CN116144636A - Chitin deacetylase mutant and encoding gene and application thereof - Google Patents

Abstract

The invention discloses a chitin deacetylase mutant, a coding gene and application thereof, which are prepared by culturing marine bacillusCyclobacterium marinum) The chitin deacetylase from the sources is subjected to directed evolution research, and the heat stability of the parent chitin deacetylase is screened by utilizing an advanced computer-aided rational design technology, so that a chitin deacetylase mutant A58C/133C with remarkably improved heat stability is finally obtained. The half-life of the mutant A58C/133C is 1.3 times of that of the wild chitin deacetylase at 50 ℃, and the yield of glucosamine is improved by 16%. Meanwhile, the principle of improving the thermal stability is explained in a molecular level by means of a computer simulation technology. Compared with wild chitin deacetylase, the mutant obtained by the invention is more suitable for the industrial application of glucosamine, and has good market application prospect and industrial value.

Description

Chitin deacetylase mutant and encoding gene and application thereof

Technical Field

The invention belongs to the technical fields of genetic engineering and enzyme engineering, and in particular relates to a chitin deacetylase mutant and a coding gene and application thereof.

Background

Glucosamine (GlcN), 2-amino-2-deoxy-D-glucose, is a monosaccharide derivative produced by substitution of the amino group of the hydroxyl group No.2 in the glucose molecule, which is the first amino sugar found. GlcN is widely found in nature and is usually present in microorganisms in the form of N-acetyl (chitin) or N-acetyl-3-O-lactic ether (muramic acid) or N-sulfate, and is abundant in chitin and chitosan in fungal cell walls and exoskeletons of shrimp and crab. Chitin is not only a constituent of the cell wall, but also protects organisms from exogenous physical or biological attack. Glucosamine is an important precursor in the biochemical synthesis of glycoproteins or glycolipids in animals and humans. GlcN is an important nutrient for the formation of chondrocytes in humans and animals, and plays an important role in cartilage tissue formation, and studies have found that the formation of the crystalline lens of the human eye is also involved in this class of substances. The research shows that GlcN has the effects of preventing and treating arthritis, resisting oxidation, resisting tumor and the like, and has wide application in the fields of food health care and medicine.

Chitin is a linear polysaccharide linked by N-acetyl-D-glucosamine through β - (1, 4) -glycosidic bonds, and chitin deacetylase (abbreviated as CDA) is an enzyme that catalyzes the hydrolysis of acetyl groups in chitin or chitin oligosaccharides to produce chitosan. CDA is widely found in bacteria, fungi and insects and plays an important role in chitin metabolism. CDA plays an important role in plant interactions with pathogens, such as pathogens protecting themselves from degradation by plant host chitinase by expressing CDA, while allowing hyphae to successfully penetrate the plant cell wall.

Most of the natural proteins are not heat-resistant, and in order to achieve the purpose of industrial application, the stability of chitin deacetylase at normal temperature must be improved.

Disclosure of Invention

The technical problems to be solved are as follows: aiming at the technical problems, the invention provides a chitin deacetylase mutant, and a coding gene and application thereof, which can effectively solve the defects of poor heat stability and the like of the chitin deacetylase.

The technical scheme is as follows: in a first aspect, the invention provides a chitin deacetylase mutant comprising an alanine mutation at position 58 to cysteine and a phenylalanine mutation at position 133 to cysteine, the mutant having an amino acid sequence as set forth in SEQ ID NO: 3.

In a second aspect, the invention provides a coding gene of the chitin deacetylase mutant of the first aspect, wherein the coding gene comprises a mutation from G at position 172 to T, a mutation from C at position 173 to G and a mutation from T at position 398 to G, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 4.

In a third aspect, the present invention provides a recombinant expression vector comprising the gene encoding the chitin deacetylase mutant of the second aspect.

In a fourth aspect, the present invention provides a genetically engineered bacterium comprising the recombinant expression vector of the third aspect.

In a fifth aspect, the present invention provides a method for preparing the chitin deacetylase mutant according to the first aspect, comprising the steps of:

s1, determining mutation sites: taking alanine at 58 th position and phenylalanine at 133 th position of chitin deacetylase of the marine circular bacillus as disulfide bond mutation sites, wherein the amino acid sequence of the chitin deacetylase of the marine circular bacillus is shown as SEQ ID NO. 1;

s2, construction of chitin deacetylase mutants: and (3) taking a recombinant plasmid carrying a chitin deacetylase encoding gene from the marine circular bacillus as a template, performing full plasmid PCR reaction, designing a point mutation primer pair, constructing a site-directed mutant, and transferring the site-directed mutant into escherichia coli to obtain the mutant.

Preferably, the nucleotide sequence of the point mutation primer pair in the step S2 is shown as SEQ ID NO. 9-SEQ ID NO. 12.

In a sixth aspect, the invention provides an application of the chitin deacetylase mutant in the first aspect in preparing glucosamine, and an application of the prepared glucosamine in preparing health care products.

In a seventh aspect, the present invention provides the use of a chitin deacetylase mutant according to the first aspect for the preparation of a plant fungal control product.

The beneficial effects are that: the invention adopts a rational design method to treat the marine bacillusCyclobacterium marinum) The chitin deacetylase structure is subjected to predictive analysis, potential sites influencing enzyme stability are obtained through screening, the chitin deacetylase mutant is obtained through site-directed mutagenesis, and the half-life of the mutant A58C-F133C and the glucosamine yield are greatly improved. Chitin deacetylase and its catalytic products are currently used in a wide variety of fields, such as glucosamine in the fields of food care and medicine, and chitin deacetylase can also be used for plant disease control. The chitin deacetylase mutant with improved stability can be better applied to the fields.

Drawings

FIG. 1 is a predicted map of potential disulfide mutation sites of chitin deacetylase;

FIG. 2 is a gel electrophoresis diagram of whole plasmid PCR products;

FIG. 3 is an electrophoretogram of the mutant expressed purified protein;

FIG. 4 is a graph of TLC results of mutant and wild-type activity assays;

FIG. 5 is a graph showing the results of the enzymatic properties of mutant A58C/F133C under different conditions;

FIG. 6 is a mechanism diagram of improved stability of a molecular dynamics simulation mutant;

FIG. 7 is a graph showing the comparison of mutant and wild type chitin deacetylase catalyzed production of glucosamine from acetamido glucose.

Detailed Description

The invention is described in detail below with reference to the attached drawings and the specific embodiments:

main materials and reagents:

coli BL21 and plasmid pET30a (+) were purchased from Invitrogen corporation;

plasmid extraction kits, fragment purification recovery kits and restriction enzymes were purchased from Takara Bio-engineering (Dalian) Inc.;

kanamycin, ampicillin and IPTG were purchased from the company division of bioengineering (Shanghai);

protein Marker: blue Plus II Protein Marker (14-120 kDa) was purchased from Beijing all gold Biotechnology Co., ltd;

LB liquid medium: yeast powder 5.0g/L, tryptone 10.0g/L and NaCl 10.0g/L;

LB solid medium: on the basis of the basic formula of LB liquid medium, 1.0% -2.0% (m/v) agar is added.

Example 1: disulfide mutation site prediction and site-directed mutagenesis

Computer aided design predicts disulfide bonds: the protein with higher homology with chitin deacetylase CmCBDA is found out from a PDB database, and then is taken as a template for homology modeling; wherein the amino acid sequence of the chitin deacetylase CmCBDA is shown in SEQ ID NO. 1:

SEQ ID NO.1：

MNAAQKLGFTESTKLLIIHADDAGLAHAENRATIQSLQKGIVNSYSIMVPCPWFYEMAIFAKNNNQYDNGVHLTLTCEWENYRFGPVLPISEVPSLVDENGYFFKKRDKLAQNAKAEHVEKELTAQIERALKFGIKPTHIDSHMYSVGAKPEFLNVYRRIAKKYKLPLVLNQQLFEMVGLEMDLSDFKDELLIDNVFMGEFKYFEKGELANFYATALDKMEGGLNLILIHPAFDDDEMKGITINHPNFCGSEWRQIDFDFFTSEEAQSKLKEQNIQLITWDEIREKIYKD

by analyzing the protein structure, the mutation site which is positioned in the chitin deacetylase protein and can form disulfide bond is found out, and the site affecting the enzyme activity is eliminated. The specific method comprises the following steps: by searching the protein database RCSB database, a protein 2E67 (PDB number, 31% homology) with high homology to the chitin deacetylase was found by blast comparison, and a spatial structure simulation was performed on CmCBDA using the software Swiss-model. And evaluating the constructed model by using online software SAVES, optimizing the evaluated model by using online software Chiron, and finally re-evaluating the optimized model by using SAVES software. And simultaneously, the structure of the material is predicted by using on-line software AI Lab. And taking the PDB file with the CmCBDA crystal structure as a parent, and introducing the PDB file into the Pymol to obtain the protein three-dimensional structure. The chitin deacetylase was disulfide screened using disulfide prediction software Disulfide by Design and BridgeD using 2E67 as a template. Three pairs of disulfide bond sites, serine at position 44 and aspartic acid at position 68, threonine at position 138 and tryptophan at position 279, and alanine at position 58 and phenylalanine at position 133 were predicted and determined, respectively, as shown in FIG. 1.

Site-directed mutagenesis: six sites were subjected to point mutation by whole plasmid PCR. Primers were designed based on the nucleic acid sequence of chitin deacetylase (SEQ ID NO. 2),

SEQ ID NO.2：

atgaatgcagcacaaaaattaggttttacagaatctactaagctattaattatccatgcagatgatgcaggacttgctcatgctgaaaacagagcaaccattcaatccttacaaaaagggattgtaaattcgtacagtattatggtgccttgtccatggttttatgaaatggctatttttgcaaagaacaacaatcaatatgacaatggggtacacctgaccttaacctgtgaatgggaaaattatcggtttggaccggttctgcctatttcagaagttccaagtttagtggatgaaaatggctatttcttcaaaaaaagggataagttagcccaaaatgcaaaggctgaacacgttgaaaaagaacttaccgcacaaatagaaagagccttgaaatttggaattaaacctacccatatagattcccatatgtatagtgttggtgcaaagcctgaatttctaaatgtctatcgaaggatagcaaaaaaatacaaactgcctctggtgcttaatcaacagttatttgaaatggtaggtttagaaatggatctttccgattttaaagacgagttattgatcgataatgtatttatgggagagtttaagtattttgaaaaaggagaattagcaaatttttatgctactgccttggataaaatggagggagggttaaacttgattttaattcaccctgcttttgatgatgatgagatgaaaggaataactataaatcaccctaattttggttcagaatggaggcagattgactttgatttttttacttctgaggaggcccaatcaaaactcaaagaacaaaatattcaattgattacctgggatgaaattagggaaaaaatatataaagactaa

the PCR primers are shown in Table 1 below:

TABLE 1 mutant primer design Table based on the results of multiple sequence alignment

Note that: mutation sites are bolded and underlined

The site-directed mutant recombinant plasmid was subjected to whole plasmid PCR using the corresponding primers. The gel electrophoresis of the whole plasmid PCR products is shown in FIG. 2, from which it can be seen that PCR was successful. Digestion with DpnI and transformation into E.coli BL21, and sequencing by biological company to identify if mutation of mutation site is successful, wherein the amino acid sequence of mutant A58C/F133C is shown as SEQ ID NO.3,

SEQ ID NO.3：

MNAAQKLGFTESTKLLIIHADDAGLAHAENRATIQSLQKGIVNSYSIMVPCPWFYEMCIFAKNNNQYDNGVHLTLTCEWENYRFGPVLPISEVPSLVDENGYFFKKRDKLAQNAKAEHVEKELTAQIERALKCGIKPTHIDSHMYSVGAKPEFLNVYRRIAKKYKLPLVLNQQLFEMVGLEMDLSDFKDELLIDNVFMGEFKYFEKGELANFYATALDKMEGGLNLILIHPAFDDDEMKGITINHPNFCGSEWRQIDFDFFTSEEAQSKLKEQNIQLITWDEIREKIYKD

the nucleotide sequence of the mutant A58C/F133C is shown as SEQ ID NO.4,

SEQ ID NO.4：

atgaatgcagcacaaaaattaggttttacagaatctactaagctattaattatccatgcagatgatgcaggacttgctcatgctgaaaacagagcaaccattcaatccttacaaaaagggattgtaaattcgtacagtattatggtgccttgtccatggttttatgaaatgtgtatttttgcaaagaacaacaatcaatatgacaatggggtacacctgaccttaacctgtgaatgggaaaattatcggtttggaccggttctgcctatttcagaagttccaagtttagtggatgaaaatggctatttcttcaaaaaaagggataagttagcccaaaatgcaaaggctgaacacgttgaaaaagaacttaccgcacaaatagaaagagccttgaaatgtggaattaaacctacccatatagattcccatatgtatagtgttggtgcaaagcctgaatttctaaatgtctatcgaaggatagcaaaaaaatacaaactgcctctggtgcttaatcaacagttatttgaaatggtaggtttagaaatggatctttccgattttaaagacgagttattgatcgataatgtatttatgggagagtttaagtattttgaaaaaggagaattagcaaatttttatgctactgccttggataaaatggagggagggttaaacttgattttaattcaccctgcttttgatgatgatgagatgaaaggaataactataaatcaccctaattttggttcagaatggaggcagattgactttgatttttttacttctgaggaggcccaatcaaaactcaaagaacaaaatattcaattgattacctgggatgaaattagggaaaaaatatataaagactaa。

example 2: expression purification and enzyme Activity characterization of mutants

2.1 expression purification of mutant proteins

The recombinant mutant obtained in example 1 was subjected to overnight activation. The overnight cultured broth was inoculated into 400 mL fresh antibiotic-free LB liquid medium, and then the culture was continued at 37℃and 200 rpm. After two hours, the bacterial cell concentration a600 was measured with a sameimer-femeimeter. When OD is _A600 Adding 400 mu L of IPTG with the concentration of 1M into the residual bacterial liquid when the bacterial liquid is between 0.5 and 0.8, inducing protein expression, and then expressing for 24 hours at the temperature of 18 ℃ and the rotating speed of 200 rpm;

after the completion of the expression, the cells were collected by centrifugation at 4500 rpm for 10 minutes at 4℃and the supernatant was discarded. 10 mL lysis buffer was added to the cell pellet and the cells were suspended by pipetting several times. The lysis buffer contained 50mM Tris-HCl,100 mM NaCl,1% (volume ratio) Triton X-100 and the pH was adjusted to 8.0;

cells were disrupted and centrifuged at 12000 rpm at 4℃for 20 minutes, and the supernatant was collected. The column was equilibrated with a wash Buffer (50 mM Tris-HCl,50mM NaCl,pH 8.0) of 5 column volumes. The centrifuged supernatant was loaded, the target protein was then bound to the nickel column, and the Washing Buffer was used to wash the unbound hetero-proteins until the protein A280nm of the effluent solution was less than 0.1. Eluting the target with eluent (50 mM Tris-HCl,500 mM imidazole, 50mM NaCl,pH 8.0) and collecting the target protein; the specific expression and purification results are shown in FIG. 3, and it can be seen from the figure that all three mutants are over-expressed, and the mutant S44C/D68C forms a large number of inclusion bodies in the expression process and exists in a precipitate form.

2.2 Activity detection of mutants

The enzyme activity determination method comprises the following steps: in a reaction system of 50 mu L,500 mM N-acetylglucosamine is used as a substrate, enzyme solutions of wild chitin deacetylase or mutant A58C/F133C, S C/D68C or T138C/W279C with the final concentration of 20 mu M are respectively added, shake reaction is carried out for half an hour at 37 ℃, and the concentration of the product glucosamine is detected by an enzyme-labeled instrument and silica gel plate Thin Layer Chromatography (TLC). The enzyme activity calculation method comprises the following steps: the amount of enzyme required to produce 1. Mu. Mol of glucosamine per unit time;

the enzyme label instrument detects that the enzyme activity of only the A58C/F133C mutant is improved compared with that of the wild type, the enzyme activity of the other two mutants is not detected, and meanwhile, the detection result of the enzyme label instrument is verified by the result of detecting the enzyme activity by TLC, and the specific TLC detection result is shown in figure 4.

Example 3: thermal stability and enzymatic Properties of mutant A58C/F133C

To analyze whether the stability of the mutant was improved, the half-lives (T _1/2 ) And T

. Half-life was measured by incubating both wild-type and mutant enzyme solutions at 50℃for different times (0 min,30 min,1 h,2 h,4 h,6 h,12 h,24 h, and 48 h) and then measuring the half-life. T (T)

Refers to the temperature at which the enzyme is incubated at a different temperature for 30 minutes, with 50% of the enzyme activity remaining. The specific detection results are shown in the following table 2:

TABLE 2 half-life and T30 50 of mutant and wild type chitin deacetylases

As can be seen from table 2: the half-life period of mutant A58C/F133C is greatly improved, T

Also improves the temperature by 6.5 ℃;

the enzymatic properties of the mutants, including optimum reaction temperature, pH, storage stability at 4℃and the like, were analyzed by the microplate reader method. The specific detection results are shown in FIG. 5, and it can be seen from the graph that the optimal reaction pH and reaction temperature of the mutant are not changed, but the stability range is widened. The storage time of the mutant at 4 ℃ is also improved, the activity of the mutant is about 42% after 30 days, and the activity of the wild-type enzyme is about 20%.

Example 4: conformational change of mutant A58C/F133C at the molecular level

The newly formed disulfide bond A58C/F133C is positioned on the surface of the protein and away from the catalytic center of the enzyme, so that the heat stability of the enzyme is improved; in the mutant, the structure of random coil and alpha helix is limited by newly formed disulfide bond crosslinking, and the conformational entropy of unfolded state is reduced, so that the thermal stability of protein is improved;

protein structural changes before and after mutation introducing disulfide bond were simulated by means of Discovery studio 4.0. Molecular dynamics simulation was performed at 330K with a simulation time of 10 ns. As shown in FIG. 6 (A), the total molecular Root Mean Square Deviation (RMSD) of mutant A58C/F133C was higher than that before its mutation. This suggests that during heat treatment the structure becomes looser than the wild type structure, so the introduction of a58C/F133C8 disulfide bond improves the overall rigidity of the protein structure. As shown in FIG. 6 (B), the overall molecular Root Mean Square Fluctuation (RMSF) also indicates that the overall structure of A58C/F133C is more rigid than that of the wild-type, resulting in enhanced thermostability of the enzyme.

Example 5: application of mutant A58C/F133C in preparation of glucosamine

The mutant A58C/F133C with improved stability in example 4 was used in the preparation of the food supplement glucosamine. A reaction system of 1 mL was prepared in which the substrate concentration was 110 mg/mL, the enzyme concentration was maintained at 20. Mu.M, and the reaction was performed in phosphate buffer at 200 mM at pH8.0 for various time points (0 min,10 min,30 min,1 h,2 h,6 h,12 h,24 h,48 h). Meanwhile, wild chitin deacetylase is used as a positive control, and a reaction system without enzyme solution is used as a negative control. The specific reaction results are shown in FIG. 7. As can be seen from FIG. 7, the efficiency of producing the glucosamine by the mutant A58C/F133C is gradually higher than that of the wild-type enzyme with the extension of time, and the concentration of the glucosamine in the mutant reaction liquid can reach 55.6 mg/mL at 48 and h, while the yield of the wild-type chitin deacetylase is 45.1 mg/mL, and the yield is improved by 22.3%.

In conclusion, the mutant obtained by the invention has the advantages that on the basis of keeping the original enzyme specificity, the heat stability is obviously improved, and the application value is good.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.

Claims (9)

1. A chitin deacetylase mutant, characterized in that: the mutant comprises the mutation of alanine at position 58 into cysteine and the mutation of phenylalanine at position 133 into cysteine, and the amino acid sequence of the mutant is shown in SEQ ID NO: 3.

2. A gene encoding the chitin deacetylase mutant of claim 1, wherein: the coding gene comprises a mutation of G at 172 th to T, a mutation of C at 173 th to G and a mutation of T at 398 th to G, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 4.

3. A recombinant expression vector comprising the gene encoding the chitin deacetylase mutant of claim 2.

4. A genetically engineered bacterium comprising the recombinant expression vector of claim 3.

5. A method for preparing the chitin deacetylase mutant according to claim 1, comprising the steps of:

s1, determining mutation sites: taking alanine at 58 th position and phenylalanine at 133 th position of chitin deacetylase of the marine circular bacillus as disulfide bond mutation sites, wherein the amino acid sequence of the chitin deacetylase of the marine circular bacillus is shown as SEQ ID NO. 1;

s2, construction of chitin deacetylase mutants: and (3) taking a recombinant plasmid carrying a chitin deacetylase encoding gene from the marine circular bacillus as a template, performing full plasmid PCR reaction, designing a point mutation primer pair, constructing a site-directed mutant, and transferring into an expression strain to obtain the mutant.

6. The method of manufacturing according to claim 5, wherein: the nucleotide sequence of the point mutation primer pair in the step S2 is shown as SEQ ID NO. 9-SEQ ID NO. 12.

7. Use of the chitin deacetylase mutant according to claim 1 for the preparation of glucosamine.

8. Use of glucosamine prepared in accordance with claim 7 in the preparation of a health product.

9. Use of the chitin deacetylase mutant according to claim 1 for the preparation of a product for controlling fungi in plants.

Images