CN116178240A - Heterocyclic ester compound containing phenyl furan pyridone skeleton, preparation method and application thereof - Google Patents
Heterocyclic ester compound containing phenyl furan pyridone skeleton, preparation method and application thereof Download PDFInfo
- Publication number
- CN116178240A CN116178240A CN202211551467.6A CN202211551467A CN116178240A CN 116178240 A CN116178240 A CN 116178240A CN 202211551467 A CN202211551467 A CN 202211551467A CN 116178240 A CN116178240 A CN 116178240A
- Authority
- CN
- China
- Prior art keywords
- compound containing
- ester compound
- culture
- heterocyclic ester
- fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D207/44—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having three double bonds between ring members or between ring members and non-ring members
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/10—Nitrogen as only ring hetero atom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/66—Aspergillus
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Rheumatology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Pain & Pain Management (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Furan Compounds (AREA)
Abstract
The invention belongs to the technical field of small molecular compounds, and discloses a heterocyclic ester compound containing a phenyl furan pyridone skeleton, and a preparation method and application thereof. The compound has a structure shown in the following formula (I). The preparation method of the compound comprises the following operation steps: inoculating marine fungus Aspergillus sp.GXNU-A1 into a seed culture medium, and shake culturing to obtain a seed culture solution; inoculating the seed culture solution into a fermentation culture medium, and standing for culture to obtain a fermentation product; standing and extracting the fermentation product with ethyl acetate for three times, extracting the obtained thallus with methanol for three times, concentrating the extractive solution to obtain extract, and separating by column chromatography to obtain the structure shown in formula (I)A compound. The compound has the activity of inhibiting nitric oxide generation in macrophage RAW264.7 induced by LSP, and IC50 of 21 mu M respectively, and can be used for preparing anti-inflammatory drugs.
Description
Technical Field
The invention belongs to the technical field of small molecular compounds, and particularly relates to a heterocyclic ester compound containing a phenyl furan pyridone skeleton, and a preparation method and application thereof.
Background
Ocean due to its unique living environment: high salt, high pressure, low temperature hypoxia, etc., marine organisms form unique metabolic pathways and physicochemical defense mechanisms, become important sources of small molecules of marine drugs, such as the first truly marine source of drugs (derived from the southern pacific ocean snail figure) ziconotide (zicotide) approved by the FDA in 2004, so far more than ten marine sources of drugs have been approved, and various marine sources of natural products are in the phase I, II, III clinical trial stages, which all indicate that the ocean is an important source of new drug sources in the future, and marine natural products have great development prospects.
Literature studies have found that 163 FDA approved drugs in the last decade have been counted, with 91% of the drugs containing a nitrogen atom and most of the drugs containing a nitrogen atom heterocycle, quinolinone structural fragment. Therefore, screening out compounds containing nitrogen heterocycles is of great importance.
Compared with artificially synthesized compounds, the natural products have more remarkable structural diversity and complexity and higher screening rate in the aspect of biological activity. The secondary metabolite of marine microorganisms has the characteristics of high novelty and remarkable biological activity, such as antibiosis, anti-tumor, immunoregulation, anti-inflammatory, enzyme inhibition and the like, and has become an important resource for research and development of marine medicinal natural products.
Meanwhile, the structural and activity diversity of the compounds containing the nitrogen heterocyclic structural fragments are widely focused, especially for natural product chemistry and organic synthesis students. Marine microorganisms have remarkable activity of metabolites produced by different metabolic pathways due to existence in special marine environments. Wherein the literature reports more than 6000 small molecules with remarkable antibacterial and antioxidant active components in fungal metabolites. In the last decade, marine natural products have been considered as one of the important sources of pharmaceutical structural precursors, especially compounds containing heterorings and the like. asperphenyltones A/B has remarkable effect on human body inflammation, and only similar compounds are reported through searching new results of domestic and foreign documents, and the compounds of the invention are not reported and applied in domestic and foreign documents.
Literature studies have also found that: statistics have been made for 163 FDA approved drugs in the last decade, with 91% of drugs containing nitrogen atoms and most of drugs containing a nitrogen atom heterocycle, quinolinone structural fragment; meanwhile, the compound containing quinolinone structural fragments has a great deal of attention on the structural and activity diversity, especially on the chemical and organic synthesis students of natural products. For example, febrivudine has remarkable antimalarial effect, and is paid attention to by scholars at home and abroad, and the toxicity of the obtained homolog is reduced by hundreds of times by a chemical modification method (the basic skeleton of the Quinazolin-4 (3H) -ones is unchanged), and the activity of the homolog is obviously superior to that of Febrivudine.
Disclosure of Invention
In order to overcome the defects and shortcomings in the prior art, the primary aim of the invention is to provide a heterocyclic ester compound containing a phenyl furan pyridone skeleton.
The invention also aims to provide a preparation method of the heterocyclic ester compound containing the phenyl furan pyridone skeleton.
The invention also aims to provide an application of the heterocyclic ester compound containing the phenyl furan pyridone skeleton.
The aim of the invention is achieved by the following technical scheme:
a heterocyclic ester compound containing a phenyl furan pyridone skeleton;
a heterocyclic ester compound containing a phenyl furan pyridone skeleton has a structure shown in the following formula (I):
preferably, the compound is isolated from a fermentation broth of the marine fungus Aspergillus sp.GXNU-A1.
The preparation method of the heterocyclic ester compound containing the phenyl furan pyridone skeleton comprises the following operation steps:
s1, inoculating marine fungus Aspergillus sp.GXNU-A1 into a seed culture medium, and performing shake culture to obtain a seed culture solution;
s2, inoculating the seed culture solution into a fermentation culture medium, and standing for culture to obtain a fermentation product;
s3, standing and extracting the fermentation product with ethyl acetate for three times, extracting the obtained thalli with methanol for three times, concentrating the extract to obtain an extract, and obtaining the compound with the structure shown in the structural formula (I) by adopting a column chromatography separation technology.
Preferably, the seed culture medium in step S1 has a formula of: the average per liter of seed culture medium comprises 100 grams of glucose, 10 grams of yeast extract, 0.5 grams of magnesium sulfate, 1 gram of monopotassium phosphate, 5 grams of sodium chloride and the balance of water.
Preferably, the condition of the shake culture in the step S1 is that the rotation speed of the shake table is 200rpm, and the shake culture is carried out for 3-7 days at 25-30 ℃.
Preferably, the formulation of the fermentation medium in step S2 is: the average fermentation medium comprises 20 g of glucose, 2 g of yeast extract, 0.1g of magnesium sulfate, 0.2 g of monopotassium phosphate, 5g of sodium chloride and the balance of water.
Preferably, the stationary culture conditions in step S2 are 25-30℃for 25-50 days.
Preferably, the specific operation of the column chromatography separation in step S3 is as follows: separating the extract by column chromatography with silica gel column, respectively eluting with dichloromethane-methanol as eluent in volume ratio of 100:1-70:30, collecting dichloromethane-methanol eluent in volume ratio of 80:20, and repeatedly separating by column chromatography with normal phase silica gel column; separating the eluent by semi-preparative liquid chromatographic column chromatography, preparing and collecting the eluent by using 60% methanol aqueous solution by volume percent concentration, and obtaining the heterocyclic ester compound containing the phenyl furan pyridone skeleton.
The synthetic route of the heterocyclic ester compound containing the phenyl furan pyridone skeleton is shown as the following formula:
the application of the heterocyclic ester compound containing the phenyl furan pyridone skeleton in preparing anti-inflammatory drugs.
Compared with the prior art, the invention has the following advantages and effects:
the compound of the marine fungus source provided by the invention has the activity of inhibiting Nitric Oxide (NO) generation in macrophage RAW264.7 induced by LSP, and the IC50 of the compound is 21 mu M (1) respectively, and can be used for preparing anti-inflammatory drugs, so that the compound of the marine fungus source provided by the invention has clinical application potential for treating inflammation.
Drawings
FIG. 1 is a high resolution mass spectrum (HR-ESI-EI) of the compound obtained in example 2.
FIG. 2 is an ultraviolet spectrum (UV) of the compound obtained in example 2.
FIG. 3 is an infrared spectrum (IR) of the compound obtained in example 2.
FIG. 4 shows the compounds obtained in example 2 1 H NMR。
FIG. 5 shows the compounds obtained in example 2 13 C NMR。
Detailed Description
The invention is further described below with reference to the drawings and specific examples. The examples are not intended to limit the invention in any way. Unless otherwise indicated, the reagents, methods and apparatus of the invention are those conventional in the art.
Example 1: isolation and characterization of the fungus Aspergillus sp
1. Materials: mangrove forest from the sea side of the Guangxi Zhuang autonomous region Qinzhou city.
2. The pure endophytic fungus strain GXNU-A1 is separated from the mangrove plant acanthus trifoliatus by adopting a block tissue method, and is identified as aspergillus Aspergillus sp GXNU-A1 by gene sequencing, and the sequence is as follows: TCCATTGGGGTCTCCGGCGGGCGCGGTCCCGGGGGCAGGCCCCGGGCCGCCCGAAGGCGGGCCCGCCGAAGCAACAGGGTACGGTAAGCACGGGTGGGAGGTTGGGCCCCGAAGGACCCAGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCC.
Example 2: preparation of the Compounds
1. The compounds were isolated from the fungal Aspergillus sp GXNU-A1 metabolite as follows:
(1) Seed culture of fungi Aspergillus sp GXNU-A1:
seed medium composition: glucose 20 g, yeast extract 2 g, magnesium sulfate 0.1g, potassium dihydrogen phosphate 0.2 g, sodium chloride 5g, and water 1L (the preparation method comprises mixing the above materials, dissolving, and shaking).
And (3) after the culture medium is sterilized at high temperature, the strain is selected by an inoculating loop and inoculated, and the culture medium is subjected to shaking culture at the constant temperature of 25 ℃ for 3 days to obtain a seed culture solution.
(2) Fermentation culture of fungus Aspergillus sp GXNU-A1:
the formula of the fermentation medium comprises 20 g of glucose, 2 g of yeast extract, 0.1g of magnesium sulfate, 0.2 g of monopotassium phosphate and 5g of sodium chloride, deionized water is added to 1L, the mixture is stirred until the mixture is completely dissolved, and the mixture is packaged into 500ml triangular flasks and sterilized at the high temperature of 121 ℃ for 20min.
Transferring the strain in the seed liquid into a triangular flask filled with a culture medium, controlling the inoculation amount to 8-20ml, and controlling the temperature at 28 all the time and culturing for 30 days.
(3) Standing and extracting the fermentation product with ethyl acetate for three times, extracting the obtained thalli with methanol for three times, and concentrating the extract to obtain extractum; separating the extract by column chromatography, respectively eluting with dichloromethane-methanol at volume ratio of 100:1-70:30, collecting dichloromethane-methanol eluent at volume ratio of 80:20, separating by normal phase silica gel column chromatography, and semi-preparing reversed phase C-18 reversed phase column to obtain the final product.
EXAMPLE 3 structural test resolution of Compounds
Structural test analysis was performed on the compound obtained in example 2 above to obtain the following test data:
compound 1: c (C) 19 H 20 NO 3 White crystals, HR-ESI-MS m/z 310.1442 (theoretical calculation 310.1443). One-dimensional nuclear magnetic resonance data: 1 H NMR 1.35(3H,s)，1.66(3H,s)，2.07(3H,s)，2.56(1H,d,J＝19.0)，3.16(1H,dd,J＝19.0,3.8)，6.27(1H,br s)，7.26(1H,d,J＝7.4)，7.36(2H,t,J＝7.4)，7.51(2H,d,J＝7.4)，9.56(1H,br s)，10.89(1H,br s)； 13 c NMR 8, 17.1, 25.2, 46.2, 46.8, 105.5, 105.6, 127.4, 127.5, 128.8, 129.1, 131.5, 134.2, 159.7, 171.6, 171.7, 213.5. Crystal structure data: CCDC:2215742.
the high resolution mass spectrum (HR-ESI-EI) of the compound obtained in example 2 is shown in FIG. 1, the ultraviolet spectrum (UV) is shown in FIG. 2, the infrared spectrum (IR) is shown in FIG. 3, 1 the H NMR is as shown in FIG. 4, 13 c NMR is as 5.
The structural formula of the compound is shown in the following formula (I) through identification:
EXAMPLE 4 test of Activity of Compounds
Inhibition of RAW264.7 cells by the compound obtained in example 2 experiment:
1. materials:
1.1DMEM high-sugar medium, fetal bovine serum, trypsin (Gibco, U.S.) and; phosphate Buffered Saline (PBS) (Gibco, usa); dimethyl sulfoxide (Mpbio in the united states); CCK8 cell count kit (APExBIO, usa); dexamethasone, lipopolysaccharide (LPS) (Sigma in the united states); griess kit (Shanghai Biyun Tian).
1.2 cytotoxicity test of compounds:
the compound was dissolved with dimethyl sulfoxide (100%) to a concentration of 20 mmol.L -1 Freezing in refrigerator, and diluting with DMEM high sugar culture solution to 200 μmol.L -1 . RAW264.7 cells were digested with 0.25% trypsin and resuspended in DMEM high-sugar medium containing 10% FBS at 1.25X10 per ml 4 Individual cells (100 μl per well) were seeded in 96-well plates and placed in 5% CO 2 After 24 hours of culture in a constant temperature incubator at 37 ℃, each group was subjected toThe culture medium was replaced with fresh DMEM high sugar culture medium containing 10% FBS. Compound test groups were added with the corresponding compound (the compound obtained in example 2 or dexamethasone) (10. Mu.L per well), and after the normal control group was added with DMEM high-sugar culture solution containing 10% fetal bovine serum (10. Mu.L per well) for further culture for 24 hours, 5 mg.mL was added -1 MTT (10. Mu.L per well) was stained for viable cells, using resveratrol as a control. After incubation for 3h, the culture broth was discarded, dissolved by adding DMSO (100. Mu.L per well) and shaken on a plate shaker to allow sufficient dissolution, followed by determination of OD at 490 nm. Blank groups 100 μl DMSO was added per well and the cell viability of each group was calculated using the following formula:
cell viability (%) = (OD value Compound test group -OD value Blank group ) /(OD value) Normal control group -OD value Blank group )×100％。
1.3 testing of anti-inflammatory Activity of Compounds
RAW264.7 cells at 2X 10 per ml 5 Density of the individual was inoculated into 96 well plates (100. Mu.L per well) and placed in a medium containing 5% CO 2 After 24 hours of culture in a constant temperature incubator at 37 ℃, the culture solution of each group was replaced with fresh DMEM high-sugar culture solution containing 10% fetal bovine serum. The compound to be tested (compound obtained in example 2 or dexamethasone) was added to the administration group at the corresponding concentration (10. Mu.L per well), and the normal control group and lipopolysaccharide model group were added with DMEM high-sugar culture medium containing 10% fetal bovine serum (10. Mu.L per well). Then 0.001 mg.multidot.mL was added to the compound test group and lipopolysaccharide model group, respectively -1 To the normal control group, 10. Mu.L of DMEM high-sugar culture medium containing 10% FBS was added (10. Mu.L per well). After further incubation for 24h, 50. Mu.L of supernatant was reacted with 50. Mu.L of Greiss reagent per well for 15min at room temperature. OD values were measured at 540nm, and the molar mass fractions of Nitric Oxide (NO) for each group were calculated using a standard curve of nitric oxide, and the inhibition ratios for each dosing group were further calculated. The calculation formula is as follows:
NO generation inhibition rate (%) =1-w 1 ÷w 2 ×100％
w 1 Represents the NO molar mass fraction, w, of the compound test group 2 NO molar mass fraction representing lipopolysaccharide group。
2. Test results
The test results show that two cyclic peptide compounds ((the compound obtained in example 2 or dexamethasone)) can significantly and effectively inhibit NO generated by cells, and the inhibition IC of the two cyclic peptide compounds on NO generated by RAW264.7 cells 50 The values (. Mu.M) are shown in Table 1.
TABLE 1 inhibition of NO production by RAW264.7 cells by two cyclic peptides (IC 50 μM)
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.
Claims (9)
1. A heterocyclic ester compound containing a phenyl furan pyridone skeleton is characterized in that: the compound has a structure shown in the following formula (I):
2. the heterocyclic ester compound containing a phenyl furan pyridone skeleton according to claim 1, wherein: the compound is isolated from fermentation broth of marine fungus Aspergillus sp.GXNU-A1.
3. The method for preparing the heterocyclic ester compound containing the phenyl furan pyridone skeleton according to claim 1, which is characterized by comprising the following operation steps:
s1, inoculating marine fungus Aspergillus sp.GXNU-A1 into a seed culture medium, and performing shake culture to obtain a seed culture solution;
s2, inoculating the seed culture solution into a fermentation culture medium, and standing for culture to obtain a fermentation product;
s3, standing and extracting the fermentation product with ethyl acetate for three times, extracting the obtained thalli with methanol for three times, concentrating the extract to obtain an extract, and obtaining the compound with the structure shown in the structural formula (I) by adopting a column chromatography separation technology.
4. A method of preparation according to claim 3, characterized in that: the formula of the seed culture medium in the step S1 is as follows: the average per liter of seed culture medium comprises 100 grams of glucose, 10 grams of yeast extract, 0.5 grams of magnesium sulfate, 1 gram of monopotassium phosphate, 5 grams of sodium chloride and the balance of water.
5. A method of preparation according to claim 3, characterized in that: the condition of the shake culture in the step S1 is that the rotation speed of the shake table is 200rpm, and the shake culture is carried out for 3-7 days at 25-30 ℃.
6. A method of preparation according to claim 3, characterized in that: the formula of the fermentation medium in the step S2 is as follows: the average fermentation medium comprises 20 g of glucose, 2 g of yeast extract, 0.1g of magnesium sulfate, 0.2 g of monopotassium phosphate, 5g of sodium chloride and the balance of water.
7. A method of preparation according to claim 3, characterized in that: and (2) standing the culture at 25-30 ℃ for 25-50 days under the condition of standing culture in the step (S2).
8. A method of preparation according to claim 3, characterized in that: the specific operation of the column chromatography separation in the step S3 is as follows: separating the extract by column chromatography with silica gel column, respectively eluting with dichloromethane-methanol as eluent in volume ratio of 100:1-70:30, collecting dichloromethane-methanol eluent in volume ratio of 80:20, and repeatedly separating by column chromatography with normal phase silica gel column; separating the eluent by semi-preparative liquid chromatographic column chromatography, preparing and collecting the eluent by using 60% methanol aqueous solution by volume percent concentration, and obtaining the heterocyclic ester compound containing the phenyl furan pyridone skeleton.
9. The use of a heterocyclic ester compound containing a phenyl furan pyridone skeleton according to claim 1 for preparing an anti-inflammatory drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211551467.6A CN116178240A (en) | 2022-12-05 | 2022-12-05 | Heterocyclic ester compound containing phenyl furan pyridone skeleton, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211551467.6A CN116178240A (en) | 2022-12-05 | 2022-12-05 | Heterocyclic ester compound containing phenyl furan pyridone skeleton, preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116178240A true CN116178240A (en) | 2023-05-30 |
Family
ID=86445008
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211551467.6A Pending CN116178240A (en) | 2022-12-05 | 2022-12-05 | Heterocyclic ester compound containing phenyl furan pyridone skeleton, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116178240A (en) |
-
2022
- 2022-12-05 CN CN202211551467.6A patent/CN116178240A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111139188B (en) | Novel skeleton heteroterpene derivative derived from marine fungi and application of novel skeleton heteroterpene derivative in preparation of anti-inflammatory drugs | |
| CN107298671B (en) | Selenolonic acid H from penicillium oxalicum and application thereof in preparing medicine for resisting human colon cancer | |
| CN107353274B (en) | Selenolonic acid I from penicillium oxalicum and application thereof in preparation of human esophageal cancer resistant medicine | |
| CN108640968B (en) | Mixed-source terpenoid and application thereof in preparation of anti-inflammatory drugs | |
| CN106432168B (en) | The anti-vibrios reactive compound and preparation method thereof in mangrove cusp sea lotus endogenetic fungus source | |
| CN107485607B (en) | Application of seclenic acid H derived from penicillium oxalicum in preparation of human esophageal cancer resistant medicine | |
| CN107298670B (en) | Application of medicine derived from penicillium oxalicum seclenum ketonic acid H in preparation of anti-human oral epidermoid carcinoma medicines | |
| CN108315264A (en) | A kind of polyketide in sea paint endogenetic fungus source and its application in preparing anti-inflammatory drug | |
| CN103911407B (en) | The preparation method of the Azaphilone class dimer compound in a kind of marine fungi source and application | |
| CN110407792B (en) | Secalonic acid J compound derived from penicillium oxalicum and preparation method thereof | |
| CN102030753A (en) | Prenylated indole alkaloids and preparation method and application thereof | |
| CN115477693B (en) | Two cyclic peptide compounds derived from marine fungi, preparation method thereof and application thereof in preparation of anti-inflammatory drugs | |
| CN103910701A (en) | Marine fungus-derived naphthoquinone compound, and preparation method and application thereof | |
| CN104804020B (en) | Sulfodionepiperazine compound, and preparation method and use thereof | |
| CN106432169B (en) | A kind of active isocoumarin class compound of anti-vibrios and its crystal | |
| CN109134416B (en) | Application of seclenic acid H derived from penicillium oxalicum in preparation of human cervical cancer drugs | |
| CN107686817B (en) | Chrysanthemum bud endophytic fungus CYSK-4 and application of Ascomylactam compound produced by same | |
| CN116178240A (en) | Heterocyclic ester compound containing phenyl furan pyridone skeleton, preparation method and application thereof | |
| CN113861029A (en) | Polyketide derived from marine fungi as well as preparation method and application thereof | |
| CN110407794B (en) | Selenolonic acid K derived from penicillium oxalicum and application thereof in inhibiting cancer cell proliferation | |
| CN110407797B (en) | Secalonic acid K compound derived from penicillium oxalicum and preparation method thereof | |
| CN108794502B (en) | Trichothecene compound and preparation method and application thereof | |
| CN107973803B (en) | Seven-membered lactonofuran derivative and preparation method and application thereof | |
| CN113004237A (en) | Spiro compound and preparation method and application thereof | |
| CN102051394A (en) | Preparation method and application of sulfo-diketopiperazine compounds |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |