CN116162627B - Soybean cyst nematode gene Hg-goa-1, encoding protein and application of dsRNA thereof in nematode control - Google Patents
Soybean cyst nematode gene Hg-goa-1, encoding protein and application of dsRNA thereof in nematode control Download PDFInfo
- Publication number
- CN116162627B CN116162627B CN202211474247.8A CN202211474247A CN116162627B CN 116162627 B CN116162627 B CN 116162627B CN 202211474247 A CN202211474247 A CN 202211474247A CN 116162627 B CN116162627 B CN 116162627B
- Authority
- CN
- China
- Prior art keywords
- goa
- soybean cyst
- gene
- dsrna
- cyst nematode
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43536—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
- C07K14/4354—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from nematodes
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G13/00—Protecting plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
- A01P5/00—Nematocides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Plant Pathology (AREA)
- Biomedical Technology (AREA)
- Environmental Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Pest Control & Pesticides (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biophysics (AREA)
- Toxicology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Agronomy & Crop Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Dentistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The application of soybean cyst nematode gene Hg-goa-1, its coding protein and dsRNA thereof in nematode control relates to the field of molecular biology, in particular to the application of soybean cyst nematode gene Hg-goa-1, its coding protein and dsRNA thereof in nematode control. The method aims to solve the problems that the existing chemical prevention and treatment method for the soybean cyst nematode has environmental pollution and the resistance is extremely easy to lose by utilizing the resistant varieties. The nucleotide sequence of the gene is shown as SEQ ID NO in a sequence table: 1, the amino acid sequence of which is shown in a sequence table SEQ ID NO:2, the dsRNA sequence of which is shown as SEQ ID NO in a sequence table: 3. The gene plays a key role in regulating and controlling the movement, infection host and development process of the soybean cyst nematode, and is used as a target gene for the development of soybean cyst nematode control medicines. The invention is used in the field of soybean cyst nematode control.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to a soybean cyst nematode gene Hg-goa-1, a coding protein thereof and application of dsRNA thereof in nematode control.
Background
Soybean is an important grain and oil crop, and soybean cyst nematode disease is one of the important soil-borne diseases caused by infection of soybean with parasitic soybean cyst nematodes (Soybean cyst nematode, SCN) in resident plants. Soyabean cyst nematode disease occurs in soybean production areas in China, and economic losses caused by the disease are estimated to be up to 6 hundred million yuan each year. SCN is easy to cause slow growth of host root after entering root system, and leaf yellowing, generally 30-50% yield reduction, and serious production insulation. The soybean planting area is increased year by year due to the change of the industrial structure in China, and the disease is also serious. In addition, wounds caused by infection with soybean cyst nematodes can cause secondary diseases or increase the severity of other diseases, such as sudden death of soybean, phytophthora sojae, stem rot of soybean, etc.
The current chemical prevention and treatment of soybean cyst nematode is effective, but has great destructiveness on environmental ecology and human and animal safety; the combination of disease-resistant varieties and non-host rotation is also an effective control method for controlling the disease, but the disease resistance is single, a plurality of physiological micro-varieties exist in the field and are easy to change, so that the resistance is easy to lose, and limited land use causes rotation to be limited by organisms.
In combination with these situations, it is highly desirable to establish new control strategies. The development of novel biogenic nematicides that are efficient, non-toxic and broad-spectrum in terms of the interaction mechanisms of nematodes with plants is now a major issue in the study of scholars. The novel genes of the soybean cyst nematodes are excavated and screened, the functions of the genes in the soybean cyst nematode behavior, infection and development processes are analyzed, and the novel biological source nematicide is developed by taking the genes as novel targets, so that the novel biological source nematicide has important theoretical guiding significance and practical application value.
Disclosure of Invention
The invention aims to solve the problems of environmental pollution and extremely easy loss of resistance of a resistant variety in the existing chemical prevention and treatment method of soybean cyst nematodes, and provides a soybean cyst nematode gene Hg-goa-1, a coding protein thereof and application of dsRNA thereof in nematode prevention and treatment.
The invention provides a soybean cyst nematode gene Hg-goa-1, the nucleotide sequence of which is shown as SEQ ID NO: 1.
The invention provides a coding protein of soybean cyst nematode gene Hg-goa-1, the amino acid sequence of which is shown in a sequence table SEQ ID NO: 2.
The dsRNA sequence of the soybean cyst nematode gene Hg-goa-1 is shown as SEQ ID NO in a sequence table: 3.
The invention designs a specific primer by taking soybean cyst nematode G protein alpha subunit gene Hg-goa-1 as a template, and synthesizes a dsRNA fragment of the gene Hg-goa-1 by using a MEGAscript RNAi kit.
The invention also provides application of the dsRNA of the soybean cyst nematode gene Hg-goa-1 in nematode control.
The specific method comprises the following steps: soaking the two-instar larvae of the soybean cyst nematode in a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-goa-1, and carrying out shaking incubation for 48 hours at room temperature.
The invention has the beneficial effects that:
the gene Hg-goa-1 of the invention is derived from soybean cyst nematode G protein alpha subunit, and the test result shows that the gene is expressed in a tail sensor of the nematode and is expressed highest in parasitic second-instar larvae of the soybean cyst nematode.
Aiming at the base sequence of G protein alpha subunit gene Hg-goa-1, the invention screens specific functional areas to synthesize dsRNA, and determines the mobility behavior capability, the infection capability and the fertility of nematodes after dsRNA treatment by an in vitro interference method, thereby verifying the function of the gene Hg-goa-1 in the pre-parasitic and parasitic processes of the nematodes. After the soybean cyst nematode G protein alpha subunit gene Hg-goa-1 is treated by double-stranded RNA fragment dsRNA-Hg-goa-1, the expression of the gene Hg-goa-1 is obviously inhibited, and the number of second-instar larvae infected into roots and the number of cysts in root surfaces and soil after 35 days of infection are respectively reduced by 36.7% and 24.7%. The result shows that the gene plays a key role in regulating and controlling the movement, infection host and development process of soybean cyst nematode, and can be used as a target gene for developing a nematicide.
The soybean cyst nematode gene Hg-goa-1 disclosed by the invention is involved in regulating and controlling the movement of soybean cyst nematodes and infection and reproduction of the soybean cyst nematodes on hosts, and can be used as a target gene for the development of soybean cyst nematode control medicines. The study also reports cloning and functional analysis of the goa gene encoding the G protein in plant parasitic nematodes for the first time.
The invention has great theoretical and application value for researching pathogenic mechanism of soybean cyst nematode and preventing nematode.
Drawings
FIG. 1 shows RT-PCR cloning of soybean cyst nematode G protein alpha subunit gene Hg-goa-1;
FIG. 2 shows in situ hybridization of G protein alpha subunit gene Hg-goa-1 in the SCN tail sensor cell;
FIG. 3 is the effect of exogenous dsRNA treatment on Hg-goa-1 expression in second instar larvae;
FIG. 4 is the rate of movement of exogenous dsRNA treated and untreated second instar larvae J2;
FIG. 5 is the amount of J2 in roots of soybeans 36h after J2 infestation of roots by exogenous dsRNA treated and untreated second instar larvae;
figure 6 shows root surface and cyst count in soil 35 days after inoculation of soybean with exogenous dsRNA treated and untreated second instar larvae J2.
Detailed Description
The technical scheme of the invention is not limited to the specific embodiments listed below, and also includes any combination of the specific embodiments.
The first embodiment is as follows: the nucleotide sequence of the soybean cyst nematode gene Hg-goa-1 in the embodiment is shown as SEQ ID NO: 1.
The second embodiment is as follows: the amino acid sequence of the coding protein of the soybean cyst nematode gene Hg-goa-1 is shown as a sequence table SEQ ID NO: 2.
And a third specific embodiment: the dsRNA sequence of the soybean cyst nematode gene Hg-goa-1 in the embodiment is shown as SEQ ID NO: 3.
In the embodiment, the soybean cyst nematode G protein alpha subunit gene Hg-goa-1 is used as a template, a specific primer is designed, and a dsRNA fragment of the gene Hg-goa-1 is synthesized through a MEGAscript RNAi kit.
The specific embodiment IV is as follows: the dsRNA of the soybean cyst nematode gene Hg-goa-1 is applied to prevention and treatment of nematodes.
Fifth embodiment: the fourth difference between this embodiment and the third embodiment is that: the specific method for preventing and controlling nematodes by dsRNA of soybean cyst nematode gene Hg-goa-1 comprises the following steps: soaking the two-instar larvae of the soybean cyst nematode in a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-goa-1, and carrying out shaking incubation for 48 hours at room temperature. The other is the same as in the fourth embodiment.
The following examples of the present invention are described in detail, and are provided by taking the technical scheme of the present invention as a premise, and the detailed embodiments and specific operation procedures are given, but the scope of the present invention is not limited to the following examples.
Example 1: cloning of soybean cyst nematode G protein alpha subunit gene Hg-goa-1
1. Collecting newly hatched two-instar larvae of soybean cyst nematode, putting into a biological freezing grinder, adding a proper amount of liquid nitrogen, quickly grinding, transferring nematode powder into a 1.5mL centrifuge tube, adding Trizol 1mL, shaking and uniformly mixing to extract total RNA of the nematode.
2. Using the total RNA in step 1 as a template, usingThe One-Step gDNA Removal and cDNA Synthesis SuperMix kit synthesizes the nematode cDNA, and the synthesized cDNA is stored in a refrigerator at the temperature of minus 80 ℃ for standby.
3. And (3) carrying out PCR (polymerase chain reaction) sectional amplification on the gene Hg-goa-1 by using the cDNA synthesized in the step (2) as a template and using an upstream primer and a downstream primer.
The upstream primer and the downstream primer of the gene Hg-goa-1 are as follows:
Hg-goa-1-1F：5’-ATGGGCTGCACAATGAGTC-3’
Hg-goa-1-1R：5’-GAACGCCGAAGGGAATG-3’
Hg-goa-1-2F：5’-ATGAAGATTATCCACGAGTCC-3’
Hg-goa-1-2R：5’-AAAGGCCGCACCCGCGCAAATTATT-3’
Hg-goa-1-3F：5’-CGACACTTCCATCATTCTC-3’
Hg-goa-1-3R：5’-TCAGTAAAGGCCGCACCC-3’
amplification reaction system: t3 Super PCR Mix, 36. Mu.L, cDNA template, 2. Mu.L, upstream primer, 2. Mu.L, downstream primer, 2. Mu.L, ddH 2 O, 8. Mu.L, 50. Mu.L of the total reaction system.
Reaction conditions: denaturation at 98℃2min,98 ℃,10s,50-57 ℃,10s,72℃extension 15se/kb,35 cycles; extending at 72 ℃ for 2min, and preserving at 4 ℃. The PCR products were identified by 1% agarose gel electrophoresis, and the results are shown in FIG. 1.
4. And (3) connecting the PCR amplification product in the step (3) with a T carrier, converting into escherichia coli DH5 alpha for culture, and taking 500 mu L of bacterial liquid for sequencing. Sequencing results show that the amplified product has the sequence shown in SEQ ID NO:1, and encodes the open reading frame shown in the sequence table of the sequence table: 2, and a protein represented by formula 2. Will have the sequence set forth in SEQ ID NO:2 is named as protein Hg-GOA-1, and the coding gene is named as Hg-GOA-1.
Example 2: tissue localization analysis of Gene Hg-goa-1
Tissue localization analysis was performed on two-instar larvae of soybean cyst nematode according to the method of DIG High Prime DNA Labeling and Detection Starter KitI.
1. The cDNA of soybean cyst nematode is used as template to amplify target fragment with upstream primer and downstream primer.
Amplification reaction system: t3 Super PCR Mix, 7.2. Mu.L, cDNA template, 0.4. Mu.L, upstream primer, 0.4. Mu.L, downstream primer, 0.4. Mu.L, ddH 2 O, 1.6. Mu.L, 10. Mu.L of the total reaction system. Reaction conditions; denaturation at 98℃2min,98 ℃,10s,50-57 ℃,10s,72℃extension 15s/kb,35 cycles; extending at 72 ℃ for 2min, and preserving at 4 ℃. The PCR product was separated and purified by 1% agarose gel electrophoresis.
2. Digoxin-labeled sense and antisense probes were synthesized using asymmetric PCR.
DIG was labeled with the partial fragment of the gene recovered in step 1 of this example as a template to obtain a sense strand probe and an antisense strand probe. Wherein the partial fragment length of the gene Hg-goa-1 is 904bp.
3. In situ hybridization was performed.
The results of in situ hybridization are shown in FIG. 2. The results show that after the Hg-goa-1 marked by the antisense strand probe is treated, the tissue cells of the nematode tail sensor generate a chromogenic reaction. The results show that Hg-goa-1 is mainly expressed in the caudate sensor tissue of soybean cyst nematode second-instar larvae (J2 s), and the caudate sensor is an important part of nematode sensory control.
Example 3: in vitro RNAi interference test for verifying Hg-goa-1 function
1. Synthesis of dsRNA: the specific primers were designed according to the gene Hg-goa-1 cloned in example 1:
primer Hg-GOA-1-si-T7F:
5’-TAATACGACTCACTATAGGGAGGGGTGTCCAGGAGTGTT-3’
primer Hg-GOA-1-si-R:
5’-GACGCCTCGTGGTAAT-3’
primer Hg-GOA-1-si-F:
5’-GGGTGTCCAGGAGTGTT-3’
primer Hg-GOA-1-si-T7R:
5’-TAATACGACTCACTATAGGGAGGACGCCTCGTGGTAAT-3’
t7 promoter sequence TAATACGACTCACTATAGGGAG was introduced at the 5' end of the specific primer. dsRNA was synthesized using cDNA as a template, purified and used in the next test.
2. According to MEGAscript TM RNAi Kit instruction manual synthesis of dsRNA
The reaction system: 1. Mu.g of the recovered gene fragment template, 2. Mu.L of 10 XT 7 reaction buffer, 2. Mu.L of ATP, 2. Mu.L of CTP, 2. Mu.L of GTP, 2. Mu.L of UTP, 2. Mu.L of T7 Enzyme Mix, and 4h incubation at-20℃in the dark without the addition of nuclease water were carried out to 20. Mu.L. The product was identified by 1% agarose gel electrophoresis, the concentration of dsRNA was measured at 260nm wavelength and the synthesized dsRNA was stored at-80 ℃. The dsRNA sequence is shown as SEQ ID NO in a sequence table: 3.
3. And collecting newly hatched two-instar larvae of soybean cyst nematodes, and cleaning for three times by using 1/4M9 buffer for later use.
4. Methods in vitro RNAi interference by two-instar larvae of soybean cyst nematodes are described in the reference article (Urwin PE, lilley CJ, atkinsonHJ.Molecular Plant-Microbe Interactions,2002, 15:747-752.). 500 second-instar larvae collected in the step 3 of the embodiment are respectively soaked in the treatment liquid 1, the treatment liquid 2 and the treatment liquid 3, 500 larvae/sample are taken, each treatment is repeated three times, and the larvae are subjected to shaking incubation for 48 hours at room temperature.
Treatment 1 contained 50mM octopamine, 3mM arginine, 0.05% gelatin, 1.5mg/mL dsRNA, and 0.1mg/mL FITC.
Treatment 2 contained 50mM octopamine, 3mM arginine, 0.05% gelatin, and 1.5mg/mL dsRNA.
Treatment 3 contained 50mM octopamine, 3mM arginine, 0.05% gelatin, and 1.5mg/mL gfp.
5. The pipette aspirates a few treatment fluid 1 groups of second-instar larvae and detects whether green fluorescence is visible in the nematode body at a wavelength of 488-525nm using a fluorescence microscope.
6. The total RNA of the soybean cyst nematode is soaked in the extracting treatment solution 2 and the treatment solution 3 and is reversely transcribed into cDNA, and the expression quantity of the gene Hg-goa-1 (with the actin gene as an internal reference) is detected by using fluorescent quantitative PCR, so that the expression quantity of Hg-goa-1 in the soybean cyst nematode is obviously reduced after dsRNA treatment of the Hg-goa-1 as shown in figure 3.
Fluorescent quantitative PCR detection primer:
primer Hg-goa-1F:5'-CGGGTGTCCAGGAGTGT-3'
Primer Hg-goa-1R:5'-CAAGCGGTCCAAATCG-3'
Primer Hg-actin F:5'-GCGTGGTTACTCCTTCGTG-3'
Primer Hg-actin R:5'-CGGGCAGTTCGTAGCTCTTC-3'
Primer GFP F:5'-GCAGAAGAACGGCATCAAG-3'
Primer GFP R:5'-TCCAGCAGGACCATGTGAT-3'
7. 100 dsRNA-interfered second-instar larvae are evenly mixed into 40 mu L of PF-127 gel with the concentration of 11.5%, 30 mu L of the mixed gel is dripped on a glass slide, the glass slide is covered, the glass slide is placed under a biological microscope for observation, and a camera is used for shooting the behavior of the nematodes for 1min. The video was imported into WormLab software to analyze the behavioral changes of nematodes after gene Hg-goa-1 interference. The results are shown in FIG. 4, and the moving speed of the second-instar larvae is improved by 32.3% after dsRNA interference, which indicates that the gene Hg-goa-1 regulates the moving behavior of the second-instar larvae.
8. 250 second-instar larvae treated by the treatment liquid 2 and the treatment liquid 3 are inoculated with soybean seedlings, and after culturing in the dark for 36 hours, the infection rate is detected by a fuchsin method. Subtracting the upper part of the soybean, washing the soybean root with clear water, and soaking in 1.5% sodium hypochlorite solution for 3min. Taking out soybean roots, thoroughly cleaning sodium hypochlorite with sterile water, soaking the cleaned soybean roots in fuchsin solution, and heating to boil the solution. After boiling for 30s, the solution was left at room temperature until the fuchsin solution cooled to room temperature. And cleaning a soybean root with clear water, preparing a glass slide, counting the number of the line worms in the root under a stereoscopic microscope, and calculating the infection rate. The calculation formula of the infection rate is as follows:
infestation = (number of line worms invading root/number of nematodes inoculated) ×100%
9. The root surface and the number of cysts in the soil were counted 35d after inoculation.
The effect of exogenous dsRNA-Hg-goa-1 on SCN infestation and reproduction after treatment of second instar larvae (H.glycoses J2 s) is shown in FIGS. 5 and 6. The result shows that after RNAi interference, the expression quantity of Hg-goa-1 is reduced by 28.5%, the infection rate and cyst number of dsRNA-Hg-goa-1 treatment are respectively reduced by 36.7% and 24.7%, and the result shows that dsRNA can interfere the expression of Hg-goa-1, and Hg-goa-1 silencing affects the infection and development of nematodes, so that the dsRNA can be used as a target gene of a nematicide for nematode prevention and control.
Claims (3)
1. dsRNA of soybean cyst nematode gene Hg-goa-1, the sequence of which is shown as SEQ ID NO in a sequence table: 3.
2. The use of the dsRNA of the soybean cyst nematode gene Hg-goa-1 of claim 1 for controlling nematodes; the nematode is soybean cyst nematode.
3. The use according to claim 2, characterized in that the specific method for controlling nematodes is: soaking the two-instar larvae of the soybean cyst nematode in a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-goa-1, and carrying out shaking incubation for 48 hours at room temperature.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211474247.8A CN116162627B (en) | 2022-11-22 | 2022-11-22 | Soybean cyst nematode gene Hg-goa-1, encoding protein and application of dsRNA thereof in nematode control |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211474247.8A CN116162627B (en) | 2022-11-22 | 2022-11-22 | Soybean cyst nematode gene Hg-goa-1, encoding protein and application of dsRNA thereof in nematode control |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116162627A CN116162627A (en) | 2023-05-26 |
| CN116162627B true CN116162627B (en) | 2023-09-08 |
Family
ID=86410022
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211474247.8A Active CN116162627B (en) | 2022-11-22 | 2022-11-22 | Soybean cyst nematode gene Hg-goa-1, encoding protein and application of dsRNA thereof in nematode control |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116162627B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111575296A (en) * | 2020-06-18 | 2020-08-25 | 中国科学院东北地理与农业生态研究所 | Soybean cyst nematode Hg-flp-1 gene and encoding protein and application thereof |
-
2022
- 2022-11-22 CN CN202211474247.8A patent/CN116162627B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111575296A (en) * | 2020-06-18 | 2020-08-25 | 中国科学院东北地理与农业生态研究所 | Soybean cyst nematode Hg-flp-1 gene and encoding protein and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| KAI3416013.1;NCBI;genpept;1-4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116162627A (en) | 2023-05-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111575296B (en) | Soybean cyst nematode Hg-flp-1 gene and encoding protein and application thereof | |
| CN111690054B (en) | Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application | |
| CN113151292B (en) | Soybean cyst nematode Hg-flp-22 gene and application of dsRNA thereof in nematode control | |
| CN116970623B (en) | Gene segment for preventing and controlling wheat stem-based rot and application thereof | |
| CN102653763B (en) | Meloidogyne javanica dominant-effect gene (Mj-nulg), related protein and application of Mj-nulg | |
| CN116162627B (en) | Soybean cyst nematode gene Hg-goa-1, encoding protein and application of dsRNA thereof in nematode control | |
| CN111567566B (en) | Aphid control agent, RNAi and beauveria bassiana combined application aphid control method | |
| CN106957358A (en) | Cereal cyst nematode Ha34609 albumen, encoding gene and its application | |
| CN113912698B (en) | Pc-CD protein of Caesalpinia aphelenchoides, coding gene and application thereof | |
| EP2121972B1 (en) | Method for detecting cyst nematodes | |
| CN115717147B (en) | Soybean cyst nematode gene Hg-ocr-2, encoding protein and application of dsRNA thereof in nematode control | |
| CN115717146B (en) | Soybean cyst nematode gene Hg-osm-9, encoding protein and application of dsRNA thereof in nematode control | |
| Hsieh et al. | Detection of Ranavirus by PCR and in situ hybridization in the American bullfrog (Rana catesbeiana) in Taiwan | |
| CN114605504A (en) | Wheat yellow mosaic virus 14K protein capable of inducing plant cell necrosis and application thereof in virus resistance | |
| CN103524611B (en) | Meloidogyne incognita esophageal gland specific gene Msp40 and proteins encoded thereof are applied with it | |
| CN116751769B (en) | Pc-CL protein of Caesalpinia aphelenchoides, coding gene and application thereof | |
| CN111378670A (en) | Separated adelphocoris suturalis Taiman gene and encoded protein thereof | |
| CN1840544A (en) | ESC42 protein, preparation method and use thereof | |
| CN113881683B (en) | Migratory locust zen gene dsRNA and application thereof | |
| CN116024219B (en) | Subterranean termite antibacterial peptide Oftermicin gene and application thereof | |
| CN111172182B (en) | Phytophthora capsici PcMPK12 gene and vector and application thereof | |
| Sharrnlla et al. | Cloning and Sequencing of Phytoplasma Ribosomal DNA (rONA) Associated with Kerala Wilt Disease of Coconut Palms | |
| Cao et al. | First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China | |
| CN102212518B (en) | Standard molecule for wheat tilletia indica mitra detection and construction method thereof | |
| CN101186917A (en) | Magnaporthe grisea exciton CSB I gene and clone method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |