DNA molecule has a fluorophore modification at one end and a quencher modification at one end. Due to the presence of the quenching group, the complete single-stranded reporter DNA molecule does not generate a fluorescent signal, and after the trans-cleavage activity of Cas12a is stimulated, the single-stranded reporter DNA molecule is cleaved such that the quenching group is separated from the fluorescent group, generating a fluorescent signal. The presence or intensity of the fluorescent signal indicates the presence or amount of amplification product.

We first obtained intraspecies specific DNA sequences for proteus mirabilis and designed and synthesized specific crrnas for targeted recognition of the pathogen based on these sequences. Next, we used escherichia coli prokaryotic expression and purified the LbCas12a protein from Mao Luogan bacteria (Lachnospiraceae bacterium), verifying that the protein possesses cis and trans cleavage activity. Subsequently, using single-stranded reporter DNA, lbCas12a protein and specific crRNA, assisted with PCR amplification techniques, a CRISPR/Cas12 a-based pathogen detection method was developed and its accuracy and specificity were verified. Finally, rapid detection of clinical samples of severe pneumonia patients was achieved within 3 hours using CRISPR/Cas12 a-based pathogen detection tools. The pathogenic bacteria detection method based on CRISPR/Cas12a is expected to become a novel and rapid clinical pathogenic bacteria detection means, and provides important technical support for improving diagnosis and treatment level of severe pneumonia.

In some embodiments of the invention, the trans-cleavage activity of Cas12a is used to detect pathogen-specific nucleic acid fragments or amplification products thereof, which further increases the specificity of detection due to the need for complementary pairing binding of crRNA to target DNA.

The nucleic acid sequences mentioned in the present invention are as follows:

SEQ ID NO:1 Forward primer

CGCTGTATGGATTCGCTGAATTT

SEQ ID NO:2 reverse primer

TTAACTTTTTCACGGCCTTATTCT

SEQ ID NO:3 seed sequence

TGAAGATAGAATGTTCTATT

SEQ ID NO: specific fragment of Proteus mirabilis 4

AAGCGCTGTATGGATTCGCTGAATTTTTTCTTGGCCATATTTTTTCCTTATGACTTCTCGAATATAGAAAAATGACAAAAGTACTCTAGCATTGAGTTATCTATAAAATGAATGGCGGGCTAGTTTTAAATATTATCTTAGGTCATTTATTATGACCTAGGTCTTTTAAATTAAAAAATAATTTAATAAATAATAAATTTTTGAAGATAGAATGTTCTATTATTAATAAATAGCCCATTAAAGAGATATTGAACAAATTGAAAATAAAGGTGTTTTTAAAAAAAATTGTTATTTTAGCTTAAAACACATTAAATTTATTAATATAGTAAAGAATAAGGCCGTGAAAAAGTTAATCTTGAAGAGATCATTCTGAGACT

SEQ ID NO:5 Proteus mirabilis specific fragments

ATATTTAAAAGTGATATTATTATTTTATAATCATTTATATATATTTACATTATTTTTATTTT A

SEQ ID NO:6 Proteus mirabilis specific fragments

TATTATTTTACGCTTCTTTTTTATGGCTTTTTTCTCAGCCATTTTTATGTATTTA

SEQ ID NO:7 Proteus mirabilis specific fragments

TTAGCAATAGCTATTATATTAGCCCTAATATATCAATATATTTATTAGGGCTAATAGTTA TATT

SEQ ID NO:8 Proteus mirabilis specific fragments

AATAATTTATTGTTATAATTTAAATATTGTTAAGTTATTATACTTAAATTCTGATTTTAAT TATTATTT

SEQ ID NO:9 Proteus mirabilis specific fragments

ATAAATAAAAAACCAAGGCAAGAAAATCAAAGTATAAAATATAAAGTAATA

SEQ ID NO:10 Proteus mirabilis specific fragments

AAATAAAAAAACATAAAGATACATATACAAATTTCCCTATCCAAATAAAACATAAAAATAATTTATCAATATTTTTTAATTATAATAAGCAAAATTAGAATAGATTAAAGATAGTCATAAATAGATAAAATAAAGATA

SEQ ID NO:11 Proteus mirabilis crRNA sequence

AAUAGAACAUUCUAUCUUCAAUCUACACUUAGUAGAAAUUACCUAUAGUGAGU CGUAUUA

The invention is further illustrated by the following specific examples.

Example 1 specificity verification of CRISPR/Cas-based pathogen detection methods

Pathogenic bacteria used for detection are all derived from a critical care unit of the drummer hospital, are isolated and cultured from clinical samples of patients with severe pneumonia, and are determined by a microbial clinical laboratory of the drummer hospital (each pathogenic bacteria has two groups and is respectively derived from different patients).

1. Specificity test

In order to prove the specificity and reliability of a pathogenic bacteria detection method based on a CRISPR/Cas system, a cross detection experiment is carried out on an amplification primer and corresponding crRNA respectively.

1.1 primer specificity test

In order to determine the specificity of the amplification primers, the amplification primers for Proteus mirabilis respectively take genomic DNA extracted from Proteus mirabilis and other 11 common clinical pathogenic bacteria as templates for cross PCR reaction.

The forward and reverse primers of the amplification primers used were:

SEQ ID NO:1 and 2, for amplification of genomic DNA of Proteus mirabilis;

the target sequence (or seed region) of crRNA used in combination with the above primer pair is set forth in SEQ ID NO: 3.

Examples of the design of amplification primers and crRNA sequences using Proteus mirabilis pathogen-specific nucleic acid fragments are shown below, wherein the sequences corresponding to the upstream and downstream primers (SEQ ID NOS: 1 and 2) are underlined, the target sequence of crRNA (SEQ ID NO: 3) is underlined, and the PAM sequence is boxed.

According to I-5 ^TM PCR was performed using Master Mix (TsingKe) protocol, wherein I-5 ^TM 2X High-Fidelity Master Mix μl, SEQ ID:1 primer 2 μl, SEQ ID:2 primer 2. Mu.l, template DNA 50ng, add water to 50. Mu.l. Amplification was performed in the following procedure: 98℃for 2min, (98℃10S,52℃10S,72℃15S) 30-35 cycles, 72℃for 5min. The PCR amplification is provided with corresponding positive control and negative control, and the genome DNA of the target pathogenic bacteria and water are respectively used as amplification templates.

After the PCR reaction is finished, judging the specificity of the primer according to the result of the gel diagram and whether the obvious bright band of the size of the target DNA exists.

1.2 CrRNA specificity assay

PCR products amplified with the corresponding primers were detected separately using LbCAs12a and the crRNA designed for the pathogen specific DNA sequences, 3 replicates were set per sample. The reaction is as follows: 1.1 PCR product/unpurified PCR reaction solution 2. Mu.l, reaction buffer 2. Mu.l, lbCAs12a 1300ng,crRNA 180ng,ssDNA-reporter (10. Mu.M) 1. Mu.l, and water to 20. Mu.l.

Wherein the structure and sequence of ssDNA-reporter are: the 5'-TTATT-3',5 'end is FAM, and 3' end is BHQ1.

The reaction solution is added into a 384-well plate to react for 30 to 45 minutes at 37 ℃. After the reaction, the fluorescence value of each well was detected by using an enzyme-labeled instrument (Infinite M200 Pro multifunctional enzyme-labeled instrument, austra Tecan), and the detection parameters were set as follows:

/>

2. experimental results

2.1 primer specificity test results

As shown in FIG. 3, although only a small amount of nonspecific bands were present in the individual non-target pathogens, a large amount of target DNA products could be amplified when the genomic DNA of the corresponding pathogens was used as a template, indicating that the primers amplified against Proteus mirabilis had good specificity.

2.2 crRNA specificity test results

The PCR reaction solution after the amplification of the corresponding primer was detected by using LbCAs12a and crRNA against Proteus mirabilis. The fluorescence results of fig. 4 show that: the detection system of the Proteus mirabilis pathogenic bacteria only can generate obvious fluorescent signals when the genomic DNA of the Proteus mirabilis pathogenic bacteria is used as a template to carry out PCR amplification on amplification products, and the fluorescent signal intensity of other non-target pathogenic bacteria is consistent with that of negative control, which shows that the specificity of the detection method is excellent due to the combination with crRNA.

Example 2 detection of severe pneumonia patients clinical samples Using CRISPR/Cas System

1. Experimental operation

The 12 clinical samples (sputum or alveolar lavage) were all derived from the drummer hospital intensive care unit and compared to the pathogenic bacteria type determined by the drummer hospital microbiological clinical laboratory using traditional culture separation detection methods.

1.1 extraction of clinical sample DNA by kit method

Extraction of clinical sample DNA complete reference Quick-DNA/RNA ^TM Pathogen Miniprep Kit (ZYMO RESEARCH) product description, the operation steps are briefly described as follows:

a) mu.L of DNA/RNA Shield reagent was added to 50-200. Mu.L of the sample, vortexed for 60s, and centrifuged at 16,000Xg for 1min.

b) mu.L of the supernatant was aspirated, 2. Mu.L of protease K was added and mixed well.

c) 1ml of Pathogen DNA/RNA buffer reagent was added, mixed well, left at room temperature for 5min, and transferred to a DNA binding column.

d) 16,000Xg, 30s, the filtrate was discarded.

e) Mu.l Wash buffer,16,000Xg, 30s was added and the filtrate was discarded. This step is repeated once.

f) Mu.l ethanol (95-100%) was added, 16,000Xg, 1min, and the DNA binding column transferred to a new 1.5ml centrifuge tube. g) And sucking 50 μl of DNase-free water at 65deg.C into the middle of the centrifugal column, standing at room temperature for 2-5 min,16,000Xg for 1min, and collecting eluate to obtain genomic DNA-containing solution.

1.2PCR amplification of target sequences

PCR amplification reactions were performed using the extracted total DNA of the clinical samples as templates, using the 1 pair primers described in example 1, respectively. The template used in the positive control group is the genome DNA of Proteus mirabilis, and the template in the negative control group is water.

The PCR reaction system and the reaction conditions were the same as in example 1.

1.3Cas12a assay

Unpurified PCR reaction stocks were detected using LbCAs12a, crRNA and ssDNA-reporter. Setting 3 repeats for the same sample to be tested;

the reaction system and the reaction conditions were the same as in example 1.

2. Experimental results

And (3) respectively carrying out PCR amplification on total DNA of 12 clinical samples of severe pneumonia patients by using 1 pair of amplification primers, and then detecting corresponding PCR reaction liquid by using single-stranded report DNA, lbCAs12a and specific crRNA of Proteus mirabilis. The detection results based on the fluorescent signal determination are shown in table 1 and compared with the conventional culture method.

TABLE 1 comparison of Proteus mirabilis detection results in clinical samples of 12 alveolar lavage fluids

As can be seen from table 1, detection of proteus mirabilis based on CRISPR/Cas12a detection No. 1, and detection of proteus mirabilis in clinical sample No. 10, the remaining samples showed negative. The result is consistent with the culture result and the second generation sequencing result.

In summary, compared with the traditional detection method relying on pathogen isolation and culture, the CRISPR/Cas12 a-based pathogen detection tool developed by the present study shows good detection effect, especially for low-load samples, and shortens the traditional detection period from days to within 4 hours, thus preliminarily proving that the detection method can be used as a potential detection tool for rapidly diagnosing the presence of proteus mirabilis in clinical samples. In addition to Proteus mirabilis, the identification of pathogenic microorganisms for a variety of other infectious diseases can be performed in a similar manner based on specific nucleic acid fragments of the numerous pathogens provided herein.

The foregoing is only a preferred embodiment of the invention, it being noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the present invention, and such modifications and adaptations are intended to be comprehended within the scope of the invention.

Claims (7)

1. A proteus mirabilis pathogen-specific nucleic acid gene, characterized in that: the nucleotide sequence of the polypeptide is at least one part of any one sequence in a sequence table SeqID No. 4-Seq ID No. 10 or the complementary sequence thereof.

2. The pathogen-specific nucleic acid gene of Proteus mirabilis according to claim 1, wherein: the primers for amplification include SEQ ID NO:1 and SEQ ID NO:2, and a sequence shown in seq id no.

3. The pathogen-specific nucleic acid gene of proteus mirabilis according to claim 2, characterized in that: at least part of the sequence of the amplified product is taken as crRNA of target sequence, the target sequence of crRNA comprises SEQ ID NO: 3.

4. A method for the specificity detection of a pathogen-specific nucleic acid gene of proteus mirabilis as defined in claim 1, comprising the steps of:

s101, specificity test: respectively carrying out cross PCR reaction on the amplification primers and the corresponding strain genome;

the forward primer in the amplification primer is SEQ ID NO:1, a step of; the reverse primer in the amplification primer used is SEQ ID NO:2;

s102, detecting through agarose electrophoresis after the PCR reaction is finished, and judging the specificity of the primer according to whether the result of the gel diagram shows that the apparent bright band of the size of the target DNA exists.

5. A method for testing a pathogen-specific nucleic acid gene of proteus mirabilis as defined in claim 1, comprising the steps of:

step 1, extracting clinical sample DNA with Proteus mirabilis;

step 2, performing PCR reaction by taking the clinical sample DNA obtained in the step 1 as a template to obtain unpurified PCR reaction stock solution, wherein forward primers in amplification primers used in the PCR reaction are SEQ ID NO:1, a step of; the reverse primer in the amplification primer used is SEQ ID NO:2;

step 3, detecting unpurified PCR reaction stock solution by using LbCAs12a, crRNA and ssDNA-reporter, and using target sequence SEQ ID NO:3, and then determining the detection result based on the fluorescence signal.

6. A kit for detecting a pathogen having the pathogen-specific nucleic acid gene of proteus mirabilis as defined in claim 1, wherein: the forward primer in the amplification primer used in the PCR reaction is SEQ ID NO:1, a step of; the reverse primer in the amplification primer used is SEQ ID NO:2; the target sequence SEQ ID NO of crRNA used with the primer pair: 3, a step of;

crRNA having trans-cleavage activity of a Crispr/Cas family nuclease, targeting at least part of the sequence of the amplification product, and a single-stranded DNA reporter molecule having a fluorescent group and a quencher group at the 5 'and 3' ends, respectively, wherein the proteus mirabilis pathogen-specific nucleic acid fragment is selected from the group consisting of SEQ ID NOs: 4-10, or a complement thereof.

7. The kit of claim 6, wherein: the Crispr/Cas family nuclease is LbCAs12.

Images