CN116162608A

CN116162608A - Nicotinamide ribose kinase mutant with enhanced thermal stability, coding gene and application

Info

Publication number: CN116162608A
Application number: CN202211004695.1A
Authority: CN
Inventors: 薛亚平; 程峰; 吴晓虎; 李欢; 沈其; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2022-08-22
Filing date: 2022-08-22
Publication date: 2023-05-26

Abstract

The invention relates to a nicotinamide riboside kinase mutant with enhanced thermal stability, a coding gene, a vector containing the coding gene, genetically engineered bacteria and application, wherein the mutant is obtained by single mutation or multi-point combined mutation of 140 th, 134 th, 136 th and 137 th of an amino acid sequence shown in SEQ ID NO. 2. The beneficial effects of the invention are mainly as follows: (1) Compared with wild type enzyme, the nicotinamide riboside kinase mutant constructed by the invention has obviously improved heat stability, and the residual enzyme activity is increased from 14.05% of wild type to 76.24% of mutant after being heated at 45 ℃ for 20 minutes; meanwhile, the unit enzyme activity of the mutant is improved by 2.77 times compared with that of a wild type, so that the reaction temperature of the enzyme can be obviously improved, the reaction rate is accelerated, the reaction time and the production cost are reduced, the NMN yield is improved, the requirement of large-scale industrial production of NMN by adopting a biological enzyme method can be met, and the method has a wide application prospect. (2) The nicotinamide riboside kinase mutant constructed by the invention has increased stability, can effectively prolong the preservation time of the enzyme and reduce the use cost of the enzyme.

Description

Nicotinamide ribose kinase mutant with enhanced thermal stability, coding gene and application

Field of the art

The invention relates to a nicotinamide riboside kinase mutant with enhanced thermal stability, a coding gene, a vector containing the coding gene, genetically engineered bacteria and application.

(II) background art

Nicotinamide mononucleotide (Nicotinamide mononuclotide, NMN), which is a naturally occurring biologically active nucleotide, has 2 irregularly occurring forms, the alpha and beta isomers. Wherein the beta isomer is an active form of NMN and has a molecular weight of 334.221g/mol. NMN is nicotinamide adenine dinucleotide (Nicotinamide adenine dinucleotide, NAD) in mammals ⁺ Also known as coenzyme I) is an important intermediate of the synthetic pathway. In recent years, related research reports in Science, nature, cell and other international journal of authoritative academy show that NMN supplementation can effectively increase and restore the level of coenzyme I in vivo, greatly delay aging, prevent senile dementia and other various neuron degeneration diseases, and radically condition and improve various symptoms of aging. Therefore, the functional health food taking NMN as an active ingredient has great development potential and market prospect. At present, NMN is approved as a health food raw material in developed countries such as Europe, america and the sun, and various health products such as HERBALmax, geneHarbor NMN9000 in the United states, MIRAI LAB NMN3000 capsules in Japan and the like are developed by taking NMN as a main ingredient.

The current production methods of NMN mainly comprise three types: solid yeast fermentation process, in vitro enzyme catalysis process and chemical synthesis process. Wherein: (1) The solid yeast has complex fermentation process and lower yield, so the product has high price. (2) The chemical synthesis process uses nicotinamide ribose as raw material and phosphorus oxychloride for phosphorylation. Although the technology is easy to control, the impurities in the product are excessive, the separation and purification are difficult, and the overall yield is low; meanwhile, the use amount of the organic solvent is large, and the environmental pollution is not negligible. (3) Enzymes are widely used in the fields of new medicine development, food, chemical industry and the like as a class of high-efficiency biocatalysts complementary to chemical synthesis. The current mainstream NMN production process adopts a safe and green in-vitro enzyme catalysis process.

The main biological enzyme method of NMN is to take nicotinamide riboside (nicotinamide riboside, NR) as a starting material, and to obtain NMN by one-step reaction under the action of nicotinamide riboside kinase (NR kinase, NRK) and ATP. In the case of an enzyme-catalyzed reaction, the reaction rate increases sharply with increasing temperature in the range of the optimum reaction temperature of the enzyme, thereby shortening the reaction time. However, the currently reported enzymes for synthesizing NMN are all enzymes for normal temperature reaction, the thermal stability is not high, the optimal reaction temperature is lower than 37 ℃, the reaction rate is low, and the reaction time is long; meanwhile, the long-term preservation of the enzyme solution is not facilitated.

However, the research on nicotinamide riboside kinase is still less at present, and the application of the biological enzyme catalysis one-step reaction method in the industrial production of preparing NMN is limited. The heat stability and the enzyme activity of nicotinamide riboside kinase are improved by a directional mutation method, which is very helpful for realizing industrial reduction of enzyme quantity and production cost.

(III) summary of the invention

Aiming at the defects of the prior art, the invention provides a nicotinamide riboside kinase mutant with enhanced thermal stability and activity, a coding gene, a vector containing the coding gene, a genetic engineering bacterium and application, so as to solve the problems of low thermal stability, low reaction rate, long reaction time and difficulty in realizing industrial production of the traditional NRK.

The technical scheme adopted by the invention is as follows:

a nicotinamide riboside kinase mutant with enhanced heat stability is obtained by single mutation or multi-point combined mutation of 140 th, 134 th, 136 th and 137 th of an amino acid sequence shown in SEQ ID NO. 2.

The amino acid sequence of human nicotinamide riboside kinase is shown as SEQ ID NO.2, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 1.

Specifically, the mutation is one of the following (single point mutation) or a combination of two or more of them (multipoint mutation): (1) aspartic acid at position 140 to serine; (2) arginine at position 134 is mutated to histidine; (3) tyrosine 136 to glutamic acid; (4) mutation of threonine at position 137 to valine.

Preferably, the mutation is one of the following:

(1) Aspartic acid at position 140 to serine (mutant D140S);

(2) Aspartic acid at position 140 to serine, arginine at position 134 to histidine (mutant D140S-R134H);

(3) Aspartic acid at position 140 to serine, arginine at position 134 to histidine, and tyrosine at position 136 to glutamic acid (mutant D140S-R134H-Y136E);

(4) Aspartic acid at position 140 is mutated to serine, arginine at position 134 is mutated to histidine, tyrosine at position 136 is mutated to glutamic acid, threonine at position 137 is mutated to valine (mutant D140S-R134H-Y136E-T137V).

The invention also relates to a gene for encoding the nicotinamide riboside kinase mutant.

Preferably, the nucleotide sequence of the coding gene is shown as one of SEQ ID NO. 5-8, and the coding gene respectively codes mutant D140S, mutant D140S-R134H-Y136E and mutant D140S-R134H-Y136E-T137V.

The invention also relates to a recombinant vector containing a gene for encoding the nicotinamide riboside kinase mutant and a genetically engineered bacterium containing the gene for encoding the nicotinamide riboside kinase mutant. Specifically, the vector may be any of various expression vectors including, but not limited to, pET expression vector, pCW expression vector, pUC expression vector, or pPIC9k expression vector. The host cell of the genetically engineered bacterium may be any suitable host cell including, but not limited to, E.coli, B.subtilis, streptomyces, or Pichia pastoris.

The invention also relates to application of the nicotinamide riboside kinase mutant in preparing beta-nicotinamide mononucleotide by microbial catalysis.

The specific principle is as follows: the enzyme catalytic system adopts a one-pot method, uses nicotinamide riboside as a substrate, transfers phosphate groups on a phosphate donor to nicotinamide riboside by using nicotinamide riboside kinase to catalyze the nicotinamide riboside to nicotinamide mononucleotide, and can be added with acetic acid kinase to convert by-product Adenosine Diphosphate (ADP) into Adenosine Triphosphate (ATP), because accumulation of excessive ADP has a certain inhibition effect on Nrk, and the converted ATP is added into the reaction again, so that the reaction cost is reduced.

The acetate kinase may employ sequences conventional in the art. Preferably, the amino acid sequence of the acetate kinase is shown as SEQ ID No.4 (the coding gene is shown as SEQ ID No. 3).

The beneficial effects of the invention are mainly as follows:

(1) Compared with wild type enzyme, the nicotinamide riboside kinase mutant constructed by the invention has obviously improved heat stability, and the residual enzyme activity is increased from 14.05% of wild type to 76.24% of mutant after being heated at 45 ℃ for 20 minutes; meanwhile, the unit enzyme activity of the mutant is improved by 2.77 times compared with that of a wild type, so that the reaction temperature of the enzyme can be obviously improved, the reaction rate is accelerated, the reaction time and the production cost are reduced, the NMN yield is improved, the requirement of large-scale industrial production of NMN by adopting a biological enzyme method can be met, and the method has a wide application prospect.

(2) The nicotinamide riboside kinase mutant constructed by the invention has increased stability, can effectively prolong the preservation time of the enzyme and reduce the use cost of the enzyme.

(IV) description of the drawings

FIG. 1 is a reaction scheme for producing nicotinamide mononucleotide by an enzymatic method employed in the method of the present invention;

FIG. 2 is a diagram of nicotinamide riboside nuclear magnetic hydrogen spectra;

FIG. 3 is a nicotinamide mononucleotide nuclear magnetic resonance spectroscopy.

(fifth) detailed description of the invention

The present invention will be described in further detail with reference to the following examples, but the present invention is not limited to the following examples:

the experimental methods used in the following examples are not specifically described, but the experimental methods in which specific conditions are not specified in the examples are generally carried out under conventional conditions, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

In the examples, the experimental procedures, which are not specified in particular conditions, are generally carried out according to conventional conditions, such as those described in the guidelines for molecular cloning experiments (J. Sambrook, D.W. Lassel, huang Peitang, wang Jiaxi, zhu Houchu, et cetera, third edition, beijing: science Press, 2002).

Reagents for upstream genetic engineering: the genome extraction kit, the plasmid extraction kit and the DNA purification recovery kit used in the examples of the present invention were purchased from corning life sciences (Wu Jiang) company; e.coli DH 5. Alpha. E.coli BL21 (DE 3), plasmid pET-24a (+) and the like are purchased from Shanghai Xueguan Biotech development Co., ltd; DNA markers, low molecular weight standard proteins, albumin glue, etc. were purchased from Beijing GenStar Co., ltd; primer synthesis and sequence sequencing work are completed by catalpa in Hangzhou, optimago biotechnology company. The above methods of reagent use are referred to in the commercial specifications.

The invention detects the progress of the reaction by High Performance Liquid Chromatography (HPLC) and analyzes the product. The HPLC analysis method comprises the following steps: chromatographic column/AQ-C18; column temperature/40 ℃; flow rate/1 mL/min; detection wavelength/254 nm; mobile phase: 20mM K ₂ HPO ₄ KH is used ₂ PO ₄ The pH was adjusted to 7.0.

Example 1:

1. construction of prokaryotic expression System

The NrK gene fragment was synthesized by Hangzhou engine Co., ltd (SEQ ID NO. 1) and recombined onto a PUC57 vector. After double digestion with restriction enzymes NdeI and HindIII (available from New England Biolabs, NEB) for 4h at 37℃1% agarose gel electrophoresis separation and gel recovery (gel recovery kit available from Hayoeng Biotechnology Co., hangzhou). Then ligated with the expression vector pET28a (+) (Novage) also digested with double enzymes, under the action of T4 DNA ligase (available from Takara) overnight in a low temperature ligation apparatus. BL21 (DE 3) competent cells are transformed by the connecting solution, colony PCR screening and sequencing verification are carried out, and thus, the positive recombinant plasmid NrK-pET28a (+) is obtained. The positive transformant containing the Nrk gene was designated as engineering bacterium Nrk001, and stored at-80 ℃.

2. Construction of Nicotinamide ribokinase mutant library

In the first round, the nicotinamide riboside kinase gene obtained by total gene synthesis and optimized by the codon is used as a template, primers for mutating D140S in table 1 are respectively used, and the dominant strain is a mutant with D140S mutation through site-directed mutagenesis PCR, transformation and plating, and the plasmid of the dominant mutant is named as nicotinamide riboside kinase mutant Nrk001-D140S.

The second round takes mutant Nrk001-D140S as a template, primers for mutation R134H and mutation in table 1 are respectively used for carrying out site-directed mutagenesis PCR, transformation and plating, dominant bacteria are obtained through screening to obtain mutants with double mutation of D140S and R134H, and the plasmid of the dominant mutants is named as nicotinamide riboside kinase mutant Nrk001-D140S-R134H.

The third round uses mutant Nrk001-D140S-R134H as a template, primers for mutation Y136E in table 1 are respectively used, the dominant strain is obtained by site-directed mutagenesis PCR, transformation and plating, and the mutant with three mutations of D140S, R134H and Y136E is obtained by screening, and the plasmid of the dominant mutant is named as nicotinamide riboside kinase mutant Nrk001-D140S-R134H-Y136E.

The fourth round uses mutant Nrk001-D140S-R134H-Y136E as a template, primers for mutation T137V in table 1 are respectively used, the dominant strain is obtained through site-directed mutagenesis PCR, transformation and plating, and the dominant strain is obtained through screening and has four mutations of D140S, R H, Y136E and T137V, and the plasmid of the dominant mutant is named as nicotinamide riboside kinase mutant Nrk001-D140S-R134H-Y136E-T137V.

Wherein, the PCR reaction system is as follows:

2 x Phanta Max buffer: 25 μL;

dNTPs：1μL；

an upstream primer: 1 μl;

a downstream primer: 1 μl;

and (3) a template: 1 μl;

phanta Super-Fidelity DNA polymerase: 0.5. Mu.L;

ddH ₂ O：20.5μL。

PCR reaction conditions: pre-denaturation at 95℃for 5min; denaturation at 95℃for 15s, annealing at 56℃for 30s, extension at 72℃for 6min, and total circulation for 30 times; then extending for 10min at 72 ℃; preserving at 4 ℃.

The PCR results are respectively subjected to DNA agarose gel electrophoresis positive verification, and the results show that the amplified products are single bands with the sizes of about 1300 bp. And (3) carrying out Dpn I enzyme digestion on the PCR product to obtain a template, and purifying and recovering the amplified product by using a DNA recovery and purification kit, wherein the specific steps are described in the specification of the purification kit.

TABLE 1

Example 2: construction of genetically engineered bacterium expressing acetate kinase

1. Amplification of target Gene transaminase

Cloning acetate kinase gene from Pseudomonas genome, and designing corresponding upstream primer and downstream primer of PCR based on corresponding genome DNA sequence (SEQ ID NO. 3).

An upstream primer: ATGCATATGGCGAAGGTTCTGGCGGTTAA

A downstream primer: CTCGAGCAGGTTCGCCAGACGCATAACAT

PCR amplification system:

2 x Phanta Max buffer: 25 μL;

dNTPs：1μL；

an upstream primer: 1 μl;

a downstream primer: 1 μl;

and (3) a template: 1 μl;

phanta Super-Fidelity DNA polymerase: 0.5. Mu.L;

ddH ₂ O：20.5μL。

PCR reaction conditions: pre-denaturation at 95℃for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, extension at 72℃for 6min, and total circulation for 30 times; then extending for 10min at 72 ℃; preserving at 4 ℃.

The PCR results are respectively subjected to DNA agarose gel electrophoresis positive verification, and the results show that the amplified products are single bands with the sizes of about 1200 bp. And (3) carrying out Dpn I enzyme digestion on the PCR product to obtain a template, and purifying and recovering the amplified product by using a DNA recovery and purification kit, wherein the specific steps are described in the specification of the purification kit.

2. Construction of expression vector and engineering bacteria

The expression vector pET-28a (+) and the PCR amplified product are respectively subjected to double enzyme digestion by using corresponding restriction enzymes, and after enzyme digestion is finished, the enzyme digestion product is purified and recovered by using a DNA purification kit so as to remove the restriction enzymes and nucleotide fragments cut by the enzymes. The PCR amplified product after double enzyme digestion is connected to an expression vector pET-28a (+) with a corresponding notch by using T4 DNA ligase, the expression vector pET-28a (+) -gabT is constructed, the constructed expression vector is transformed into escherichia coli BL21 (DE 3), the escherichia coli BL21 is coated on an LB plate containing 50mg/ml kanamycin resistance, cultured for 8-12 h at 37 ℃, the clone extraction plasmid is randomly picked up for sequencing identification, and recombinant escherichia coli BL21 (DE)/pET-28 a (+) -gabT containing the expression recombinant plasmid pET-28a (+) -gabT is screened.

Example 3: cultivation of microorganisms

1. Culture of bacterial cells

After the engineering bacteria containing nicotinamide riboside kinase and acetate kinase genes are respectively streaked and activated by a plate, single colonies are selected and inoculated into 10mL LB liquid medium containing 50 mug/mL kanamycin, and shake culture is carried out for 10 hours at 37 ℃. Transfer to 50mL of LB liquid medium containing 50. Mu.g/mL kanamycin as well at 2% inoculum size, shake culture at 37℃to OD ₆₀₀ When the concentration reaches about 0.8, IPTG with the final concentration of 0.5mM is added, and shake culture is carried out for 12 hours at 28 ℃. After the culture is finished, centrifuging the culture solution at 8000rpm for 10min, discarding the supernatant, collecting thalli, and storing in an ultralow temperature refrigerator at-80 ℃ for later use.

2. Preparation of crude enzyme solution

Cells collected after the end of the culture were washed twice with phosphate buffer (50 mM) at pH 8, and then cells were resuspended in PBS (50 mM) at ph=8, and sonicated 30 times under disruption conditions: the power is 400W, the crushing is 2s, and the interval is 5s. The cell disruption solution is centrifuged at 8000rpm at 4 ℃ for 10min, and the precipitate is removed, and the obtained supernatant is crude enzyme solution.

3. Purification of enzymes

Combining the crude enzyme solution with Ni affinity chromatography resin equilibrated by a loading buffer (50 mM phosphate buffer with pH=8, wherein the buffer comprises 500mM NaCl and 20mM imidazole), then washing the crude enzyme solution to be basically free of impurity proteins by using a washing buffer (50 mM phosphate buffer with pH=8, wherein the buffer comprises 50mM imidazole and 500mM NaCl), then eluting and collecting target proteins by using an eluting buffer (50 mM phosphate buffer with pH=8, wherein the buffer comprises 200mM imidazole and 500mM NaCl), combining the target proteins after electrophoresis identification of purity and dialyzing the target proteins for 24 hours by using a dialysis buffer (50 mM phosphate buffer with pH=8), measuring the protein content of the trapped solution by using a Coomassie brilliant blue method, diluting the enzyme solution to a final concentration of 0.5mg/mL, subpackaging, and freezing the mixed enzyme solution at-80 ℃ to obtain recombinant pure enzyme.

Acetate kinase recombinant pure enzyme was also prepared as described above.

Example 4: determination of Nicotinamide ribokinase Activity

Definition of enzyme activity: in 1961, international conference on enzymology stipulated that 1 enzyme activity unit means the amount of enzyme converting 1. Mu. Mole of a substrate in 1 minute under a specific condition (30 ℃), or the amount of enzyme converting 1. Mu. Mole of the relevant group in the substrate.

The concentration of the substrate NR was 25g/L,100mM ATP,20mM anhydrous magnesium chloride, a proper amount of the crude enzyme supernatant was prepared, the volume was made up to 1mL with 50mM potassium phosphate buffer pH7.0, and the reaction was carried out under shaking at 40℃in a constant temperature metal bath reactor. After 10min of reaction, samples were taken and subjected to HPLC detection to calculate the enzyme activity.

Table 2: enzyme activity measurement results

Numbering device	Mutation type	Relative enzyme activity
			Control 1	Unmutated	1
E1	D140S	1.98
			E2	D140S-R134H	2.06
E3	D140S-R134H-Y136E	2.44
			E4	D140S-R134H-Y136E-T137V	3.74

Example 5: large-scale preparation of thalli

In the process of producing nicotinamide mononucleotide, a large amount of biocatalyst is required, so that large-scale preparation of thalli is required. The culture medium used was LB medium.

After the glycerol tube with the recombinant nicotinamide riboside kinase engineering bacteria is streaked and activated by a plate, single colonies are selected and inoculated into 50mL of LB liquid medium containing 50 mug/mL of kanamycin, and shake culture is carried out for 12 hours at 37 ℃. At an inoculum size of 2%Transfer to 1L fresh LB liquid medium also containing 50. Mu.g/mL kanamycin, shake culture at 37℃to OD ₆₀₀ When the concentration reaches about 0.8, IPTG with the final concentration of 0.5mM is added, and shake culture is carried out at 28 ℃ for 16h. After the culture is finished, centrifuging the culture solution at 8000rpm for 10min, discarding the supernatant, collecting thalli, and storing in an ultralow temperature refrigerator at-80 ℃ for later use.

Example 6: preparation of nicotinamide mononucleotide by selecting acetate kinase

The genetically engineered bacteria capable of expressing acetate kinase were cultured in the same manner as in example 4, and the cells were collected by centrifugation.

Nicotinamide ribose is quantitatively weighed into 50mM phosphate buffer solution with pH=7.5, and the final concentration of the nicotinamide ribose is 100mM, the initial concentration of nicotinamide riboside kinase thallus is 10g/L, the concentration of acetate kinase thallus is 10g/L,10mM adenosine triphosphate and 10mM Mg are placed in a reaction container ²⁺ . The reaction temperature was controlled to 40℃by water bath, and the amount of NMN produced was measured by liquid chromatography with regular sampling, while the amount of NR reduction was measured by pre-column derivatization high performance liquid chromatography.

The reaction was completed for 3 hours, the conversion was 75%, and the yield was 67%.

Example 7:

enzyme activity determination: sequentially adding NR with the final concentration of 25g/L, ATP with the final concentration of 15g/L and anhydrous magnesium chloride with the final concentration of 10mM into 50mM potassium phosphate buffer with the pH of 7.0, magnetically stirring and incubating for 5min in a water bath at 40 ℃, adding enzyme solution (or enzyme freeze-dried powder) to be detected, reacting for 20min, and sampling for HPLC detection.

Thermal stability determination: after dissolving wild-type nicotinamide riboside kinase enzyme powder and nicotinamide riboside kinase mutant enzyme powder in 50mM sodium phosphate buffer of pH7.0, placing the mixture in a water bath at 50 ℃ for incubation for 15min, and centrifuging to obtain a supernatant for residual enzyme activity determination. The experimental results are shown in the following table, the thermal stability of the mutant is obviously improved, and the residual enzyme activity is improved from 14.05% of the wild type to 76.24% of the mutant; the unit enzyme activity is also improved unexpectedly, and is improved by 2.77 times compared with the wild type enzyme.

Example 8: preparation of nicotinamide mononucleotide by selecting nicotinamide riboside kinase mutant D140S-R134H-Y136E-T137V

A genetically engineered bacterium capable of expressing nicotinamide riboside kinase was cultured as described in example 4, and cells were collected by centrifugation.

Quantitative weighing nicotinamide riboside into 50mM phosphate buffer solution with pH=7.5, and placing into a reaction container to obtain final concentration of nicotinamide riboside of 100mM, mutant nicotinamide riboside kinase thallus concentration of 10g/L, acetate kinase thallus concentration of 10g/L,10mM adenosine triphosphate and 10mM Mg ²⁺ . The reaction temperature was controlled to 40℃by water bath, and the amount of NMN produced was measured by liquid chromatography with regular sampling, while the amount of NR reduction was measured by pre-column derivatization high performance liquid chromatography.

The reaction was completed for 3 hours, the conversion was 99%, and the yield was about 90%.

Example 9: preparation of nicotinamide mononucleotide by selecting nicotinamide riboside kinase mutant D140S-R134H-Y136E-T137V

Quantitative weighing nicotinamide riboside into 50mM phosphate buffer solution with pH=7.5, and placing into a reaction container to obtain final concentration of nicotinamide riboside of 200mM, mutant nicotinamide riboside kinase thallus concentration of 10g/L, acetate kinase thallus concentration of 10g/L,10mM adenosine triphosphate and 10mM Mg ²⁺ . The reaction temperature was controlled to 40℃by water bath, and the amount of NMN produced was measured by liquid chromatography with regular sampling, while the amount of NR reduction was measured by pre-column derivatization high performance liquid chromatography.

The reaction was completed for 3 hours, and the conversion was 99% and the yield was about 90%.

Example 10: selecting nicotinamide riboside kinase mutant D140S-R134H-Y136E-T137V (preparation of nicotinamide mononucleotide)

Nicotinamide ribose is quantitatively weighed into 50mM phosphate buffer solution with pH=7.5, and the final concentration of the nicotinamide ribose is 400mM in a reaction container, and mutant nicotinamide riboside kinase is obtainedThe concentration of the thallus is 10g/L, the concentration of the acetate kinase thallus is 10g/L,10mM adenosine triphosphate and 10mM Mg ²⁺ . The reaction temperature was controlled to 40℃by water bath, and the amount of NMN produced was measured by liquid chromatography with regular sampling, while the amount of NR reduction was measured by pre-column derivatization high performance liquid chromatography.

At the end of the 5 hour reaction, there was a substantial increase in initial substrate concentration and substrate inhibition, so the conversion was reduced to 95% with a yield of about 90%.

Finally, it should be noted that the above description is only for illustrating the technical solution of the present invention, and not for limiting the scope of the present invention, and that the simple modification and equivalent substitution of the technical solution of the present invention can be made by those skilled in the art without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A nicotinamide riboside kinase mutant with enhanced heat stability is obtained by single mutation or multi-point combined mutation of 140 th, 134 th, 136 th and 137 th of an amino acid sequence shown in SEQ ID NO. 2.

2. The nicotinamide riboside kinase mutant of claim 1, wherein the mutation is one or a combination of two or more of: (1) aspartic acid at position 140 to serine; (2) arginine at position 134 is mutated to histidine; (3) tyrosine 136 to glutamic acid; (4) mutation of threonine at position 137 to valine.

3. The nicotinamide riboside kinase mutant of claim 1, wherein the mutation is one of:

(1) Aspartic acid at position 140 to serine;

(2) Aspartic acid at position 140 to serine, arginine at position 134 to histidine;

(3) Aspartic acid at position 140 is mutated to serine, arginine at position 134 is mutated to histidine, and tyrosine at position 136 is mutated to glutamic acid;

(4) Aspartic acid at position 140 is mutated to serine, arginine at position 134 is mutated to histidine, tyrosine at position 136 is mutated to glutamic acid, and threonine at position 137 is mutated to valine.

4. A gene encoding the nicotinamide riboside kinase mutant of claim 1.

5. The coding gene according to claim 4, wherein the nucleotide sequence of the coding gene is shown in one of SEQ ID NO. 5-8.

6. A recombinant vector comprising a gene encoding the nicotinamide riboside kinase mutant of claim 1.

7. A genetically engineered bacterium comprising a gene encoding the nicotinamide riboside kinase mutant of claim 1.

8. Use of the nicotinamide riboside kinase mutant of claim 1 in the microbial catalysis of the preparation of β -nicotinamide mononucleotide.