CN116179547A

CN116179547A - Method for improving WAS protein expression in human cells

Info

Publication number: CN116179547A
Application number: CN202211502055.3A
Authority: CN
Inventors: 马奎莹; 于玲玲; 陆智伟; 方日国; 袁鹏飞
Original assignee: Edigene Biotechnology Inc
Current assignee: Edigene Biotechnology Inc
Priority date: 2021-11-26
Filing date: 2022-11-28
Publication date: 2023-05-30

Abstract

Disclosed herein is a method of increasing the expression of a WAS protein (WASp) in a human cell, the method comprising editing a mutant WAS gene in a human cell using a CRISPR/Cas9 system and a homologous recombination nucleic acid. The method disclosed by the application is characterized in that on the basis that 80-90% of endogenous WAS is edited, homologous recombination is carried out into 20-30% of coWAS, and successful human cells are integrated, so that the method has the potential of improving the WASp expression of patients in vivo and recovering the functions of related blood cells.

Description

Method for improving WAS protein expression in human cells

Cross Reference to Related Applications

The present application claims priority from chinese patent application No. 202111422632.3 filed at 2021, 11, 26, which is incorporated herein by reference in its entirety.

Technical Field

The present application relates to the field of gene editing technology, and in particular, to a method for increasing the expression of WAS protein (WASp) in human cells.

Background

Wiskott-Aldrich syndrome (also known as WAS syndrome, eczematous thrombocytopenia associated immunodeficiency syndrome, wiskott-Aldrich syndrome, WAS) is an X-linked primary immunodeficiency disease whose pathogenic principle is the expression or functional deletion of the Wiskott-Aldrich protein (WASp) due to mutation of the WAS gene. Since WASP protein is widely expressed in hematopoietic cells, it is involved in the manifestation of thrombocytopenia, eczema, immunodeficiency, susceptibility to autoimmune diseases and malignant tumors, and the like.

The WAS gene encodes a protein that modulates actin cytoskeleton, resulting in altered signaling function and/or development in multiple hematopoietic cell lineages. WAS is caused by a mutation in the WAS gene, resulting in a mutated or deleted form of the WAS protein (WASp).

X-linked thrombocytopenia (XLT) is a hereditary coagulation disorder associated with WAS. The number and size of platelets in XLT patients change to affect clotting functions. XLT results from mutations in the WAS gene, resulting in WASp reduction, deletion or alteration.

Hematopoietic Stem Cells (HSCs) are a class of self-renewing, differentiation-able stem cells into various types of blood cells and immune cells, which are considered important therapeutic cells for blood system diseases, such as WAS and XLT. Furthermore, since 2009, the first treatment of WAS patients with WAS using Hematopoietic Stem Cell Transplantation (HSCT), allogeneic HSCT WAS the standard therapy for radical treatment of WAS. But its biggest problem is the risk of morbidity or mortality from xenografts. In order to reduce the risk of immune rejection, HSC donors are often required to be siblings of the same HLA-type or non-related donors of HLA-match in patients, but often many patients cannot find a suitable donor in time, which is a hindrance to treatment and aggravates the condition. Thus, the art began to explore gene therapy protocols that could solve the treatment problem from the source by gene editing based on autologous HSCs of the patient, repairing WAS mutant genes.

Currently, gene therapy protocols mainly utilize gamma-retrovirus, lentivirus, or gene editing systems as vectors. Retroviral or lentiviral vector-based therapies, although to some extent, alleviate symptoms in patients, such as reducing bleeding, frequency of infection, ameliorating eczema. However, WAS gene therapy suffers from the difficulty that WAS is expressed in almost all hematopoietic cells, and thus requires that WAS expression be restored in cells of each lineage after treatment to achieve the best therapeutic effect. Currently, reported lentiviral gene therapies have achieved a certain therapeutic effect, but may bring about some unknown side effects due to the use of viruses. And compared with gene therapy based on a retrovirus vector, the CRISPR gene editing system can realize site-directed integration, has better control on safety, and is a relatively better choice.

Furthermore, the pathogenic genotype and clinical phenotype of WAS is complex. The pathogenic sites can be statistically distributed in each exon or intron of the WAS gene, including missense mutations, nonsense mutations, deletion mutations, frameshift mutations, and the like. Therefore, searching for a WAS patient capable of safely, effectively and efficiently treating various pathogenic genotypes and searching for a tool capable of repairing a plurality of even all disease curing genes at the same time is a problem to be solved.

Disclosure of Invention

Because the pathogenic mutation genotypes of WAS patients are very diverse and likely to be distributed throughout most regions of WAS genes, designing specific repair therapies for patients of each different mutation type is no different from cup-and-wage, and some mutations are limited by technology and cannot be used to design suitable specific repair tools. To solve this technical problem, the present application devised a solution to replace the original mutant WAS sequence with a foreign sequence (coWAS) with an optimized coding region of the wild-type WAS sequence to repair all mutations that may exist on the WAS gene.

For introducing coWAS, the simplest approach is direct delivery with retrovirus or lentivirus, but this approach is to integrate the coWAS randomly into the patient's genome, which can present problems: random insertion sites, uncontrollable gene expression levels, and potential carcinogenic risk; furthermore, this approach only introduces coWAS, and the patient's own mutant WAS gene is still present and the mutant WAS protein is still expressed, thus, some unpredictable safety issues may also result. In order to solve the technical problem, the application provides a CRISPR/Cas9 mediated site-directed homologous recombination (HDR) technical scheme, which realizes the integration of coWAS at the original expression site of a mutant WAS gene of a patient, so that the coWAS obtains an expression environment and an expression level similar to those of an endogenous WAS gene, the mutant WAS obtains higher repair efficiency, and the HSC after gene repair can be differentiated into various blood cells with normal functions.

The specific technical scheme of the application is as follows:

1. a repair system for mutating a WAS gene in a mammalian cell comprising a CRISPR/Cas9 system and a homologous recombination nucleic acid, wherein the CRISPR/Cas9 system comprises:

1) An sgRNA targeting the WAS gene, a complex comprising the sgRNA, or a construct encoding the sgRNA; and

2) Cas9 protein or nucleic acids or constructs expressing the Cas9 protein,

wherein the homologous recombination nucleic acid comprises:

A. an exogenous WAS gene encoding at least a portion of the nucleotide sequence of a WAS protein (WASp);

B. homology arms of the 5 'and 3' ends of the exogenous WAS gene that promote homologous repair (HDR).

2. The repair system for WAS gene of item 1, wherein said sgRNA comprises any one sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:8 and SEQ ID NO:20-SEQ ID NO: 27.

3. The repair system for a WAS gene of

clause

1 or 2, wherein the exogenous WAS gene comprises the nucleotide sequence set forth in SEQ ID No. 17 or SEQ ID No. 18.

4. The repair system for a WAS gene of any one of clauses 1-3, wherein the exogenous WAS gene further comprises a PolyA sequence between its 3' homology arm.

5. The repair system for WAS gene of item 4, wherein the PolyA sequence is as shown in SEQ ID NO. 32 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the sequence.

6. The repair system for a WAS gene of

clause

4 or 5, wherein the exogenous WAS gene is linked to the PolyA sequence by a linker.

7. The repair system of WAS gene according to any one of items 1 to 6, wherein the homology arm of the 5 'or 3' end has a length of 200bp to 1200bp, 200bp to 1000bp, 300bp to 900bp, 350bp to 850bp, 400bp to 800bp, 450bp to 750bp, 500bp to 700bp or 450bp to 700bp.

8. The repair system for a WAS gene of any one of items 1-7, wherein the homology arms at the 5 'and 3' ends are the same or different in length.

9. The repair system of the WAS gene of any one of items 1-8, the 5 'homology arm comprising a nucleotide sequence as set forth in any one of SEQ ID NOs 9-12, and the 3' homology arm comprising a nucleotide sequence as set forth in any one of SEQ ID NOs 13-16.

10. The repair system for a WAS gene of any one of claims 1-9, wherein the sgRNA is chemically modified.

11. The repair system for the WAS gene of item 10, wherein the chemical modification comprises methoxy modification and/or thio modification.

12. A method of improving expression of a WAS protein (WASp) in a human cell, comprising editing a mutant WAS genome in a human cell using a CRISPR/Cas9 system and a homologous recombination nucleic acid, wherein the CRISPR/Cas9 system comprises:

2) Cas9 protein or nucleic acids or constructs expressing the Cas9 protein,

wherein the homologous recombination nucleic acid comprises:

13. The method of item 12, wherein the sgRNA comprises any one sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:8 and SEQ ID NO:20-SEQ ID NO: 27.

14. The method of clause 12 or 13, wherein the exogenous WAS gene comprises the nucleotide sequence set forth in SEQ ID NO. 17 or SEQ ID NO. 18.

15. The method of any one of claims 12-14, wherein the exogenous WAS gene further comprises a PolyA sequence between the 3' homology arm thereof.

16. The method of item 15, wherein the PolyA sequence is as set forth in SEQ ID NO. 32 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the sequence.

17. The method of any one of claims 12-16, wherein the exogenous WAS gene is linked to the PolyA sequence by a linker.

18. The method of any one of claims 12-17, wherein the homology arm at the 5 'or 3' end is 200bp-1200bp, 200bp-1000bp, 300bp-900bp, 350bp-850bp, 400bp-800bp, 450bp-750bp, 500bp-700bp, or 450bp-700bp in length.

19. The method of any one of claims 12-18, wherein the homology arms at the 5 'and 3' ends are the same or different in length.

20. The method of any one of claims 12-19, wherein the 5 'homology arm comprises a nucleotide sequence as set forth in any one of SEQ ID NOs 9-12 and the 3' homology arm comprises a nucleotide sequence as set forth in any one of SEQ ID NOs 13-16.

21. The method of any one of claims 12-20, wherein the sgRNA is chemically modified.

22. The method of item 21, wherein the chemical modification comprises methoxy modification and/or thio modification.

23. The method of any one of claims 12-22, wherein the Cas9 is a polynucleotide encoding a Cas9 protein.

24. The method of any one of claims 12-23, co-introducing the sgRNA with the polynucleotide encoding the Cas9 protein into the mammalian cell by electrotransfer.

25. The method of any one of claims 12-24, wherein the mammalian cell is a human hematopoietic stem cell or immune cell (e.g., a T lymphocyte).

26. The method of any one of claims 12-25, wherein the homologous recombinant nucleic acid is introduced into the cell by a viral vector.

27. The method of item 26, wherein the viral vector is an adeno-associated virus (AAV), preferably AAV6.

28. The method of item 27, wherein the MOI is above 5x10e3 vg/cell.

29. A hematopoietic stem cell prepared by the method of any one of claims 12-28.

30. A mature blood cell or precursor cell thereof obtained by differentiating the hematopoietic stem cell of clause 29.

31. A pharmaceutical composition comprising the hematopoietic stem cell of item 29 or the blood cell or precursor cell of item 30.

32. A medical article comprising the hematopoietic stem cell of item 29 or the blood cell or precursor cell of item 30.

33. Use of a hematopoietic stem cell of item 29 or a blood cell or precursor cell of item 30 for preventing or treating a WASp protein expression abnormality or loss of function associated disease in a subject in need thereof.

34. The use of item 33, wherein the disease is Wiskott-Aldrich syndrome (WAS) or X-linked thrombocytopenia (XLT).

35. An sgRNA construct comprising any one of the sequences selected from the group consisting of SEQ ID NOs 1-8 and 20-27.

36. The construct of item 35, comprising methoxy modification and/or thio modification.

37. A vector comprising the sgRNA construct of claim 35 or 36.

38. A host cell comprising the sgRNA construct of item 35 or 36 or the vector of item 37.

39. A homologous recombinant nucleic acid comprising a left homology arm, an exogenous sequence (coWAS) and a right homology arm, wherein the nucleotide sequence of the left homology arm comprises any of the sequences as set forth in SEQ ID NOs 9-12, the nucleotide sequence of the right homology arm comprises any of the sequences as set forth in SEQ ID NOs 13-16, and the nucleotide sequence of the coWAS comprises the sequence as set forth in SEQ ID NO 17 or as set forth in SEQ ID NO 18.

40. A vector comprising the homologous recombinant nucleic acid of claim 39.

41. The vector according to item 40, wherein the vector is an adeno-associated virus (AAV), preferably AAV6.

42. A method of treating or preventing a disease associated with abnormal expression or loss of function of a WASp protein in a subject, comprising administering to the subject hematopoietic stem cells of item 29 or the blood cells or precursor cells of item 30.

43. The method of item 42, wherein the disease is Wiskott-Aldrich syndrome (WAS) or X-linked thrombocytopenia (XLT).

44. The method of item 42 or 43, wherein the subject is a human.

ADVANTAGEOUS EFFECTS OF INVENTION

The method disclosed by the application is characterized in that on the basis that 80-90% of endogenous WAS is edited, homologous recombination is carried out into 20-30% of coWAS, and successful human cells are integrated, so that the method has the potential of improving the WASp expression of patients in vivo and recovering the functions of related blood cells.

Drawings

FIG. 1 is a schematic representation of the cleavage ratios of different sgRNAs in example 1.

FIG. 2 is a graphical representation of the statistical results of the cleavage ratios of different sgRNAs in example 1.

FIG. 3A is a graph showing the efficiency of gene editing after transfer of different sgRNAs into human primary T cells in example 1.

FIG. 3B is a schematic representation of cell viability following transfer of different sgRNAs into human primary T cells in example 1.

FIG. 4A is a graph showing the efficiency of gene editing after electrotransformation of different sgRNAs into hematopoietic stem/progenitor cells (HSPCs) in example 1.

Fig. 4B is a schematic representation of cell viability following electrotransfection of different sgrnas into HSPCs in example 1.

FIG. 5 is a graph showing the effect on the proportion of GFP+ cells when cells were infected with different titers of AAV6-GFP following electrotransformation with sgRNA1-1 in example 2.

FIG. 6 is a schematic representation of the proportion of GFP+ cells following cell infection with different sgRNAs in example 2.

FIG. 7 is a schematic representation of cell viability following cell infection with different sgRNAs in example 2.

FIG. 8 is a schematic representation of the detection of homologous recombination efficiency on the genome of cells using three-generation sequencing after electroporation using sgRNA and subsequent infection of the cells with AAV (GFP) in example 2.

Fig. 9 is a schematic representation of CD14, GFP and WASp expression after differentiation of genetically engineered HSPCs into macrophages in example 3.

Fig. 10 is a schematic representation of the proportion of gfp+ in human cd45+ cells of bone marrow and the expression of cd56+, cd33+, cd19+ and cd3+ in bone marrow in the genetically edited HSPCs transplanted into NPG immunodeficient mouse model of example 4.

Detailed Description

The present application is described in detail below with reference to the embodiments depicted in the drawings, wherein like numerals represent like features throughout the several views. While specific embodiments of the present application are shown in the drawings, it should be understood that the present application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. Those of skill in the art will understand that a person may refer to the same component by different names. The specification and claims do not identify differences in terms of components, but rather differences in terms of the functionality of the components. As referred to throughout the specification and claims, the terms "include" or "comprising" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth the preferred embodiment for carrying out the present application, but is not intended to limit the scope of the present application in general, as the description proceeds. The scope of the present application is defined by the appended claims.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising:

the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid.

The human cells can be, for example, hematopoietic stem cells or T cells, and the CRISPR/Cas9 system and the homologous recombination nucleic acid are used for editing the mutant WAS genome in the human cells, so that the WASp expression of patients can be improved, and the functions of the related blood cells can be recovered.

The "CRISPR/Cas" is a gene editing technique including, but not limited to, various naturally occurring or artificially designed CRISPR/Cas systems, such as the CRISPR/Cas9 system used herein. The naturally occurring CRISPR/Cas system (Naturally occurring CRISPR/Cas system) is an adaptive immune defense that bacteria and archaea develop during long-term evolution, and can be used to combat invasive viruses and foreign DNA. For example, the principle of CRISPR/Cas9 operation is that crRNA (CRISPR-extended RNA) binds to a tracrRNA (trans-activating RNA) by base pairing to form a tracrRNA/crRNA complex that directs nuclease Cas9 protein to cleave double-stranded DNA at the sequence target site paired with the crRNA. By artificially designing the tracrRNA and crRNA, sgRNA (single guide RNA) with guiding effect can be engineered to be sufficient to guide the site-directed cleavage of DNA by Cas 9. As an RNA-guided dsDNA binding protein, cas9 effector nucleases are able to co-localize RNA, DNA and protein, thus possessing tremendous engineering potential.

In one embodiment, the mutant WAS genome is complementary to any sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:8 and SEQ ID NO:20-SEQ ID NO: 27.

In one embodiment, a sgRNA comprising any one of the sequences selected from SEQ ID NO:20-SEQ ID NO:27 and a homologous recombination nucleic acid is introduced into the human cell to effect editing of the mutant WAS genome.

The "sgRNA (single guide RNA)" and "gRNA (guide RNA)" may be "single guide RNAs", "synthetic guide RNAs" or "guide RNAs" are used interchangeably.

The "guide sequence" may be a sequence of about 17-20bp specifying the targeting site, and may be used interchangeably with "guide sequence" or "spacer". In the context of forming a CRISPR complex, a "target sequence" is, for example, a sequence to which a guide sequence is designed to have complementarity, wherein hybridization between the target sequence and the guide sequence promotes CRISPR complex formation, which hybridization requires that the "target sequence" and the "guide sequence" or "guide sequence" have sufficient complementarity to cause hybridization and promote CRISPR complex formation, and complete complementarity is not necessary.

By "complementary" is meant that the "guide sequence" or "guide sequence" hybridizes to a target nucleotide sequence (for purposes of this application, the mutant WAS genomic target nucleotide sequence in a human cell) by the nucleotide pairing rules found by watson and crick. It will be appreciated by those skilled in the art that a "guide sequence" can hybridize to a target nucleotide sequence so long as it has sufficient complementarity, without requiring 100% complete complementarity between them. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence can be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more when optimally aligned using an appropriate alignment algorithm. The optimal alignment may be determined using any suitable algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, the Burrows-Wheeler Transform based algorithm, and the like.

Generally, in the context of endogenous CRISPR systems, the formation of a CRISPR complex (including hybridization of a guide sequence to a target sequence and complexing with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., in a range of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence).

In one embodiment, the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO:1-SEQ ID NO:8, preferably, the sgRNA is a sgRNA with methoxy modification and thio modification at 3 bases at both the 5 'and 3' ends.

The methoxy modification refers to modification with methoxy (-O-CH) ₃ ) The hydroxyl (-OH) group at the carbon atom at ribose 2-position in the base is replaced, and the sequence is denoted by m below.

The thio modification refers to the replacement of a non-bridging oxygen atom in the phosphate backbone with a sulfur atom, represented by the following sequence.

The sequences of SEQ ID NO. 1-SEQ ID NO. 8 were designed as follows:

the size of the sequence is 100bp, the sequence consists of a space corresponding sequence and scaffold, the length of the scaffold is 80bp, and the sequence is as follows:

the rGruUrUrAlrGrGrCrUrAlGrarGrarrArarUrCrGrUrAlrAlrAlrAlrAlrAlrGrCrCrUrAlCrGrCrGrUrUrUrUrCrCrCrGrCrUrUrArarArarArarArararGrarGrGrGrGrGrCrGrCrGrCrarCrGrCrarCrGrCrGrCrGrarCrGrrGruGrrGrrCrU. MU (SEQ ID NO: mU (SEQ ID NO: 19) at the 3' end of the spacer corresponding sequence, wherein r in the sequence refers to RNA.

By designing for WAS exon 1 and

exon

2, 4 sgRNAs were designed for exon 1 near the ATG start codon with the spacer sequences of

1-1：AGGGCAGAAAGCACCATGAG(SEQ ID NO:20)

1-2：ATGAGTGGGGGCCCAATGGG(SEQ ID NO:21)

1-4：CGGGGGCCGAGGAGCACCAG(SEQ ID NO:22)

1-5：CCAATGGGAGGAAGGCCCGG(SEQ ID NO:23)

For

exon

2, 4 sgRNAs were designed near the cleavage site with spacer sequences of

2-2：CTGGACCAAGGAGCATTGTG(SEQ ID NO:24)

2-3：TGGAGCTGAGCACTGGACCA(SEQ ID NO:25)

2-4：GTACAGCTGAACAACTGCAG(SEQ ID NO:26)

2-5：GTCCAGTGCTCAGCTCCAGG(SEQ ID NO:27)

Thereby obtaining the sequences of SEQ ID NO. 1-SEQ ID NO. 8, which are respectively:

sgRNA1-1：

mA*mG*mG*rGrCrArGrArArArGrCrArCrCrArUrGrArGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:1)

sgRNA1-2：

mA*mU*mG*ArGrUrGrGrGrGrGrCrCrCrArArUrGrGrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:2)

sgRNA1-4：

mC*mG*mG*rGrGrGrCrCrGrArGrGrArGrCrArCrCrArGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:3)

sgRNA1-5：

mC*mC*mA*rArUrGrGrGrArGrGrArArGrGrCrCrCrGrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:4)

sgRNA2-2：

mC*mU*mG*rGrArCrCrArArGrGrArGrCrArUrUrGrUrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:5)

sgRNA2-3：

mU*mG*mG*rArGrCrUrGrArGrCrArCrUrGrGrArCrCrArGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:6)

sgRNA2-4：

mG*mU*mA*rCrArGrCrUrGrArArCrArArCrUrGrCrArGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:7)

sgRNA2-5：

mG*mU*mC*rCrArGrUrGrCrUrCrArGrCrUrCrCrArGrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU(SEQ ID NO:8)

in one embodiment, after co-introducing the sgRNA and Cas9 encoding nucleotides into the human cell, a homologous recombination nucleic acid is introduced into the human cell, thereby editing the mutant WAS genome in the human cell.

In one embodiment, the sgRNA is co-introduced into the human cell by electrotransformation with Cas 9-encoding nucleotides, preferably at 200-600v for 0.5-2ms.

In one embodiment, the homologous recombinant nucleic acid is introduced into the human cell by a viral infection method.

The virus is an adeno-associated virus (AAV), preferably AAV6; preferably, the MOI is above 5x10e3 vg/cell.

MOI (Multiplicity of Infection ) refers to the proportion of virus-infected cells, and in this application, MOI may be, for example, 5×10e3vgs/cell, 7.5x10e3vgs/cell, 1×10e4vgs/cell, 2.5x10e4vgs/cell, or the like.

In one embodiment, the homologous recombinant nucleic acid comprises a left homology arm, an exogenous sequence (coWAS) and a right homology arm, preferably, the nucleotide sequence of the left homology arm comprises any one of the sequences shown as SEQ ID NO:9-SEQ ID NO:12, the nucleotide sequence of the right homology arm comprises any one of the sequences shown as SEQ ID NO:13-SEQ ID NO:16, and the nucleotide sequence of the coWAS comprises the sequence shown as SEQ ID NO: 17-18.

The sequence is as follows:

1-1 left homology arm (5' homology arm) (450 bp):

GTAGTAACCCTTCCGGACTAGGGACCTCGGGCCTCAGCCTCAGGCTACCTAGGTGCTTTAGAAAGGAGGCCACCCAGGCCCATGACTACTCCTTGCCACAGGGAGCCCTGCACACAGATGTGCTAAGCTCTCGCTGCCAGCCAGAGGGAGGAGGGTCTGAGCCAGTCAGAAGGAGATGGGCCCCAGAGAGTAAGAAAGGGGGAGGAGGACCCAAGCTGATCCAAAAGGTGGGTCTAAGCAGTCAAGTGGAGGAGGGTTCCAATCTGATGGCGGAGGGCCCAAGCTCAGCCTAACGAGGAGGCCAGGCCCACCAAGGGGCCCCTGGAGGACTTGTTTCCCTTGTCCCTTGTGGTTTTTTGCATTTCCTGTTCCCTTGCTGCTCATTGCGGAAGTTCCTCTTCTTACCCTGCACCCAGAGCCTCGCCAGAGAAGACAAGGGCAGAAAGCACC(SEQ ID NO:9)

1-1 left homology arm (5' homology arm) (700 bp):

AAGGGTCTTGCTCTGTCATCATCCAGGCTGGAGTGCAGTGGTGCAGTCTCAGCTCACTGCAACCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGCAGCTAGGACTACAGGTGTGTGCCACCATGCCTGGCTAATTTTTGTATTTTTTAGTGGAAATGGGGTTTTGCCATGTTGCCCAGGCTCGTCTTGAACTCCTGACCTCAAGTGATCCACTCGTCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCTATTGTCCCCAGCCAAAAGGAAAAGTTTTACTGTAGTAACCCTTCCGGACTAGGGACCTCGGGCCTCAGCCTCAGGCTACCTAGGTGCTTTAGAAAGGAGGCCACCCAGGCCCATGACTACTCCTTGCCACAGGGAGCCCTGCACACAGATGTGCTAAGCTCTCGCTGCCAGCCAGAGGGAGGAGGGTCTGAGCCAGTCAGAAGGAGATGGGCCCCAGAGAGTAAGAAAGGGGGAGGAGGACCCAAGCTGATCCAAAAGGTGGGTCTAAGCAGTCAAGTGGAGGAGGGTTCCAATCTGATGGCGGAGGGCCCAAGCTCAGCCTAACGAGGAGGCCAGGCCCACCAAGGGGCCCCTGGAGGACTTGTTTCCCTTGTCCCTTGTGGTTTTTTGCATTTCCTGTTCCCTTGCTGCTCATTGCGGAAGTTCCTCTTCTTACCCTGCACCCAGAGCCTCGCCAGAGAAGACAAGGGCAGAAAGCACC(SEQ ID NO:10)

2-3 left homology arm (5' homology arm) (450 bp):

AAGACAAGGGCAGAAAGCACCATGAGTGGGGGCCCAATGGGAGGAAGGCCCGGGGGCCGAGGAGCACCAGCGGTTCAGCAGAACATACCCTCCACCCTCCTCCAGGACCACGAGAACCAGCGACTCTTTGAGATGCTTGGACGAAAATGCTTGGTGAGCTGGGGATCTCCTGCCCCCGCCCCGTCCCCACCGTTTCTTCCTCTTCCTCTCCTCCTTCTCTCTCTTCCCCTCCTCCCGCTCCTCCTTTCCCTCTCCATCATCTCCTCTCCTAGAATTTCCCGTCATAATCCACCCTTCCCAGGAAGATCTCAATGTCTACTTGCCTTCCCTCTGGCTGCAGCTCTTCCTTTGGGCCCATGACTGTCATGAGGCAGGAAGGACCAGGTCTGGCTCCAAGACCTTGTGGCTACCCCTGACCAGACTCCACTGACCCCTGCTTTCCTCTCCCAG(SEQ ID NO:11)

2-3 left homology arm (5' homology arm) (700 bp):

CTCGCTGCCAGCCAGAGGGAGGAGGGTCTGAGCCAGTCAGAAGGAGATGGGCCCCAGAGAGTAAGAAAGGGGGAGGAGGACCCAAGCTGATCCAAAAGGTGGGTCTAAGCAGTCAAGTGGAGGAGGGTTCCAATCTGATGGCGGAGGGCCCAAGCTCAGCCTAACGAGGAGGCCAGGCCCACCAAGGGGCCCCTGGAGGACTTGTTTCCCTTGTCCCTTGTGGTTTTTTGCATTTCCTGTTCCCTTGCTGCTCATTGCGGAAGTTCCTCTTCTTACCCTGCACCCAGAGCCTCGCCAGAGAAGACAAGGGCAGAAAGCACCATGAGTGGGGGCCCAATGGGAGGAAGGCCCGGGGGCCGAGGAGCACCAGCGGTTCAGCAGAACATACCCTCCACCCTCCTCCAGGACCACGAGAACCAGCGACTCTTTGAGATGCTTGGACGAAAATGCTTGGTGAGCTGGGGATCTCCTGCCCCCGCCCCGTCCCCACCGTTTCTTCCTCTTCCTCTCCTCCTTCTCTCTCTTCCCCTCCTCCCGCTCCTCCTTTCCCTCTCCATCATCTCCTCTCCTAGAATTTCCCGTCATAATCCACCCTTCCCAGGAAGATCTCAATGTCTACTTGCCTTCCCTCTGGCTGCAGCTCTTCCTTTGGGCCCATGACTGTCATGAGGCAGGAAGGACCAGGTCTGGCTCCAAGACCTTGTGGCTACCCCTGACCAGACTCCACTGACCCCTGCTTTCCTCTCCCAG(SEQ ID NO:12)

1-1 right homology arm (3' homology arm) (450 bp):

TGAGTGGGGGCCCAATGGGAGGAAGGCCCGGGGGCCGAGGAGCACCAGCGGTTCAGCAGAACATACCCTCCACCCTCCTCCAGGACCACGAGAACCAGCGACTCTTTGAGATGCTTGGACGAAAATGCTTGGTGAGCTGGGGATCTCCTGCCCCCGCCCCGTCCCCACCGTTTCTTCCTCTTCCTCTCCTCCTTCTCTCTCTTCCCCTCCTCCCGCTCCTCCTTTCCCTCTCCATCATCTCCTCTCCTAGAATTTCCCGTCATAATCCACCCTTCCCAGGAAGATCTCAATGTCTACTTGCCTTCCCTCTGGCTGCAGCTCTTCCTTTGGGCCCATGACTGTCATGAGGCAGGAAGGACCAGGTCTGGCTCCAAGACCTTGTGGCTACCCCTGACCAGACTCCACTGACCCCTGCTTTCCTCTCCCAGACGCTGGCCACTGCAGTTGTTC(SEQ ID NO:13)

1-1 right homology arm (3' homology arm) (700 bp):

TGAGTGGGGGCCCAATGGGAGGAAGGCCCGGGGGCCGAGGAGCACCAGCGGTTCAGCAGAACATACCCTCCACCCTCCTCCAGGACCACGAGAACCAGCGACTCTTTGAGATGCTTGGACGAAAATGCTTGGTGAGCTGGGGATCTCCTGCCCCCGCCCCGTCCCCACCGTTTCTTCCTCTTCCTCTCCTCCTTCTCTCTCTTCCCCTCCTCCCGCTCCTCCTTTCCCTCTCCATCATCTCCTCTCCTAGAATTTCCCGTCATAATCCACCCTTCCCAGGAAGATCTCAATGTCTACTTGCCTTCCCTCTGGCTGCAGCTCTTCCTTTGGGCCCATGACTGTCATGAGGCAGGAAGGACCAGGTCTGGCTCCAAGACCTTGTGGCTACCCCTGACCAGACTCCACTGACCCCTGCTTTCCTCTCCCAGACGCTGGCCACTGCAGTTGTTCAGCTGTACCTGGCGCTGCCCCCTGGAGCTGAGCACTGGACCAAGGAGCATTGTGGGGCTGTGTGCTTCGTGAAGGATAACCCCCAGAAGTCCTACTTCATCCGCCTTTACGGCCTTCAGGTGACCCCCCCACCCCCGACTGGACTTGCAAGCCAGTTCTCAACCCGCAAACCCAGATCTGTGTCCATATGTGTCCATAGCTTCAAGACCTCAGACCTGATCAGTGAATCCCTGAGCCCCAGAACCAAAGACTCATCCAGATGGCAAACTCTGACTTGCCTTTCTAAGTCTGCAATGACTG(SEQ ID NO:14)

2-3 right homology arm (3' homology arm) (450 bp):

ACCAAGGAGCATTGTGGGGCTGTGTGCTTCGTGAAGGATAACCCCCAGAAGTCCTACTTCATCCGCCTTTACGGCCTTCAGGTGACCCCCCCACCCCCGACTGGACTTGCAAGCCAGTTCTCAACCCGCAAACCCAGATCTGTGTCCATATGTGTCCATAGCTTCAAGACCTCAGACCTGATCAGTGAATCCCTGAGCCCCAGAACCAAAGACTCATCCAGATGGCAAACTCTGACTTGCCTTTCTAAGTCTGCAATGACTGGCCCCAGTCTCCGTATCAAGATCTCTAAAGCCCCCAGTATTAGTCTGCTGCCTAAGCCTAATCTTTTCCACAAATTCCAATAAATGAGCACTGTATTTGTACCTGAACCTCAAATCTATTCTAAACTCAACATTTTGCATCCCAGGAATCTCTCATCAAAACTCCTGAACCCCAGATGTTTGCCAAGC(SEQ ID NO:15)

2-3 right homology arm (3' homology arm) (700 bp):

ACCAAGGAGCATTGTGGGGCTGTGTGCTTCGTGAAGGATAACCCCCAGAAGTCCTACTTCATCCGCCTTTACGGCCTTCAGGTGACCCCCCCACCCCCGACTGGACTTGCAAGCCAGTTCTCAACCCGCAAACCCAGATCTGTGTCCATATGTGTCCATAGCTTCAAGACCTCAGACCTGATCAGTGAATCCCTGAGCCCCAGAACCAAAGACTCATCCAGATGGCAAACTCTGACTTGCCTTTCTAAGTCTGCAATGACTGGCCCCAGTCTCCGTATCAAGATCTCTAAAGCCCCCAGTATTAGTCTGCTGCCTAAGCCTAATCTTTTCCACAAATTCCAATAAATGAGCACTGTATTTGTACCTGAACCTCAAATCTATTCTAAACTCAACATTTTGCATCCCAGGAATCTCTCATCAAAACTCCTGAACCCCAGATGTTTGCCAAGCTCCTAAGTCATAAATCTGTTCAACAAACCCCAAAGTTGAATATTCCATTGATCCTTGAACTCCAAATCTGTCCTTCTAAATCCACAGCACAGACCCCAGAGTTCCCATATTAAAATTCCTGAACACTCAAATACCGAGGTAGTTCTTAAGCAAAAAGTCTTTTCCACAATCCCCTGACCTGAACTTTCTAGGTTTAAGCCCCAAATTCATCCTTTTAAACCCATAAAGATGGACCCAGCATAACTTCCAGATCCCAAGGCTATCAAATATCCACCAAACTCCTAAACCATAACTCTCTCC(SEQ ID NO:16)

the foreign sequence (coWAS) sequence is as follows:

coWAS insertion sequence:

ATGTCTGGCGGCCCCATGGGCGGCCGCCCCGGAGGCAGAGGTGCACCCGCCGTGCAGCAGAACATCCCTAGCACCCTGCTGCAAGACCACGAGAATCAGAGACTGTTCGAGATGCTGGGCAGAAAGTGCTTGACCCTGGCCACCGCCGTCGTGCAATTGTACCTGGCGCTGCCGCCCGGCGCCGAACACTGGACCAAGGAGCACTGCGGCGCCGTGTGCTTCGTGAAGGACAACCCTCAGAAGAGCTACTTCATCAGACTGTACGGCCTGCAAGCCGGCAGACTGCTGTGGGAGCAAGAGCTGTACTCTCAGCTGGTGTACTCGACCCCCACCCCGTTCTTTCACACCTTCGCCGGCGACGACTGCCAAGCCGGCCTGAACTTCGCCGACGAAGACGAGGCCCAAGCCTTCAGAGCCCTGGTGCAAGAGAAGATTCAGAAGAGAAATCAGCGGCAGAGCGGGGACCGCCGGCAACTTCCTCCGCCTCCGACCCCCGCGAACGAAGAAAGACGTGGCGGTCTGCCCCCCTTGCCCTTACATCCCGGCGGAGATCAAGGCGGACCACCCGTGGGCCCCTTAAGCCTGGGCCTGGCCACCGTGGACATTCAGAACCCCGACATCACAAGCAGCAGATACAGAGGCCTGCCCGCCCCCGGCCCTAGCCCCGCCGACAAGAAGAGAAGCGGCAAGAAGAAGATCAGCAAGGCCGACATCGGCGCCCCTAGCGGCTTCAAGCACGTGAGCCACGTGGGCTGGGACCCTCAGAACGGCTTCGACGTGAACAACCTGGACCCCGACCTGAGAAGCCTGTTCAGCAGAGCCGGCATCAGCGAGGCTCAGCTGACCGACGCCGAGACAAGCAAGCTGATCTACGACTTCATCGAGGACCAAGGCGGCTTAGAAGCCGTGAGACAAGAGATGAGAAGACAAGAGCCACTCCCGCCCCCTCCTCCTCCGAGTCGAGGTGGAAATCAGCTGCCGAGACCCCCGATAGTGGGGGGAAACAAAGGACGAAGCGGTCCACTTCCTCCCGTACCCCTGGGCATCGCACCCCCACCCCCTACACCAAGAGGCCCACCACCACCCGGCCGTGGGGGGCCCCCCCCTCCTCCACCTCCGGCAACGGGCAGAAGCGGACCCTTACCCCCTCCTCCCCCTGGAGCGGGCGGTCCCCCAATGCCCCCGCCACCGCCTCCTCCGCCTCCGCCTCCGTCCTCCGGCAACGGCCCCGCACCTCCACCACTACCGCCCGCCTTAGTGCCGGCGGGGGGCCTTGCGCCCGGAGGGGGGAGAGGAGCCCTGCTGGATCAGATCAGACAAGGGATTCAGCTGAATAAGACGCCCGGGGCACCGGAAAGCAGCGCCCTACAGCCCCCCCCTCAGTCAAGCGAGGGCCTGGTGGGCGCCCTGATGCACGTGATGCAGAAGAGAAGCAGAGCCATCCACAGCAGCGACGAGGGCGAGGACCAAGCCGGCGACGAGGACGAAGATGACGAGTGGGACGACTGATAAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTC(SEQ ID NO:17)

poly A sequence

CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATC(SEQ ID NO:32)

coWAS insertion sequence:

ACCCTGGCCACCGCCGTCGTGCAATTGTACCTGGCGCTGCCGCCCGGCGCCGAACACTGGACCAAGGAGCACTGCGGCGCCGTGTGCTTCGTGAAGGACAACCCTCAGAAGAGCTACTTCATCAGACTGTACGGCCTGCAAGCCGGCAGACTGCTGTGGGAGCAAGAGCTGTACTCTCAGCTGGTGTACTCGACCCCCACCCCGTTCTTTCACACCTTCGCCGGCGACGACTGCCAAGCCGGCCTGAACTTCGCCGACGAAGACGAGGCCCAAGCCTTCAGAGCCCTGGTGCAAGAGAAGATTCAGAAGAGAAATCAGCGGCAGAGCGGGGACCGCCGGCAACTTCCTCCGCCTCCGACCCCCGCGAACGAAGAAAGACGTGGCGGTCTGCCCCCCTTGCCCTTACATCCCGGCGGAGATCAAGGCGGACCACCCGTGGGCCCCTTAAGCCTGGGCCTGGCCACCGTGGACATTCAGAACCCCGACATCACAAGCAGCAGATACAGAGGCCTGCCCGCCCCCGGCCCTAGCCCCGCCGACAAGAAGAGAAGCGGCAAGAAGAAGATCAGCAAGGCCGACATCGGCGCCCCTAGCGGCTTCAAGCACGTGAGCCACGTGGGCTGGGACCCTCAGAACGGCTTCGACGTGAACAACCTGGACCCCGACCTGAGAAGCCTGTTCAGCAGAGCCGGCATCAGCGAGGCTCAGCTGACCGACGCCGAGACAAGCAAGCTGATCTACGACTTCATCGAGGACCAAGGCGGCTTAGAAGCCGTGAGACAAGAGATGAGAAGACAAGAGCCACTCCCGCCCCCTCCTCCTCCGAGTCGAGGTGGAAATCAGCTGCCGAGACCCCCGATAGTGGGGGGAAACAAAGGACGAAGCGGTCCACTTCCTCCCGTACCCCTGGGCATCGCACCCCCACCCCCTACACCAAGAGGCCCACCACCACCCGGCCGTGGGGGGCCCCCCCCTCCTCCACCTCCGGCAACGGGCAGAAGCGGACCCTTACCCCCTCCTCCCCCTGGAGCGGGCGGTCCCCCAATGCCCCCGCCACCGCCTCCTCCGCCTCCGCCTCCGTCCTCCGGCAACGGCCCCGCACCTCCACCACTACCGCCCGCCTTAGTGCCGGCGGGGGGCCTTGCGCCCGGAGGGGGGAGAGGAGCCCTGCTGGATCAGATCAGACAAGGGATTCAGCTGAATAAGACGCCCGGGGCACCGGAAAGCAGCGCCCTACAGCCCCCCCCTCAGTCAAGCGAGGGCCTGGTGGGCGCCCTGATGCACGTGATGCAGAAGAGAAGCAGAGCCATCCACAGCAGCGACGAGGGCGAGGACCAAGCCGGCGACGAGGACGAAGATGACGAGTGGGACGACTGATAAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTC(SEQ ID NO:18)

the present application enables the determination of preferred homologous recombinant nucleic acids by gene editing using different left and right homology arms and corresponding exogenous sequences, and thus for editing of the mutant WAS genome in human cells.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 20, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 9, a coWAS of the sequence shown in SEQ ID No. 17 and a right homology arm of the sequence shown in SEQ ID No. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 20, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 10, a coWAS of the sequence shown in SEQ ID No. 17 and a right homology arm of the sequence shown in SEQ ID No. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 20, and the homologous recombination nucleic acid comprises a left homology arm shown in SEQ ID No. 11, a coWAS shown in SEQ ID No. 18 and a right homology arm shown in SEQ ID No. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 20, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 12, a coWAS of the sequence shown in SEQ ID No. 18 and a right homology arm of the sequence shown in SEQ ID No. 16.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 21, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 9, a coWAS of the sequence shown in SEQ ID NO. 17 and a right homology arm of the sequence shown in SEQ ID NO. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 21, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 10, a coWAS of the sequence shown in SEQ ID NO. 17 and a right homology arm of the sequence shown in SEQ ID NO. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 21, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 11, a coWAS of the sequence shown in SEQ ID NO. 18 and a right homology arm of the sequence shown in SEQ ID NO. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 21, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 12, a coWAS of the sequence shown in SEQ ID NO. 18 and a right homology arm of the sequence shown in SEQ ID NO. 16.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 22, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID No. 9, a coWAS shown in SEQ ID No. 17 and a right homology arm shown in SEQ ID No. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 22, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID No. 10, a coWAS shown in SEQ ID No. 17 and a right homology arm shown in SEQ ID No. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 22, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID No. 11, a coWAS shown in SEQ ID No. 18 and a right homology arm shown in SEQ ID No. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 22, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID No. 12, a coWAS shown in SEQ ID No. 18 and a right homology arm shown in SEQ ID No. 16.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 23, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 9, a coWAS of the sequence shown in SEQ ID NO. 17 and a right homology arm of the sequence shown in SEQ ID NO. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 23, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 10, a coWAS of the sequence shown in SEQ ID NO. 17 and a right homology arm of the sequence shown in SEQ ID NO. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 23, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 11, a coWAS of the sequence shown in SEQ ID NO. 18 and a right homology arm of the sequence shown in SEQ ID NO. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 23, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 12, a coWAS of the sequence shown in SEQ ID NO. 18 and a right homology arm of the sequence shown in SEQ ID NO. 16.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 24, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 9, a coWAS of the sequence shown in SEQ ID No. 17 and a right homology arm of the sequence shown in SEQ ID No. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 24, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 10, a coWAS of the sequence shown in SEQ ID No. 17 and a right homology arm of the sequence shown in SEQ ID No. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 24, and the homologous recombination nucleic acid comprises a left homology arm shown in SEQ ID No. 11, a coWAS shown in SEQ ID No. 18 and a right homology arm shown in SEQ ID No. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 24, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 12, a coWAS of the sequence shown in SEQ ID No. 18 and a right homology arm of the sequence shown in SEQ ID No. 16.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 25, and the homologous recombinant nucleic acid comprises a left homology arm of the sequence shown in SEQ ID NO. 9, a coWAS of the sequence shown in SEQ ID NO. 17 and a right homology arm of the sequence shown in SEQ ID NO. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 25, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID NO. 10, a coWAS shown in SEQ ID NO. 17 and a right homology arm shown in SEQ ID NO. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 25, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID NO. 11, a coWAS shown in SEQ ID NO. 18 and a right homology arm shown in SEQ ID NO. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 25, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID NO. 12, a coWAS shown in SEQ ID NO. 18 and a right homology arm shown in SEQ ID NO. 16.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 26, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 9, a coWAS of the sequence shown in SEQ ID No. 17 and a right homology arm of the sequence shown in SEQ ID No. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 26, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 10, a coWAS of the sequence shown in SEQ ID No. 17 and a right homology arm of the sequence shown in SEQ ID No. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 26, and the homologous recombination nucleic acid comprises a left homology arm shown in SEQ ID No. 11, a coWAS shown in SEQ ID No. 18 and a right homology arm shown in SEQ ID No. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID No. 26, and the homologous recombination nucleic acid comprises a left homology arm of the sequence shown in SEQ ID No. 12, a coWAS of the sequence shown in SEQ ID No. 18 and a right homology arm of the sequence shown in SEQ ID No. 16.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 27, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID NO. 9, a coWAS shown in SEQ ID NO. 17 and a right homology arm shown in SEQ ID NO. 13.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 27, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID NO. 10, a coWAS shown in SEQ ID NO. 17 and a right homology arm shown in SEQ ID NO. 14.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 27, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID NO. 11, a coWAS shown in SEQ ID NO. 18 and a right homology arm shown in SEQ ID NO. 15.

The present application provides a method of increasing the expression of a WAS protein (WASp) in a human cell comprising: the mutant WAS genome in human cells WAS edited using CRISPR/Cas9 system and homologous recombination nucleic acid. Wherein the mutant WAS gene is complementary to the sequence shown in SEQ ID NO. 27, and the homologous recombinant nucleic acid comprises a left homology arm shown in SEQ ID NO. 12, a coWAS shown in SEQ ID NO. 18 and a right homology arm shown in SEQ ID NO. 16.

In one embodiment, the human cell is a hematopoietic stem cell or a T cell.

For example, by resuscitating human cd34+ hematopoietic stem cells or T cells, collecting the cells after in vitro activation, then co-transferring sgrnas and Cas 9-encoding nucleotides into the above cells by electrotransfer based on CRISPR/Cas9 system, and then introducing the homologous recombinant nucleic acids into the above cells by virus infection method, the efficiency of gene editing, cell viability and cell differentiation ability can be evaluated, and after introducing the gene-edited cells into NPG mice, the ability to reconstitute hematopoietic system and in vivo transplantation ability can be evaluated.

A specific sequence with 96bp length is generally adopted as the sgRNA in the field, and the stability of the sgRNA is effectively improved by performing methoxy modification and thio modification on the basis of the sequence.

In addition, the selected Cas9 is Streptococcus pyogenes Cas (SpCas 9, cas9 of streptococcus pyogenes), and has the advantages of high efficiency, good applicability and NO obvious off-target effect, and for the presentation mode of the encoding nucleotide of the spCas9, the protein or mRNA can be used, and in the following experiments, the mRNA, such as the mRNA containing an ARCR cap, is used, and the mRNA sequence of the spCas9 is shown as SEQ ID NO. 28. In some embodiments, the spCas9 encoding nucleotide is in a viral vector, such as a lentiviral vector. In some embodiments, the sgRNA is in the same vector as the spCas9 encoding nucleotide.

The nucleotide sequence of SEQ ID NO. 28 is as follows:

AGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGCCCCCAAGAAGAAGCGGAAGGUGGGCAUCCACGGCGUGCCCGCCGCCGACAAGAAGUACAGCAUCGGCCUGGACAUCGGCACCAACAGCGUGGGCUGGGCCGUGAUCACCGACGAGUACAAGGUGCCCAGCAAGAAGUUCAAGGUGCUGGGCAACACCGACCGGCACAGCAUCAAGAAGAACCUGAUCGGCGCCCUGCUGUUCGACAGCGGCGAGACCGCCGAGGCCACCCGGCUGAAGCGGACCGCCCGGCGGCGGUACACCCGGCGGAAGAACCGGAUCUGCUACCUGCAGGAGAUCUUCAGCAACGAGAUGGCCAAGGUGGACGACAGCUUCUUCCACCGGCUGGAGGAGAGCUUCCUGGUGGAGGAGGACAAGAAGCACGAGCGGCACCCCAUCUUCGGCAACAUCGUGGACGAGGUGGCCUACCACGAGAAGUACCCCACCAUCUACCACCUGCGGAAGAAGCUGGUGGACAGCACCGACAAGGCCGACCUGCGGCUGAUCUACCUGGCCCUGGCCCACAUGAUCAAGUUCCGGGGCCACUUCCUGAUCGAGGGCGACCUGAACCCCGACAACAGCGACGUGGACAAGCUGUUCAUCCAGCUGGUGCAGACCUACAACCAGCUGUUCGAGGAGAACCCCAUCAACGCCAGCGGCGUGGACGCCAAGGCCAUCCUGAGCGCCCGGCUGAGCAAGAGCCGGCGGCUGGAGAACCUGAUCGCCCAGCUGCCCGGCGAGAAGAAGAACGGCCUGUUCGGCAACCUGAUCGCCCUGAGCCUGGGCCUGACCCCCAACUUCAAGAGCAACUUCGACCUGGCCGAGGACGCCAAGCUGCAGCUGAGCAAGGACACCUACGACGACGACCUGGACAACCUGCUGGCCCAGAUCGGCGACCAGUACGCCGACCUGUUCCUGGCCGCCAAGAACCUGAGCGACGCCAUCCUGCUGAGCGACAUCCUGCGGGUGAACACCGAGAUCACCAAGGCCCCCCUGAGCGCCAGCAUGAUCAAGCGGUACGACGAGCACCACCAGGACCUGACCCUGCUGAAGGCCCUGGUGCGGCAGCAGCUGCCCGAGAAGUACAAGGAGAUCUUCUUCGACCAGAGCAAGAACGGCUACGCCGGCUACAUCGACGGCGGCGCCAGCCAGGAGGAGUUCUACAAGUUCAUCAAGCCCAUCCUGGAGAAGAUGGACGGCACCGAGGAGCUGCUGGUGAAGCUGAACCGGGAGGACCUGCUGCGGAAGCAGCGGACCUUCGACAACGGCAGCAUCCCCCACCAGAUCCACCUGGGCGAGCUGCACGCCAUCCUGCGGCGGCAGGAGGACUUCUACCCCUUCCUGAAGGACAACCGGGAGAAGAUCGAGAAGAUCCUGACCUUCCGGAUCCCCUACUACGUGGGCCCCCUGGCCCGGGGCAACAGCCGGUUCGCCUGGAUGACCCGGAAGAGCGAGGAGACCAUCACCCCCUGGAACUUCGAGGAGGUGGUGGACAAGGGCGCCAGCGCCCAGAGCUUCAUCGAGCGGAUGACCAACUUCGACAAGAACCUGCCCAACGAGAAGGUGCUGCCCAAGCACAGCCUGCUGUACGAGUACUUCACCGUGUACAACGAGCUGACCAAGGUGAAGUACGUGACCGAGGGCAUGCGGAAGCCCGCCUUCCUGAGCGGCGAGCAGAAGAAGGCCAUCGUGGACCUGCUGUUCAAGACCAACCGGAAGGUGACCGUGAAGCAGCUGAAGGAGGACUACUUCAAGAAGAUCGAGUGCUUCGACAGCGUGGAGAUCAGCGGCGUGGAGGACCGGUUCAACGCCAGCCUGGGCACCUACCACGACCUGCUGAAGAUCAUCAAGGACAAGGACUUCCUGGACAACGAGGAGAACGAGGACAUCCUGGAGGACAUCGUGCUGACCCUGACCCUGUUCGAGGACCGGGAGAUGAUCGAGGAGCGGCUGAAGACCUACGCCCACCUGUUCGACGACAAGGUGAUGAAGCAGCUGAAGCGGCGGCGGUACACCGGCUGGGGCCGGCUGAGCCGGAAGCUGAUCAACGGCAUCCGGGACAAGCAGAGCGGCAAGACCAUCCUGGACUUCCUGAAGAGCGACGGCUUCGCCAACCGGAACUUCAUGCAGCUGAUCCACGACGACAGCCUGACCUUCAAGGAGGACAUCCAGAAGGCCCAGGUGAGCGGCCAGGGCGACAGCCUGCACGAGCACAUCGCCAACCUGGCCGGCAGCCCCGCCAUCAAGAAGGGCAUCCUGCAGACCGUGAAGGUGGUGGACGAGCUGGUGAAGGUGAUGGGCCGGCACAAGCCCGAGAACAUCGUGAUCGAGAUGGCCCGGGAGAACCAGACCACCCAGAAGGGCCAGAAGAACAGCCGGGAGCGGAUGAAGCGGAUCGAGGAGGGCAUCAAGGAGCUGGGCAGCCAGAUCCUGAAGGAGCACCCCGUGGAGAACACCCAGCUGCAGAACGAGAAGCUGUACCUGUACUACCUGCAGAACGGCCGGGACAUGUACGUGGACCAGGAGCUGGACAUCAACCGGCUGAGCGACUACGACGUGGACCACAUCGUGCCCCAGAGCUUCCUGAAGGACGACAGCAUCGACAACAAGGUGCUGACCCGGAGCGACAAGAACCGGGGCAAGAGCGACAACGUGCCCAGCGAGGAGGUGGUGAAGAAGAUGAAGAACUACUGGCGGCAGCUGCUGAACGCCAAGCUGAUCACCCAGCGGAAGUUCGACAACCUGACCAAGGCCGAGCGGGGCGGCCUGAGCGAGCUGGACAAGGCCGGCUUCAUCAAGCGGCAGCUGGUGGAGACCCGGCAGAUCACCAAGCACGUGGCCCAGAUCCUGGACAGCCGGAUGAACACCAAGUACGACGAGAACGACAAGCUGAUCCGGGAGGUGAAGGUGAUCACCCUGAAGAGCAAGCUGGUGAGCGACUUCCGGAAGGACUUCCAGUUCUACAAGGUGCGGGAGAUCAACAACUACCACCACGCCCACGACGCCUACCUGAACGCCGUGGUGGGCACCGCCCUGAUCAAGAAGUACCCCAAGCUGGAGAGCGAGUUCGUGUACGGCGACUACAAGGUGUACGACGUGCGGAAGAUGAUCGCCAAGAGCGAGCAGGAGAUCGGCAAGGCCACCGCCAAGUACUUCUUCUACAGCAACAUCAUGAACUUCUUCAAGACCGAGAUCACCCUGGCCAACGGCGAGAUCCGGAAGCGGCCCCUGAUCGAGACCAACGGCGAGACCGGCGAGAUCGUGUGGGACAAGGGCCGGGACUUCGCCACCGUGCGGAAGGUGCUGAGCAUGCCCCAGGUGAACAUCGUGAAGAAGACCGAGGUGCAGACCGGCGGCUUCAGCAAGGAGAGCAUCCUGCCCAAGCGGAACAGCGACAAGCUGAUCGCCCGGAAGAAGGACUGGGACCCCAAGAAGUACGGCGGCUUCGACAGCCCCACCGUGGCCUACAGCGUGCUGGUGGUGGCCAAGGUGGAGAAGGGCAAGAGCAAGAAGCUGAAGAGCGUGAAGGAGCUGCUGGGCAUCACCAUCAUGGAGCGGAGCAGCUUCGAGAAGAACCCCAUCGACUUCCUGGAGGCCAAGGGCUACAAGGAGGUGAAGAAGGACCUGAUCAUCAAGCUGCCCAAGUACAGCCUGUUCGAGCUGGAGAACGGCCGGAAGCGGAUGCUGGCCAGCGCCGGCGAGCUGCAGAAGGGCAACGAGCUGGCCCUGCCCAGCAAGUACGUGAACUUCCUGUACCUGGCCAGCCACUACGAGAAGCUGAAGGGCAGCCCCGAGGACAACGAGCAGAAGCAGCUGUUCGUGGAGCAGCACAAGCACUACCUGGACGAGAUCAUCGAGCAGAUCAGCGAGUUCAGCAAGCGGGUGAUCCUGGCCGACGCCAACCUGGACAAGGUGCUGAGCGCCUACAACAAGCACCGGGACAAGCCCAUCCGGGAGCAGGCCGAGAACAUCAUCCACCUGUUCACCCUGACCAACCUGGGCGCCCCCGCCGCCUUCAAGUACUUCGACACCACCAUCGACCGGAAGCGGUACACCAGCACCAAGGAGGUGCUGGACGCCACCCUGAUCCACCAGAGCAUCACCGGCCUGUACGAGACCCGGAUCGACCUGAGCCAGCUGGGCGGCGACAGCGGCGGCAAGCGGCCCGCCGCCACCAAGAAGGCCGGCCAGGCCAAGAAGAAGAAGGGCAGCUGAGCGGCCGCUUAAUUAAGCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAGUCUAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA(SEQ ID NO:28)

the application designs a plurality of sgRNAs, compares the editing efficiency of the sgRNAs to obtain the sgRNAs with high efficiency of gene editing, designs a plurality of homologous recombination nucleic acids, and further researches the homologous recombination efficiency of the homologous recombination nucleic acids on the basis of using the sgRNAs with high efficiency of gene editing effect, thereby further editing mutant WAS genome in human cells, and having the potential of improving WASp expression of patients in vivo and recovering functions of related blood cells.

The application provides a method for efficiently editing human cells in vitro through a CRISPR/Cas9 system, which comprises the step of introducing sgRNA containing any sequence selected from SEQ ID NO:20-SEQ ID NO:27 into the human cells, wherein the nucleotide sequence of the sgRNA is shown as any sequence from SEQ ID NO:1-SEQ ID NO:8, and the sgRNA is subjected to methoxy modification and thio modification. In one embodiment, the sgRNA is co-introduced into the human cell with Cas9 encoding nucleotides. In one embodiment, the sgrnas are co-introduced into the human cells by electrotransformation methods with Cas 9-encoding nucleotides. In one embodiment, the human cell is a hematopoietic stem cell or a T cell. By modifying the sgRNA, the stability of the sgRNA can be improved, and the gene editing efficiency of the obtained sgRNA is high.

The present application provides a hematopoietic stem cell or T cell prepared by the method described above.

The present application provides a hematopoietic stem cell or T cell with increased expression of WAS protein (WASp) by genetic engineering, wherein the mutant WAS genome in the hematopoietic stem cell or T cell is edited using a CRISPR/Cas9 system and a homologous recombination nucleic acid.

The present application provides a precursor cell obtained by differentiating and culturing the hematopoietic stem cell described above.

As the medium used in the culture process, a medium commonly used in the art is used.

The present application provides a pharmaceutical composition comprising the hematopoietic stem cells or T cells described above or the precursor cells described above. The pharmaceutical composition may be administered to a subject in need thereof by a route conventionally used for administration of pharmaceutical preparations containing cellular components, such as intravenous infusion route. The dosage administered may be specifically determined based on the condition and general health of the subject.

The present application provides a medical article comprising the hematopoietic stem cells or T cells described above or the precursor cells described above.

The present application provides methods of delivering a nucleic acid comprising a sgRNA and/or Cas9 encoding nucleotide and/or a homologous recombination described herein in a human cell, which in some embodiments can be introduced into a human cell or other host cell using conventional viral and non-viral based gene transfer methods. Non-viral delivery systems include DNA plasmids, RNA, naked nucleic acids, and liposomes. Viral vector delivery systems include DNA and RNA viruses having an isolated or integrated genome for delivery to cells, such as adeno-associated viruses as used herein. In some embodiments, the present application utilizes electrotransformation methods to introduce the genes encoding Cas9 and sgrnas into human cells, and then transfects the human cells with a virus comprising the homologous recombinant nucleic acid to edit the mutant WAS genome in the human cells. Through repeated experiments, the inventors found that when the MOI was above 5x10e3 vgs/cell, the efficiency was higher than at other MOIs for human cells infected with viruses comprising homologous recombinant nucleic acids.

The present application provides the use of the hematopoietic stem cells or T cells described above or the precursor cells described above in the prevention or treatment of a disease in a subject in need thereof. In one embodiment, the disease is Aldrich syndrome (Wiskott-Aldrich syndrome) or other disease caused by mutation of the WAS gene. In one embodiment, the subject is a human.

The application provides the application of the hematopoietic stem cells or T cells or the precursor cells in preparing medicines or medical products for preventing or treating diseases of subjects. In one embodiment, the disease is Aldrich syndrome (Wiskott-Aldrich syndrome) or other disease caused by mutation of the WAS gene. In one embodiment, the subject is a human.

The "hematopoietic stem/progenitor cells (HSPCs)" described herein are the most primitive hematopoietic cells in which various blood cells occur. The main characteristics are that the cell culture medium has vigorous proliferation potential, multidirectional differentiation capacity and self-renewal capacity, so that the cell culture medium not only can differentiate and supplement various blood cells, but also can maintain the characteristics and the quantity of stem cells through self-renewal. Hematopoietic stem cells vary in their degree of differentiation and proliferation capacity, and are heterogeneous. Multipotent hematopoietic stem cells are the most primitive and first differentiate into committed multipotent hematopoietic stem cells, such as myeloid hematopoietic stem cells that can give rise to the lineage, erythroid lineage, mononuclear lineage, and megakaryo-platelet lineage, and lymphoid stem cells that can give rise to B-lymphocytes and T-lymphocytes. These two types of stem cells are not only maintained with basic characteristics of hematopoietic stem cells, but also slightly differentiated, and are respectively responsible for the generation of 'bone marrow components' and lymphocytes, so that they are called directional multipotent hematopoietic stem cells. They differentiate further into hematopoietic progenitor cells, which, while also primitive, have lost many of the essential features of hematopoietic stem cells, such as having lost the ability to differentiate multipotentially, but only toward one or closely related secondary cells; the repeated self-renewing ability is lost, and the number is supplemented by the proliferation and differentiation of the hematopoietic stem cells; proliferation potential is limited and can only split several times. According to the number of blood cell lines that can be differentiated from hematopoietic progenitor cells, the hematopoietic progenitor cells are further classified into unipotent hematopoietic progenitor cells (differentiated into only one blood cell line) and oligopotent hematopoietic progenitor cells (differentiated into 2 to 3 blood cell lines). The term "hematopoietic stem cells" as used herein encompasses multipotent hematopoietic stem cells, committed multipotent hematopoietic stem cells and hematopoietic progenitor cells, and is a generic term for hematopoietic stem cells having different heterogeneity. In this application, "hematopoietic stem/progenitor cells" and the term "hematopoietic stem cells" are used interchangeably to express the same meaning.

In particular embodiments of the present application, hematopoietic stem cells (HSPCs) to be genetically edited as used herein may be derived from mononuclear cells in Bone Marrow (BM), cord Blood (CB), or recruited peripheral blood (mPB).

The present application provides sgRNA constructs comprising any one of the sequences selected from SEQ ID NO:20-SEQ ID NO: 27. In one embodiment, the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO:1-SEQ ID NO:8, preferably, the sgRNA is methoxy-modified and thio-modified.

The present application provides a vector comprising the sgRNA construct described above. The vector may be, for example, a plasmid or a virus, and is not limited in any way to a specific type, and may be determined according to conventional selection.

The present application provides a host cell comprising the sgRNA construct described above or the vector described above. The present application provides a formulation comprising the sgRNA construct described above.

The present application provides the use of the sgRNA construct described above or the vector described above or the preparation described above in gene editing human cells. In one embodiment, the human cell is a hematopoietic stem cell or a T cell.

The application provides a homologous recombinant nucleic acid, which comprises a left homologous arm, an exogenous sequence (coWAS) and a right homologous arm, wherein the nucleotide sequence of the left homologous arm comprises any one sequence shown as SEQ ID NO 9-SEQ ID NO 12, the nucleotide sequence of the right homologous arm comprises any one sequence shown as SEQ ID NO 13-SEQ ID NO 16, and the nucleotide sequence of the coWAS comprises a sequence shown as SEQ ID NO 17 or SEQ ID NO 18. In one embodiment, the homologous recombinant nucleic acid comprises a left homology arm of the sequence shown as SEQ ID NO. 9, a coWAS of the sequence shown as SEQ ID NO. 17 and a right homology arm of the sequence shown as SEQ ID NO. 13.

The present application provides a homologous recombinant nucleic acid comprising a left homology arm of the sequence shown as SEQ ID NO. 10, a coWAS of the sequence shown as SEQ ID NO. 17 and a right homology arm of the sequence shown as SEQ ID NO. 14.

The present application provides a homologous recombinant nucleic acid comprising a left homology arm of the sequence shown as SEQ ID NO. 11, a coWAS of the sequence shown as SEQ ID NO. 18 and a right homology arm of the sequence shown as SEQ ID NO. 15.

The present application provides a homologous recombinant nucleic acid comprising a left homology arm of the sequence shown as SEQ ID NO. 12, a coWAS of the sequence shown as SEQ ID NO. 18 and a right homology arm of the sequence shown as SEQ ID NO. 16.

The present application provides a vector comprising the above-described homologous recombinant nucleic acid. In one embodiment, the vector is an adeno-associated virus (AAV), preferably AAV6.

The present application provides a method of treating or preventing Aldrich syndrome (Wiskott-Aldrich syndrome) or other diseases caused by WAS gene mutation in a subject, comprising administering to the subject hematopoietic stem cells or T cells as described above or precursor cells as described above. In one embodiment, the subject is a human.

Examples

The materials used in the test and the test methods are generally and/or specifically described herein, and in the examples which follow,% represents wt%, i.e., weight percent, unless otherwise specified. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

EXAMPLE 1 screening of sgRNA

(1) Primary screening of preferred sgrnas by primary T cells

The sgRNA1-1, the sgRNA1-2, the sgRNA1-4, the sgRNA1-5, the sgRNA2-2, the sgRNA2-3, the sgRNA2-4 and the corresponding spacer of the sgRNA2-5 are connected into the sgRNA expression plasmid by a synthetic method, and the DNA sequence corresponding to the spCas9 mRNA is connected into another expression plasmid by a genetic synthesis method. These two plasmids were simultaneously transferred into 293T cells using liposomes, the cell genomes were collected for 72 hours, and T7E1 assays were performed on the gene editing results from these sgRNAs, respectively. After gene editing occurs, non-homologous end joining (Non-homologous end joining, NHEJ) of the edited site occurs and base deletion and insertion of the editing site is randomly caused during the joining process. When these edited products are amplified in vitro and re-annealed, imperfect duplex matches may be formed between different repair forms, or between wild type. T7E1 endonuclease can recognize and cut the mismatched structures, and the editing efficiency can be obtained by running glue, photographing and gray level calculation of the proportion of cut products to uncut products. The detection original result is shown in fig. 1 (2 repeated results), and the statistical result is shown in fig. 2.

As can be seen from FIGS. 1 and 2, the cleavage ratios of the sgRNAs 1-1, 1-5, 2-3 and 2-4 are high, and the cleavage efficiency is good.

Next, sgRNA1-1, sgRNA1-5, sgRNA2-3 and sgRNA2-4 were synthesized as the sgRNAs with methoxy and thio modifications. Methoxy modification refers to modification with methoxy (-O-CH) ₃ ) The hydroxyl (-OH) group at the carbon atom at position 2 of ribose is replaced. Thio modification refers to the replacement of a non-bridging oxygen atom in the phosphate backbone with a sulfur atom. The modified sgrnas described above were transformed into human primary T cells by electrotransformation with spCas9 mRNA, and editing efficiency and statistical cell viability were tested as described above, with the results shown in fig. 3A and 3B, respectively.

(2) Editing hematopoietic stem/progenitor cells (HSPCs) with sgRNA genes, verifying initially screened sgRNA

Cd34+ hematopoietic stem/progenitor cells (HSPCs) from peripheral blood of healthy humans were resuscitated and cells were collected after 48 hours of in vitro activation. Four sgrnas 1-1, 1-5, 2-3 and 2-4, which were verified by in vitro experiments, were electrically transferred into HSPCs with spCas9 mRNA respectively, under the conditions of 200-600v and 0.5-2ms, and after the electric transfer, the gene editing efficiency was detected by first generation sequencing, after 4 days, 20 μl of the sample was mixed with AO/PI staining solution in equal proportion, and then the cell viability was detected on a cell counter (cell counter K2), and the results are shown in fig. 4A and 4B, respectively.

EXAMPLE 2 screening of different homologous recombinant DNA templates

(1) Determination of preferred infection MOI

During research, the method for directly comparing the editing efficiency of different homologous recombination DNA templates under different conditions is designed, the homologous recombination DNA templates of Green Fluorescent Protein (GFP) with the same size as the coWAS are inserted into the same locus of an endogenous WAS gene in the research process, and the editing efficiency is directly detected by adopting a streaming method, wherein the editing efficiency of the GFP is approximately equal to the editing efficiency of the WAS.

In this application, GFP sequences for exon 1 and for exon 2 were designed, the nucleotide sequences of which are shown in SEQ ID NO. 29 and SEQ ID NO. 30, respectively:

gfp insertion sequence:

ATGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGCTAGTAAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTA(SEQ ID NO:29)

gfp insertion sequence:

GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTTCCGGAATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGCTAGTAAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTC(SEQ ID NO:30)

for different lengths of the left and right homology arms and GFP sequences, 9 AVV6 were formed by linking to AAV6 backbones, respectively, as shown in table 1.

Table 1 9 AVV6

Wherein the CAG-GFP sequence is shown as SEQ ID NO. 31, and the sequence is as follows:

CAG-GFP sequences

CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCATTCGGTACAATTCACGCGTCGACATTGATTATTGACTAGCTCTGGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACTCGAGGCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGCGGGATCAGCCACCGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGCTCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGCGGCCGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAATCGAATTCCGCTCGAGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATCTAGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:31)

Hematopoietic stem cells derived from peripheral blood are subjected to in vitro activation for 48 hours, are electrically transformed by sgRNA1-1, are immediately infected by AAV6-GFP with different titers (MOI), and are detected by a flow cytometer 4 days after infection, and the infection efficiency is analyzed, and the result is shown in FIG. 5.

As can be seen from fig. 5, as the virus titer increases, the GFP positive rate of the cells increases and the infection efficiency increases. When AAV6-GFP virus titers were greater than 5x10e3 vg/cell, the GFP+ ratio was greater than 70% and thus titers of 5x10e3 vg/cell were used in subsequent experiments.

(2) HDR mediated gene editing by sgRNA in combination with AAV6

After in vitro activation of HSPCs derived from peripheral blood of healthy people for 48 hours, the sgRNA1-1 or the sgRNA2-3 and the mRNA of spCas9 are respectively electrically transferred into the HSPCs under the conditions of 200-600V and 0.5-2ms, four AAV6 viruses (AAV 6-G1-1,2500bp, AAV6-G2-3,2500bp and AAV6-G2-3,1900 bp) are infected into corresponding cells after the electric transfer, and a control group (shown in the following table 2) also infects the corresponding cells. GFP expression was examined by flow cytometry four days after infection, and the efficiency of gene editing was analyzed, and in addition, 20. Mu.l of a cell sample was diluted with an AOPI dye in equal proportions and the cell viability was examined by a cell counter, and the results are shown in Table 2 and FIGS. 6 to 8.

TABLE 2 GFP ratio and cell Activity in the experimental and control groups

As can be seen from table 2 and fig. 6-8, gene editing of HSPCs using the sgRNA and AAV6 (carrying GFP) combination, and flow cytometry detection showed that the homologous recombination efficiencies were both higher than 30%. The third generation sequencing result shows that GFP homologous recombination efficiency is consistent with the flow detection result.

Example 3 in vitro functional verification

HSPCs derived from peripheral blood of healthy humans were electrotransferred into HSPCs with mRNA of sgRNA2-3 and spCas9 for two days in vitro under conditions of 200-600V for 0.5-2ms, and immediately after electrotransfer, infected with AAV 6-G2-3.2500. After overnight infection, fresh medium for HSPCs was changed. Four days after the culture, the cells were collected, and monocyte differentiation was performed, and after 7 days of differentiation, cd14+ monocytes were positively sorted by using magnetic beads, and further macrophage differentiation was performed. After 7 days of macrophage differentiation, CD14, GFP and WASp expression was examined using a loss cell tester and the results are shown in fig. 9.

As can be seen from fig. 9, HSPCs can still differentiate into macrophages after gene editing. After cleavage of sgrnas 2-3, WASp expression was reduced in the sgRNA group and the sgrna+aav6 group compared to the control group (Mock). HSPCs (sgRNA+AAV 6 group) that were post-electric transduction with sgRNA2-3 and then infected with AAV6-G2-3.2500 showed enhanced GFP expression compared to the uninfected sgRNA group and the control group (Mock).

Example 4 in vivo reconstruction function verification

HSPCs from peripheral blood of healthy people are activated in vitro for two days, mRNA of sgRNA2-3 and spCas9 is used for electrotransfer into the HSPCs, the electrotransfer condition is 200-600V, AAV6-G2-3.2500 is used for infection immediately after 0.5-2ms electrotransfer, and fresh culture medium of the HSPCs is changed after the infection is over night. The sgRNA+AAV group is an experimental group, the sgRNA group is not subjected to AAV infection treatment only through the electrical transformation of the sgRNA2-3 and the spCas9, the AAV6 group is not subjected to electrical transformation treatment only through the AAV6-G2-3.2500 infection treatment, and the control group is not subjected to electrical transformation or infection treatment. Cells were collected after four days of culture, and the obtained cells were transplanted by intravenous injection into NPG immunodeficient mouse model irradiated with 1.0Gy (purchased from beijing-veron biotechnology limited (Beijing Vitalstar Biotechnology, inc.) the cell transplantation efficiency in mouse bone marrow was examined at week 17 after transplantation, and the distribution ratio was examined and analyzed with a flow cytometer, as shown in fig. 10, with human CD3, CD4, CD8 antibody-labeled human T cells, human CD33 antibody-labeled myeloid cells, human CD19 antibody-labeled B cells, NK 56 antibody-labeled cells.

As can be seen from fig. 10, HSPCs can still be transplanted into bone marrow after gene editing, and the immune system is reconstituted after transplantation into immunodeficient mice (NPG mice). 17 weeks after transplantation, gfp+ edited cells were still detectable by the sgrna+aav group, demonstrating that edited HSPCs were not only in vivo transplantable, but also reconstituted.

The above description is only of the preferred embodiments of the present application and is not intended to limit the present application in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present application still fall within the protection scope of the technical solution of the present application.

Claims

2) Cas9 protein or nucleic acids or constructs expressing the Cas9 protein,

Wherein the homologous recombination nucleic acid comprises:

2. The repair system for a WAS gene of claim 1, wherein the sgRNA comprises any one sequence selected from the group consisting of SEQ ID No. 1-SEQ ID No. 8 and SEQ ID No. 20-SEQ ID No. 27.

3. A method of improving expression of a WAS protein (WASp) in a human cell, comprising editing a mutant WAS genome in a human cell using a CRISPR/Cas9 system and a homologous recombination nucleic acid, wherein the CRISPR/Cas9 system comprises:

2) Cas9 protein or nucleic acids or constructs expressing the Cas9 protein,

wherein the homologous recombination nucleic acid comprises:

4. The method of claim 3, wherein the sgRNA comprises any sequence selected from the group consisting of SEQ ID NO:1-SEQ ID NO:8 and SEQ ID NO:20-SEQ ID NO: 27.

5. A hematopoietic stem cell prepared by the method of any one of claims 3-4.

6. A mature blood cell or a precursor cell thereof obtained by differentiating and culturing the hematopoietic stem cell of claim 5.

7. A pharmaceutical composition comprising the hematopoietic stem cell of claim 5 or the blood cell or precursor cell of claim 6.

8. A medical article comprising the hematopoietic stem cell of claim 5 or the blood cell or precursor cell of claim 6.

9. Use of a hematopoietic stem cell comprising claim 5 or a blood cell or precursor cell of claim 6 for preventing or treating a WASp protein expression abnormality or loss of function related disease in a subject in need thereof.

10. An sgRNA construct comprising any one of the sequences selected from the group consisting of SEQ ID NOs 1-8 and 20-27.

11. A vector comprising the sgRNA construct of claim 10.

12. A host cell comprising the sgRNA construct of claim 10 or the vector of claim 11.

13. A homologous recombinant nucleic acid comprising a left homology arm, an exogenous sequence (coWAS) and a right homology arm, wherein the nucleotide sequence of the left homology arm comprises any of the sequences as set forth in SEQ ID NOs 9-12, the nucleotide sequence of the right homology arm comprises any of the sequences as set forth in SEQ ID NOs 13-16, and the nucleotide sequence of the coWAS comprises the sequence as set forth in SEQ ID NO 17 or as set forth in SEQ ID NO 18.

14. A vector comprising the homologous recombinant nucleic acid of claim 13.

15. A method of treating or preventing a disease associated with abnormal expression or loss of function of a WASp protein in a subject, comprising administering to the subject a hematopoietic stem cell of claim 5 or a blood cell or precursor cell of claim 6.